ID: 1175804690

View in Genome Browser
Species Human (GRCh38)
Location 20:61820948-61820970
Sequence CCTGGAGCCCAGGACACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175804690_1175804701 24 Left 1175804690 20:61820948-61820970 CCTGTTGTGTCCTGGGCTCCAGG No data
Right 1175804701 20:61820995-61821017 CTGTAGTTCTAGGATTTGCGGGG No data
1175804690_1175804698 22 Left 1175804690 20:61820948-61820970 CCTGTTGTGTCCTGGGCTCCAGG No data
Right 1175804698 20:61820993-61821015 TCCTGTAGTTCTAGGATTTGCGG No data
1175804690_1175804697 14 Left 1175804690 20:61820948-61820970 CCTGTTGTGTCCTGGGCTCCAGG No data
Right 1175804697 20:61820985-61821007 TCAGCATATCCTGTAGTTCTAGG No data
1175804690_1175804700 23 Left 1175804690 20:61820948-61820970 CCTGTTGTGTCCTGGGCTCCAGG No data
Right 1175804700 20:61820994-61821016 CCTGTAGTTCTAGGATTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175804690 Original CRISPR CCTGGAGCCCAGGACACAAC AGG (reversed) Intronic