ID: 1175804700

View in Genome Browser
Species Human (GRCh38)
Location 20:61820994-61821016
Sequence CCTGTAGTTCTAGGATTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175804690_1175804700 23 Left 1175804690 20:61820948-61820970 CCTGTTGTGTCCTGGGCTCCAGG No data
Right 1175804700 20:61820994-61821016 CCTGTAGTTCTAGGATTTGCGGG No data
1175804695_1175804700 5 Left 1175804695 20:61820966-61820988 CCAGGTACAGTGCTGGGCCTCAG No data
Right 1175804700 20:61820994-61821016 CCTGTAGTTCTAGGATTTGCGGG No data
1175804692_1175804700 13 Left 1175804692 20:61820958-61820980 CCTGGGCTCCAGGTACAGTGCTG No data
Right 1175804700 20:61820994-61821016 CCTGTAGTTCTAGGATTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175804700 Original CRISPR CCTGTAGTTCTAGGATTTGC GGG Intronic