ID: 1175806025

View in Genome Browser
Species Human (GRCh38)
Location 20:61829878-61829900
Sequence CTCGTCCCTCCCACCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 408}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175806025_1175806034 6 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806034 20:61829907-61829929 GCCCGGCCGGCCCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 58
4: 503
1175806025_1175806042 18 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806042 20:61829919-61829941 CTGGGGCTGGGAGGCAGGTGTGG 0: 1
1: 3
2: 23
3: 214
4: 1628
1175806025_1175806044 28 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806044 20:61829929-61829951 GAGGCAGGTGTGGGAAGTGCAGG 0: 1
1: 0
2: 4
3: 88
4: 772
1175806025_1175806028 -7 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806028 20:61829894-61829916 GGACGAGGCTCCTGCCCGGCCGG 0: 1
1: 0
2: 1
3: 17
4: 283
1175806025_1175806030 0 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806030 20:61829901-61829923 GCTCCTGCCCGGCCGGCCCTGGG 0: 1
1: 0
2: 5
3: 25
4: 309
1175806025_1175806039 13 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806039 20:61829914-61829936 CGGCCCTGGGGCTGGGAGGCAGG 0: 1
1: 1
2: 9
3: 109
4: 901
1175806025_1175806029 -1 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806029 20:61829900-61829922 GGCTCCTGCCCGGCCGGCCCTGG 0: 1
1: 0
2: 3
3: 55
4: 424
1175806025_1175806031 1 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806031 20:61829902-61829924 CTCCTGCCCGGCCGGCCCTGGGG 0: 1
1: 0
2: 4
3: 47
4: 335
1175806025_1175806043 19 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806043 20:61829920-61829942 TGGGGCTGGGAGGCAGGTGTGGG 0: 1
1: 0
2: 17
3: 140
4: 1214
1175806025_1175806033 5 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806033 20:61829906-61829928 TGCCCGGCCGGCCCTGGGGCTGG 0: 1
1: 0
2: 0
3: 43
4: 490
1175806025_1175806037 9 Left 1175806025 20:61829878-61829900 CCTGCTGGGGTGGGAGGGACGAG 0: 1
1: 1
2: 4
3: 31
4: 408
Right 1175806037 20:61829910-61829932 CGGCCGGCCCTGGGGCTGGGAGG 0: 1
1: 0
2: 6
3: 65
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175806025 Original CRISPR CTCGTCCCTCCCACCCCAGC AGG (reversed) Intronic
900150020 1:1174159-1174181 CCCAGCCCTCCCACCCCACCGGG - Intronic
900408422 1:2502418-2502440 CTCTTCTCTGCCACCGCAGCTGG - Intronic
900526188 1:3129988-3130010 CACTGCCCTCCCAGCCCAGCTGG - Intronic
901082587 1:6591900-6591922 CTCGGCCTTCCCAGCACAGCAGG + Exonic
901473502 1:9473531-9473553 CTCCTACCTCCCACCCCTGCAGG + Intergenic
901679809 1:10906413-10906435 CCCCTTCCTCCCACCCCAGTGGG - Intergenic
902616465 1:17626108-17626130 CTCCTCCCTCCTACCCCAGGAGG - Intronic
902659124 1:17889238-17889260 CTCGTCCCTCCCACAACACATGG + Intergenic
902877356 1:19348967-19348989 CTCGACCCTCAGACCCCAGGGGG + Intronic
903064342 1:20690335-20690357 CTGGTCCCTCCCACCCCCCCAGG - Exonic
905592167 1:39173602-39173624 CTCTTCCCTCCCTGCCCAGAGGG - Intronic
905751423 1:40467970-40467992 ATCTTCCGTCCAACCCCAGCAGG + Intergenic
906032348 1:42731820-42731842 CCCGCCCCCCCCACCCCAGAAGG - Intergenic
906057997 1:42930962-42930984 CCCCTACCTCCCACCCCATCTGG + Intronic
906495411 1:46301822-46301844 CTCCTGCCCCCCTCCCCAGCAGG + Intronic
906614920 1:47227474-47227496 ACCATCCCTCCCACCCCAGAAGG + Intronic
907284513 1:53371221-53371243 CTGCTGCCCCCCACCCCAGCCGG + Intergenic
907526703 1:55057978-55058000 CCCGGCCCTCCTGCCCCAGCAGG - Intronic
908410826 1:63863087-63863109 CTCCTGACTCCCACACCAGCAGG + Intronic
908515062 1:64884088-64884110 CTGGTTCCTACCACCCCAGGAGG + Intronic
909914337 1:81298872-81298894 ATTGTCCCTACCACCCCAGAAGG - Intergenic
910070418 1:83206994-83207016 TTGGCCCCTCCCACCCCACCGGG - Intergenic
911039661 1:93581985-93582007 CTTCTCCCACCCACCCCTGCTGG - Intronic
913071712 1:115304794-115304816 CCTGGCCCTTCCACCCCAGCGGG + Intronic
913611157 1:120510999-120511021 CTCCTACCTCCCACCATAGCTGG - Intergenic
913983639 1:143545814-143545836 CTCCTACCTCCCACCATAGCTGG + Intergenic
914580033 1:149011240-149011262 CTCCTACCTCCCACCATAGCTGG + Intronic
916824473 1:168430646-168430668 CTCCTCTCTGCCACCCCAGTTGG - Intergenic
917772534 1:178295365-178295387 CTCACCCCTCACCCCCCAGCAGG + Intronic
918662489 1:187106685-187106707 CTCCTCCCACCCTCCCCAGTAGG + Intergenic
919182658 1:194104833-194104855 CTCGCTGCTCCCAGCCCAGCAGG + Intergenic
920917901 1:210272851-210272873 CCCGTCCCTTCCATCCCACCCGG - Intergenic
920964888 1:210693435-210693457 CTCCTCCCACCCACCCAAGTGGG - Intronic
922196263 1:223363246-223363268 CCAGGCCCTCCCACCACAGCTGG + Intronic
923047034 1:230362915-230362937 CTCGTCCCACCCACCCACTCAGG - Intronic
923113775 1:230914868-230914890 ATTGACCTTCCCACCCCAGCAGG - Intronic
923484117 1:234412873-234412895 CAGGCCCCTTCCACCCCAGCAGG + Intronic
924358467 1:243209789-243209811 CTCCTACCTCCCACCTCAGTAGG - Intronic
924422422 1:243922193-243922215 CTCTTCCCTCCCACAACAGAAGG - Intergenic
924817988 1:247459713-247459735 CTCCTCCCTCCATCCCCAGAAGG - Intergenic
1063375807 10:5553637-5553659 CTCCTCCCTCCCAGCCCCACAGG + Intergenic
1063614870 10:7592843-7592865 GCTGTCCCTCCCATCCCAGCCGG - Intronic
1063972236 10:11389225-11389247 CTCCTCCATCCAACACCAGCAGG + Intergenic
1064848534 10:19683926-19683948 CTTGTCCCTCACCCCCCAGCAGG + Intronic
1064849924 10:19699034-19699056 CTTGTCCCTCACCCCCCAACAGG - Intronic
1066059039 10:31706262-31706284 ATCGTTCCTGCCACTCCAGCGGG + Intergenic
1066411985 10:35180802-35180824 CTCGTCCCCCCGTCCCCAGAGGG + Intronic
1066596759 10:37059387-37059409 ATTTTCCCTCCCACCACAGCAGG - Intergenic
1066818727 10:39456017-39456039 CTCTTCCCAGCCACCCCATCTGG - Intergenic
1067287595 10:44918194-44918216 CTGGTCCCTCCCACAACAGGTGG + Intronic
1071549937 10:86559169-86559191 CTGGTCCCTCCCACCACATATGG + Intergenic
1071603885 10:86971671-86971693 CGCGCCCCTCACGCCCCAGCGGG + Intronic
1072587913 10:96799012-96799034 CTCACTACTCCCACCCCAGCTGG + Intergenic
1072946480 10:99815094-99815116 CTCGCCCCTCACTCCCCAACAGG + Intronic
1073936210 10:108635561-108635583 CTCGCCCCTCTCCCCCCAACAGG + Intergenic
1075256134 10:120927093-120927115 CTCCAGTCTCCCACCCCAGCAGG - Intergenic
1075451237 10:122553145-122553167 CTTCTCCCTCCCACCCCTGATGG - Intergenic
1075802151 10:125160385-125160407 CCCGCCCCTCCCACCCCACCCGG + Intronic
1076350866 10:129814374-129814396 CTTGGCCCTCCCACCCTGGCAGG + Intergenic
1076794281 10:132791203-132791225 CTCTCCCCTCCCACCCCACCTGG - Intergenic
1077039759 11:514639-514661 CTCCTCACTCCCTCCCCAACTGG - Intergenic
1077218592 11:1405291-1405313 CACACACCTCCCACCCCAGCTGG - Intronic
1077551157 11:3200892-3200914 CTCATTCCTCCCTTCCCAGCAGG - Intergenic
1078101757 11:8334283-8334305 CTCATCCTTCCCACCCTAGGAGG + Intergenic
1079409555 11:20174614-20174636 CTGGTCCCTCCCACAACAGGTGG - Intergenic
1081806901 11:45895914-45895936 CTCCCCACTTCCACCCCAGCTGG + Intronic
1081967233 11:47177268-47177290 CTCGTCCCTCCGGCCCGAACGGG + Intergenic
1083297818 11:61724724-61724746 ATATTCCCTCCCAGCCCAGCTGG + Intronic
1083662669 11:64259039-64259061 CTCGTCCATGCCTGCCCAGCTGG + Exonic
1083794230 11:65005439-65005461 CTCTGCCCCCCGACCCCAGCCGG - Intergenic
1084009059 11:66337730-66337752 CTGGGCCCTCCCACTCCATCTGG - Exonic
1084111221 11:67015300-67015322 CAAGTCCCTGCCACCCCTGCTGG + Intronic
1084370775 11:68741274-68741296 CTCCTCGCTGCCACCACAGCAGG + Intronic
1084954796 11:72685484-72685506 CTGCTGCCTCCCACCCCTGCCGG + Exonic
1085307482 11:75496162-75496184 CTGGGCCCTCCCAGCCTAGCCGG - Intronic
1088326799 11:108609129-108609151 CTCTTCACACCCACCCCAGTGGG + Intergenic
1089273337 11:117316073-117316095 CCCGCCCCTCCCAGCCCCGCCGG - Exonic
1089614449 11:119687376-119687398 ATCGCCCCTCCCACCACCGCTGG + Intronic
1090207095 11:124891413-124891435 CAGGCGCCTCCCACCCCAGCTGG - Exonic
1090948718 11:131453825-131453847 CATGTCCCTCCCACACCAGCAGG + Intronic
1091460908 12:642967-642989 CCCGGCCCTCCCTCCCCAGCTGG + Intronic
1092008681 12:5090285-5090307 CTCCCCCCACCCACCCCAGAAGG - Intergenic
1092365506 12:7873310-7873332 CTGGGCCTTCCCAGCCCAGCCGG - Intronic
1092926438 12:13276449-13276471 CTCTTCTGTCCCACCCCATCTGG - Intergenic
1094625849 12:32123492-32123514 CTCTTCCTTCCCACCATAGCAGG + Intronic
1095857929 12:46881704-46881726 CTCGTCCCCCACTCCCCAACAGG - Intergenic
1095955753 12:47804888-47804910 CTTGGTCCTCCCTCCCCAGCAGG + Intronic
1096000135 12:48122508-48122530 CTGATCCCTCCCACCCCAATTGG - Intronic
1096695435 12:53345443-53345465 CTCTTCCCAGCCACCACAGCTGG - Intergenic
1098476334 12:70908590-70908612 CTGGTCCCTCCCACAACAGGTGG + Intronic
1100926793 12:99558021-99558043 CTCGGCCCCTCCACCACAGCAGG - Intronic
1101128712 12:101666326-101666348 CCTGTCTCTGCCACCCCAGCAGG - Intronic
1101563907 12:105886863-105886885 CTAGCCCCTCCCACCTCATCAGG - Intergenic
1101606162 12:106248426-106248448 TTCGTCCCTCCGACCCCGCCTGG - Intronic
1101708570 12:107243585-107243607 CCCGACACTCCCAGCCCAGCTGG + Intergenic
1101823789 12:108204567-108204589 CGCGCCCCTCCCACCACAGATGG - Intronic
1101876176 12:108598123-108598145 CTCCTTCCTCCCTCCCCGGCTGG + Exonic
1102554468 12:113717856-113717878 TTCCTACCTCCCTCCCCAGCAGG - Intergenic
1103617967 12:122167052-122167074 CTGGTGCCCCCCACCCCAGACGG - Intergenic
1104107825 12:125680510-125680532 CTCCTCCCTCACCCCCCAGAGGG + Intergenic
1104107877 12:125680672-125680694 CTCCTCCCTCACCCCCCAGAGGG + Intergenic
1104107902 12:125680737-125680759 CTCCTCCCTCACCCCCCAGAGGG + Intergenic
1104662325 12:130620297-130620319 CCACTCCCTCCCACCCCAGGCGG + Intronic
1104678064 12:130729271-130729293 CCCGTCACACCCACCCCTGCTGG - Intergenic
1104679502 12:130739718-130739740 TTCGTCCCTCCCACCCTGGAAGG + Intergenic
1104831002 12:131751404-131751426 CTCCAGCCTCCCACCTCAGCAGG - Intronic
1104895753 12:132162918-132162940 CCCTGCCCTCCCAGCCCAGCTGG + Intergenic
1106098342 13:26670339-26670361 CTTGTCCCTCACCCCCCAACAGG - Intronic
1106112782 13:26791751-26791773 CTGGTCCCTCCCACAACAGTTGG - Intergenic
1106130241 13:26933699-26933721 CTCAGCCCTCCCACCCCATGAGG + Intergenic
1106280082 13:28259334-28259356 CTCGGCTCTGTCACCCCAGCTGG + Intronic
1109907649 13:68865774-68865796 CCCCTCCATCCCAGCCCAGCAGG + Intergenic
1111266033 13:85814710-85814732 CTCTTTCCTCCCACCCCAACAGG + Intergenic
1112071253 13:95852972-95852994 CTGGTCCCTCCCACAACAGGTGG - Intronic
1112967198 13:105211534-105211556 CACGGGCCTCCCTCCCCAGCTGG + Intergenic
1113654865 13:112061664-112061686 CTGTTCCCACCCAGCCCAGCTGG - Intergenic
1113723010 13:112574935-112574957 TTCCTCCCTCCCTCCCCACCTGG - Intronic
1114664057 14:24368294-24368316 CTCCCCCCTCCCACCCAGGCCGG + Exonic
1115169347 14:30486463-30486485 CTTGTCCCTCCCTCCACACCTGG - Intergenic
1116305721 14:43253805-43253827 CTCGCCCCACCCACCTCACCGGG - Intergenic
1116779986 14:49226649-49226671 CTCATCTCTTCCACCCCTGCAGG + Intergenic
1117762046 14:59039360-59039382 CTGGTCCCTCCCACAACACCTGG - Intergenic
1117921361 14:60728181-60728203 TTCGTCCCTCCCACCCCTTTTGG - Intergenic
1121222838 14:92299377-92299399 CTCCTCCCTCCCACCCCCACAGG - Intergenic
1121442044 14:93955574-93955596 CTCCTCCCTTCCACTTCAGCTGG - Intronic
1122136036 14:99633491-99633513 CTCATCCCTCCCAACTCTGCAGG - Intergenic
1122884062 14:104702757-104702779 CCCCTGCCTCCCACCCCATCTGG - Intronic
1124347153 15:28930552-28930574 CACAGCCCTCCCTCCCCAGCCGG - Intronic
1124545914 15:30626373-30626395 CTCGCTCCTCCAGCCCCAGCAGG - Exonic
1124779432 15:32615760-32615782 CTCGCTCCTCCAGCCCCAGCAGG - Exonic
1129460523 15:75698111-75698133 CAGGGCCCTCCCTCCCCAGCAGG - Intronic
1129463324 15:75710713-75710735 GGCGTCCCTCCCACCCCTCCTGG - Intronic
1129524275 15:76204106-76204128 CTCGCCCGGCCCAGCCCAGCGGG + Exonic
1129720472 15:77875241-77875263 CTGTGCCCACCCACCCCAGCCGG - Intergenic
1129721563 15:77880689-77880711 GGCGTCCCTCCCACCCCTCCCGG + Intergenic
1129724340 15:77893925-77893947 CAGGGCCCTCCCTCCCCAGCAGG + Intergenic
1130538561 15:84804158-84804180 CACTTCCCTGCCTCCCCAGCTGG + Exonic
1130822181 15:87507434-87507456 CTGGTCCCTCCCACCACACATGG + Intergenic
1131021657 15:89104291-89104313 CTCGGCCCACTCACCCCAGCTGG - Intronic
1131743784 15:95422576-95422598 CTGGTCCCTCCCACAGCAGGTGG + Intergenic
1132662583 16:1068239-1068261 TTGGTCCCACCCACCCCAGGAGG + Intergenic
1132711845 16:1272341-1272363 CAGGTCCCTCCCACCTCACCCGG - Intergenic
1132996792 16:2827681-2827703 CAAGTCCCCCCAACCCCAGCTGG + Intergenic
1133791601 16:9013360-9013382 TGCTTCCCTCCCACCCCTGCAGG - Intergenic
1136622132 16:31436313-31436335 CTCCACGCTCCCACCCCTGCAGG + Exonic
1137707447 16:50545362-50545384 CTGGTGCCTCCCAGCCCAGCAGG - Intergenic
1138226775 16:55302732-55302754 CTCCTCCCTGCCATCCCTGCTGG + Intergenic
1138247587 16:55479144-55479166 CAGCTCCCTCCCAGCCCAGCCGG + Exonic
1138453198 16:57105977-57105999 CCCTCCCCTCCTACCCCAGCAGG - Intronic
1138963138 16:62051362-62051384 CACGTCCCTGCCACCACACCTGG - Intergenic
1139790586 16:69431139-69431161 CAGGTCCCTCCCACCACACCTGG + Intronic
1140810174 16:78569137-78569159 TTCTTCCCTCCCACCCCAACAGG - Intronic
1140914937 16:79484527-79484549 CCCTTCCCTCCCACCATAGCAGG - Intergenic
1141631813 16:85291846-85291868 CTCGTCCCTCTCACCACAAAGGG + Intergenic
1142108074 16:88316989-88317011 ATTCTCCCTCCCAACCCAGCTGG + Intergenic
1142223213 16:88865262-88865284 CTCTTCCCTCCAACCCCAGCGGG - Intronic
1142232738 16:88907363-88907385 CTGACCCCACCCACCCCAGCAGG - Intronic
1142243970 16:88960218-88960240 CCCTGCCCTCCCAGCCCAGCAGG - Intronic
1142620459 17:1162406-1162428 ATCCTCTCTTCCACCCCAGCAGG + Intronic
1142764874 17:2059241-2059263 CCCGACGCTCCGACCCCAGCGGG - Exonic
1142959309 17:3542745-3542767 CTTGGCCCTCCCAGCCCAGAGGG + Intronic
1143174766 17:4949601-4949623 CCCGTCCCGCCCTCCCCAGGTGG - Intronic
1143674068 17:8417873-8417895 TACTTCTCTCCCACCCCAGCAGG - Intronic
1146176291 17:30668155-30668177 CTCTTCCCACCTTCCCCAGCCGG - Intergenic
1146349746 17:32084265-32084287 CTCTTCCCACCTTCCCCAGCCGG - Intergenic
1147535966 17:41323632-41323654 CTCCTCCCTGGCACCCCTGCAGG + Intergenic
1147988647 17:44320436-44320458 CTCTCCCCGCCCACCCCACCAGG - Exonic
1148688412 17:49513313-49513335 CCAGCCCCTCCCACCACAGCAGG + Exonic
1148698633 17:49575664-49575686 CTCGTCCCTCCCACCGGCGGCGG - Intergenic
1148732468 17:49845864-49845886 TGCTTCCCTCCCACCCCACCAGG + Intronic
1148764474 17:50029122-50029144 CACCTGCCTCCCACCCCACCTGG + Intergenic
1148985743 17:51619474-51619496 CTCACCCCTCCCACCCAAGTTGG - Intergenic
1149317655 17:55453696-55453718 CTGTTCCCTCCCACCCCTGCAGG + Intergenic
1149470650 17:56913108-56913130 CTCGTCCCTCTCACCCAAGCTGG - Intronic
1149595384 17:57861977-57861999 CTCGTCCCGCCCACCCTGCCCGG - Exonic
1149991488 17:61385973-61385995 CTCCAGCCTCCCTCCCCAGCAGG - Intronic
1150660577 17:67072650-67072672 CTCCTCACTCTCACCCCTGCTGG - Exonic
1151456780 17:74231189-74231211 CCCATCCCTGCCACCCCTGCAGG - Intronic
1151560212 17:74865948-74865970 CTGGTCCCTCCTCCCCCACCTGG + Intronic
1151569176 17:74917576-74917598 CTCCTCCCGTCCACCCCAGAGGG - Exonic
1151691913 17:75691743-75691765 CTCCTCCCTCACCCGCCAGCTGG - Intronic
1151880158 17:76889871-76889893 CACCTCCCTCCCAGCCCGGCAGG - Intronic
1151956442 17:77382557-77382579 CTGGTCCCTCCCAGCCCTCCAGG - Intronic
1152071839 17:78137983-78138005 CTGGACCCTCCCATCCCTGCAGG + Exonic
1152214739 17:79025374-79025396 TTCCTCCCTCCCTCCCAAGCAGG - Intronic
1152422955 17:80203912-80203934 CTCTTCCAGCCCACCCCAGTGGG - Intronic
1152525806 17:80887651-80887673 CTCCTCTCTCCCACCCCAGAGGG - Intronic
1152600065 17:81257801-81257823 CTCGTCCCCGCTCCCCCAGCGGG - Intronic
1152663116 17:81552132-81552154 CCGGTCCCTCCCGCCCCCGCGGG + Intronic
1155840049 18:30632511-30632533 CTCCTCCCTCCCCTCTCAGCTGG - Intergenic
1156460630 18:37319540-37319562 CTCTGCCCTCCAGCCCCAGCAGG - Intronic
1156490293 18:37492031-37492053 CTCCCTCCTCCCACCCCAGCTGG + Intronic
1157095498 18:44682374-44682396 CTCCGCCTTCCCATCCCAGCTGG - Intronic
1157334970 18:46731478-46731500 CACCTCCCTCTCGCCCCAGCAGG + Intronic
1157816966 18:50736505-50736527 CTCGCCCCACCCTCCCCAGCTGG - Intergenic
1158269035 18:55692884-55692906 CTGGTTCCTCAGACCCCAGCAGG + Intergenic
1158858395 18:61567480-61567502 CTCCTCCCACCCTCCCCAACAGG + Intergenic
1159002534 18:62987039-62987061 CTCCTCCCTGCCACCCAAACAGG + Intergenic
1159022578 18:63155598-63155620 CTCTTCCCTCCCAAGCCAACAGG - Intronic
1159785783 18:72712671-72712693 CTCGTCCCTCCCACAACACATGG + Intergenic
1160551189 18:79694519-79694541 CCCCACACTCCCACCCCAGCCGG - Intronic
1160551216 18:79694615-79694637 CCCCACACTCCCACCCCAGCCGG - Intronic
1160718180 19:585798-585820 CTCTTACCCCCCACCCCAGTGGG + Intergenic
1160809465 19:1007218-1007240 CTCGCTCTTCCCACCCCAGGCGG - Intronic
1161379247 19:3955973-3955995 CTGGTCCGCCCCTCCCCAGCAGG + Intergenic
1161576826 19:5059034-5059056 CGGGTCCCTCCCACTGCAGCCGG + Intronic
1162205708 19:9054738-9054760 CTCATCCCTTCCACCCAACCAGG + Intergenic
1162404060 19:10462871-10462893 CTACTCCCTCCCTCCCCAGGTGG + Intronic
1162964146 19:14148164-14148186 CTTGACGCCCCCACCCCAGCTGG - Exonic
1162982534 19:14248752-14248774 CTCTTCCCACCTTCCCCAGCAGG + Intergenic
1164447509 19:28330549-28330571 CTGGTCCCTCCCACAACACCTGG - Intergenic
1165006543 19:32812169-32812191 CTGGGCCTTCCCACTCCAGCTGG - Intronic
1165006567 19:32812250-32812272 CTGGGCCTTCCCACCCCACCTGG - Intronic
1165329039 19:35131351-35131373 CTCCCGCCTCCCACCCCATCGGG + Intronic
1165541939 19:36499076-36499098 CCCGCCCCTCCCACCCCACCTGG + Intergenic
1166361860 19:42255779-42255801 CTGGTCACTTCCTCCCCAGCTGG - Intergenic
1168475772 19:56673854-56673876 CTTGTTCCTCCAACCCCAGGAGG - Intergenic
925645255 2:6029406-6029428 CTCCTCACTCCCTCCCCTGCTGG + Intergenic
927126078 2:20012982-20013004 ACTCTCCCTCCCACCCCAGCGGG + Intergenic
929094239 2:38248544-38248566 CACCTCCCTCTAACCCCAGCTGG + Intergenic
929436497 2:41932525-41932547 TCCCTCCCTCCCTCCCCAGCGGG - Intergenic
931355935 2:61537833-61537855 CCCTTCCCTCACTCCCCAGCCGG - Exonic
932435204 2:71699323-71699345 TTCCTCCCTCCTCCCCCAGCTGG + Intergenic
934763788 2:96869546-96869568 CTCGGCGCTCCCACCCCCGATGG - Intronic
934797595 2:97114064-97114086 CCACTCACTCCCACCCCAGCCGG - Intronic
935112017 2:100103725-100103747 CTCCTCCTCCCCACCCCACCCGG - Intronic
935171603 2:100614719-100614741 CTGCTCTGTCCCACCCCAGCAGG + Intergenic
935547963 2:104420513-104420535 CTCCTCCCTGCCCCCTCAGCTGG + Intergenic
936122956 2:109761426-109761448 CTCCTCCTCCCCACCCCACCCGG + Intergenic
936221731 2:110610038-110610060 CTCCTCCTCCCCACCCCACCCGG - Intergenic
937037352 2:118793135-118793157 CTCTTCCTGTCCACCCCAGCTGG - Intergenic
937142584 2:119614662-119614684 CTGGTCCCTCCCACAACACCTGG + Intronic
937319011 2:120949584-120949606 CTCATCCCTGTCAGCCCAGCAGG - Intronic
938207794 2:129438771-129438793 CTCTTGCCTCCCACACCAGCCGG + Intergenic
938724890 2:134098706-134098728 TTCATCCCTCCCACCTGAGCTGG - Intergenic
941172548 2:162156969-162156991 ATCTTCCCCCCAACCCCAGCAGG - Intergenic
941735422 2:168969952-168969974 CCCATCCCTCCCACCCCACAAGG + Intronic
941934793 2:170974060-170974082 CTCGTCCAACCCACACCCGCGGG + Intergenic
944097383 2:195984148-195984170 CTTGTCCCTCAAGCCCCAGCAGG - Intronic
945903230 2:215561418-215561440 CTGGTCCCTCCCACAACAGGTGG - Intergenic
946312347 2:218889779-218889801 AGCCTCCCTCCCACCCCACCAGG + Intronic
946328078 2:218994954-218994976 CTCGCCCCTCTCACCTCTGCTGG - Intergenic
948032435 2:234829990-234830012 CTCGTGCCTTCCACCCAGGCTGG + Intergenic
948122229 2:235539575-235539597 CTCCTTCCTCCCACCCTAGAGGG - Intronic
948664093 2:239523785-239523807 CTCCTCACTACCACCCCAGGTGG + Intergenic
948667298 2:239544735-239544757 CTCCCTCCTCCCACCACAGCAGG + Intergenic
948982561 2:241501780-241501802 CAGGTCCCTTCCTCCCCAGCAGG - Intronic
1168761809 20:354597-354619 CCAGCCCCTCCCTCCCCAGCCGG + Exonic
1168799186 20:633619-633641 CTCAATCCCCCCACCCCAGCAGG - Intergenic
1168819030 20:761238-761260 CTCTTCCCTCCCGGCCCCGCAGG - Exonic
1168931264 20:1626361-1626383 TTCTTCTCTCCCATCCCAGCAGG - Intergenic
1169341423 20:4799380-4799402 CTCGCCCCTCTCATCCCACCTGG - Intronic
1169968654 20:11245060-11245082 CTCATCCCAGTCACCCCAGCAGG - Intergenic
1170157932 20:13285507-13285529 CTGGTCCCTCCCCCTCCAGGAGG + Intronic
1171416094 20:24981510-24981532 CTGCTCTCTCCCTCCCCAGCGGG + Intronic
1171962332 20:31503775-31503797 CTCCTCCCTCACATCCCATCAGG + Intergenic
1172083305 20:32358897-32358919 CTTGCCCCTCCCCCCCCAGTGGG - Intronic
1172171236 20:32934615-32934637 CAGGTCCCTCCCACGACAGCTGG - Intronic
1173895752 20:46549568-46549590 CTTGTCCTTCCACCCCCAGCTGG - Intronic
1175459948 20:59145008-59145030 ATCTTCCCTCCCACCCCAGCAGG - Intergenic
1175724738 20:61310155-61310177 CTCAGCCTACCCACCCCAGCTGG - Intronic
1175806025 20:61829878-61829900 CTCGTCCCTCCCACCCCAGCAGG - Intronic
1175973599 20:62699308-62699330 CTCACCCCTCCCACCGCAGGAGG + Intergenic
1176168834 20:63688071-63688093 CCCCCACCTCCCACCCCAGCAGG - Intronic
1176256304 20:64154856-64154878 CAAGGCCCTCCCATCCCAGCTGG - Intronic
1178963049 21:37085645-37085667 CTAGGCTCTCCCACCCCAGGGGG - Intronic
1179502398 21:41818364-41818386 CTCTCCCCTCAAACCCCAGCCGG - Intronic
1180057618 21:45367053-45367075 TGCGTCCCTCCCCCGCCAGCTGG - Intergenic
1180994614 22:19959443-19959465 CGCGTCCCTCCCGGCCCAGTGGG + Intronic
1181000340 22:19985206-19985228 CTCATCACCCCCTCCCCAGCTGG + Intronic
1181495234 22:23283897-23283919 TTCGGCCCTCCCAGCCCAGCAGG - Intronic
1181794074 22:25291132-25291154 CAGGTCCCTCCCACCACAGGTGG - Intergenic
1181834073 22:25587682-25587704 CAGGTCCCTCCCACCACAGGTGG - Intronic
1182294702 22:29306287-29306309 GACGTCCCGCCCAGCCCAGCCGG + Intergenic
1182972138 22:34589027-34589049 CTCTTCCCCCCTCCCCCAGCTGG - Intergenic
1183135288 22:35881257-35881279 CTCCTCCCTGCCACCCGAGACGG - Intronic
1183617864 22:38956070-38956092 CTCCTCCCTGCTGCCCCAGCTGG - Intronic
1183674731 22:39292820-39292842 ACAGTCCCTCCCACCCCAGCAGG - Intergenic
1184186768 22:42870027-42870049 CACGTTCCCCCCACCCCCGCCGG + Exonic
1184218801 22:43085800-43085822 CGCTTCCCTCCCACACCAGATGG + Intronic
1184740955 22:46428860-46428882 CATGTCCCTGCCTCCCCAGCTGG + Intronic
1184742048 22:46434271-46434293 CTCGCCCGCCCCACTCCAGCAGG - Intronic
1185419931 22:50729519-50729541 TTTGTCCCTCCCACAGCAGCTGG + Intergenic
949928024 3:9057539-9057561 CTTGCCCCTCCCCTCCCAGCAGG + Intronic
951334023 3:21399316-21399338 CTAGCCACTACCACCCCAGCTGG + Intergenic
951382004 3:21995622-21995644 CTTGTCTCACCCACCACAGCTGG - Intronic
951952797 3:28219683-28219705 CTGGTCCCTCCCACCACACATGG + Intergenic
952543130 3:34388965-34388987 CTGGTACCACCCACACCAGCTGG + Intergenic
952882514 3:37993824-37993846 CTCTTCCACCCCACCCCAGCGGG + Intronic
953352004 3:42222847-42222869 GTCGTCCCTACCCCCCCTGCAGG + Intronic
954215914 3:49124419-49124441 CTTGTGCCTGCCACCCAAGCCGG - Exonic
957693332 3:83599812-83599834 CTGGTCCCTCCCTCCACAGGTGG - Intergenic
959033181 3:101327286-101327308 CAGGTCCCTCCCACCACAGTGGG - Intronic
961383512 3:126510791-126510813 CTCCGCTCTCCTACCCCAGCTGG - Exonic
962746921 3:138403685-138403707 CTCTCCACTCCCACCCCAGCTGG - Exonic
965962095 3:174441126-174441148 CTCCTCCGTCCTACCCAAGCTGG + Intronic
966710394 3:182966647-182966669 CCCTTCCCTCTCACCCAAGCCGG + Intronic
967628396 3:191713371-191713393 CCCCACCCTCCCACCCCGGCTGG + Intergenic
968682183 4:1928934-1928956 CACACCCCTCCCAACCCAGCAGG - Intronic
968685632 4:1956615-1956637 CTCCTGCCTCCCACCCCAGCTGG - Intronic
970378115 4:15479418-15479440 CTCTCCCCTCCCTCCCCTGCTGG - Intronic
972412400 4:38807556-38807578 CTCTGCCCTGCCACCCCATCTGG + Intronic
972624278 4:40780957-40780979 CTCGTGCCTGCCACCACACCCGG + Intronic
973021182 4:45207543-45207565 CTCTTCCCGGCCACCCCATCTGG + Intergenic
976104984 4:81606845-81606867 CTGGTCCCTCCCCTCACAGCTGG + Intronic
977554067 4:98471029-98471051 CTCGTCCCTCCCACCTAAAGTGG + Exonic
977961486 4:103090090-103090112 CTTTTCCCTTCCATCCCAGCTGG - Intronic
982820971 4:159940010-159940032 CTCTGCCCTGCCACCCCATCTGG - Intergenic
983020594 4:162671082-162671104 CTGGTCCCTCCCACCACATGTGG + Intergenic
984211605 4:176856451-176856473 CTCTTCTCTCCCACCCCTTCTGG + Intergenic
985680344 5:1252789-1252811 ATCACCCCTGCCACCCCAGCTGG + Intergenic
985714050 5:1445855-1445877 CCCTTCCCTCCCTCCCCATCAGG + Intergenic
985715919 5:1461496-1461518 CTCTGCCCTCACACCCCAGCAGG + Exonic
986298021 5:6455725-6455747 CTCCTCCCTCCCCACCCATCTGG + Intronic
986298439 5:6458981-6459003 CTCTTCTCTCCCACCCAACCTGG - Intronic
986947903 5:13047209-13047231 CTGGTCCCTCCCACAACAGGTGG + Intergenic
988532747 5:32040576-32040598 CTCTGCCCTGCCACCCCATCTGG + Intronic
988666080 5:33329207-33329229 CTCTTCCCTCCCACCCCTTCTGG + Intergenic
992814827 5:80426444-80426466 CACCACCCCCCCACCCCAGCAGG + Intronic
993258443 5:85624194-85624216 TTCCTCCCTCCCACCCCTGTTGG + Intergenic
996297447 5:121938388-121938410 CTCGTCCCCCACACCGCAACAGG + Intergenic
997640448 5:135445431-135445453 CGCGGCCTTCTCACCCCAGCTGG + Exonic
997732670 5:136192531-136192553 CGGGTCCCGCCGACCCCAGCCGG + Intergenic
998163835 5:139829010-139829032 CCCCTCCCTCCCACCCCATTTGG - Intronic
998172975 5:139883236-139883258 CTCCCCCCTACCTCCCCAGCTGG + Intronic
998385746 5:141756265-141756287 CTCTGCTCTCCCTCCCCAGCAGG - Intergenic
999270348 5:150293282-150293304 CTCTTCTCTCCCTCCCCTGCTGG + Intergenic
1000510311 5:162172855-162172877 CAAGTCCCTCCCACCACACCTGG - Intergenic
1001482232 5:172096346-172096368 CCTGCCCCTCCCACACCAGCAGG + Intronic
1001566324 5:172701678-172701700 ATCCTCCCTCCAGCCCCAGCGGG - Intergenic
1001768187 5:174271521-174271543 CCAGCCCCACCCACCCCAGCTGG - Intergenic
1001881793 5:175251026-175251048 CTCCTCCATGCCACCCCACCTGG + Intergenic
1002443318 5:179275348-179275370 CTCCTCCCTCCCATCTCAGCCGG - Intronic
1003809751 6:9766815-9766837 CTCGTCCCTCCCACAACACATGG + Intronic
1004232732 6:13847713-13847735 CTCCTCCCACCCACCCCTCCTGG + Intergenic
1004509977 6:16277418-16277440 CTCCTCCCTCCCACCAGACCCGG - Intronic
1005400885 6:25432992-25433014 CTTTTCCCTCCCACTTCAGCTGG - Intronic
1006294171 6:33162547-33162569 CTGGGCCCTGACACCCCAGCTGG + Intergenic
1006375894 6:33671448-33671470 CAAGCCCCTCCCACCTCAGCAGG + Intronic
1006424928 6:33957977-33957999 CTCCTCCCTTCCTCCCCTGCTGG - Intergenic
1006523202 6:34583928-34583950 CTTCTCCCTCACAGCCCAGCAGG + Intergenic
1007697790 6:43744634-43744656 TTCCTCCCTCACACCCCAGCGGG - Intergenic
1008825040 6:55683988-55684010 CGGGTCCCTCCCACCACAGGTGG - Intergenic
1009582653 6:65557210-65557232 CTCCGCCCACCCAGCCCAGCAGG + Intronic
1010128065 6:72457536-72457558 CCTGTCCTTCCCACCCCAGTGGG + Intergenic
1010673943 6:78719867-78719889 CTCGTCCCTCCCACAACACAAGG - Intergenic
1011656140 6:89553724-89553746 CTCGTCTCGCCCTCACCAGCAGG + Intronic
1012887139 6:104859378-104859400 CCCGACGCTCCCACCCCGGCAGG - Intronic
1014525304 6:122495230-122495252 CACTTCCCTCCCACCCAAGAGGG - Intronic
1016949715 6:149567197-149567219 CTCGATTCTCCCACCTCAGCTGG - Intronic
1018400266 6:163414434-163414456 CTCCTCCCTGCCTCCCCGGCGGG - Intronic
1018788377 6:167126741-167126763 CTGGTCCCTCCCACCACACGTGG - Intronic
1019280999 7:200217-200239 CCCCTCCCACCCACCCCAGGTGG + Intronic
1019339244 7:500764-500786 CTCCTCCCGCCCACCCTGGCAGG + Intronic
1019780860 7:2938827-2938849 CTCCTCCCTCCCACCCAGGCCGG - Exonic
1020528360 7:9294823-9294845 CGGGTCCCTCCCACAACAGCGGG + Intergenic
1021868430 7:24980403-24980425 CTCCGCCCTCCCAACCCATCCGG - Intronic
1022513415 7:30958699-30958721 CTGGTGCCTCCCACCACACCTGG - Intronic
1023413604 7:39911196-39911218 AGCTTCCCTACCACCCCAGCCGG - Intergenic
1023497005 7:40808438-40808460 CTCCTCCCTCACAGCCCAACTGG + Intronic
1023871447 7:44264998-44265020 CTCCCTCCTCCCACCCCAGAGGG - Intronic
1024881253 7:54087913-54087935 CAGGTGCCTGCCACCCCAGCCGG - Intergenic
1026592411 7:71708320-71708342 CTCTTCCCTGCCACCCCATAAGG - Intronic
1026946108 7:74317376-74317398 CTCGTCCAGCCCACCTCAGGAGG + Intronic
1026956005 7:74376839-74376861 CCCGACCCTCCCGCCCCAGCAGG - Intronic
1027288134 7:76671854-76671876 TTGGCCCCTCCCACCCCACCGGG - Intergenic
1031356422 7:120792343-120792365 CCGGTCCCTCCCTCCCCAGGAGG + Intronic
1032408104 7:131672356-131672378 CTCGTCTCTCACAGCTCAGCTGG - Intergenic
1033185905 7:139226419-139226441 CTCTGCCCTGCCACCCCATCTGG + Intergenic
1033487544 7:141805748-141805770 CTGGTCCCTCCCACCACATGTGG - Intergenic
1034036865 7:147833898-147833920 ATAGTCCCTCGCTCCCCAGCTGG - Intronic
1034380565 7:150688671-150688693 CTAGTCCCTCCTTCCCCATCAGG + Intronic
1035725516 8:1823342-1823364 CCCGTCCCTCCGTCCGCAGCTGG - Intergenic
1036210363 8:6835642-6835664 ATCCTCCCTCCCTCCCCTGCTGG - Exonic
1036641229 8:10585307-10585329 CCACTCCCTCCCACCCTAGCAGG - Intergenic
1036774574 8:11601517-11601539 CTCCTCCCCACCACCCCGGCTGG + Intergenic
1037756130 8:21711163-21711185 CTCTTCCCTCCAACACCAGGAGG + Intronic
1037985794 8:23289904-23289926 CTCCTGCCTCCTGCCCCAGCAGG + Exonic
1038224692 8:25645028-25645050 CCCCTCCCTCCCACCCCTCCAGG - Intergenic
1041691420 8:60691661-60691683 CTCCTCCCTTCCACCTCACCAGG + Intronic
1041881178 8:62751216-62751238 CTTCTCCCTCCTACCCCACCTGG + Intronic
1044614109 8:94121475-94121497 CCCTTGCCTCCCACCCCAACAGG + Intergenic
1044667099 8:94641874-94641896 CTCCTCCCTCGCTCCCCTGCTGG - Intronic
1044730591 8:95225822-95225844 TCTGTCCCTCCCACCCCTGCAGG + Intergenic
1045282189 8:100758760-100758782 CCCGTCCCTCCCACCCCAGCTGG + Intergenic
1045426548 8:102072293-102072315 CCCCTCCCATCCACCCCAGCTGG - Intronic
1045649782 8:104330751-104330773 CTGGTCCCTCCCTCCACACCTGG - Intronic
1048731562 8:137447457-137447479 CTTGTCTCTCCCATCCCAGTTGG + Intergenic
1049054774 8:140227240-140227262 CCCCTCCACCCCACCCCAGCTGG - Intronic
1049224440 8:141443091-141443113 CTTGTCCCTGCAGCCCCAGCAGG + Intergenic
1049528629 8:143142462-143142484 CCTGTCCCTCCCTCCCCAGGAGG + Intergenic
1049528648 8:143142517-143142539 CCTGTCCCTCCCTCCCCAGGAGG + Intergenic
1049528667 8:143142573-143142595 CCTGTCCCTCCCTCCCCAGGAGG + Intergenic
1049528686 8:143142628-143142650 CCTGTCCCTCCCTCCCCAGGAGG + Intergenic
1049528718 8:143142738-143142760 CCTGTCCCTCCCTCCCCAGGAGG + Intergenic
1049709023 8:144055425-144055447 CTCGACCCTCCCACCCTGCCTGG + Intronic
1052609713 9:30757849-30757871 CTCGTTCTGCCCACCCCACCTGG + Intergenic
1053209217 9:36213332-36213354 GTCTTGCCTCCCACACCAGCTGG + Intronic
1055094736 9:72400365-72400387 CTCCTCCCACCCACCTCAACAGG - Intergenic
1055540530 9:77299920-77299942 CCCTTGCCTCCCACCCCAACAGG - Intronic
1055757315 9:79570954-79570976 CTCGTCCCTCCAAGCCCCGCGGG - Intergenic
1056777756 9:89526146-89526168 CTTGTGCTTCCTACCCCAGCTGG - Intergenic
1057039278 9:91835694-91835716 CTTTTCCCTCCCACCCCTGCTGG - Intronic
1057195267 9:93112900-93112922 CTGTTCCCACCCACCCCCGCAGG + Intronic
1057198157 9:93126612-93126634 CCCGTGCCTCCAGCCCCAGCGGG + Exonic
1057442163 9:95090648-95090670 CCTGTCCCTTCAACCCCAGCAGG - Intergenic
1057951643 9:99373780-99373802 CTCCTGCCTCCCAACCCAGGTGG + Intergenic
1058584389 9:106491735-106491757 CCCGTCACTCCCACCCCCACAGG - Intergenic
1060966175 9:127713422-127713444 TTCTTCCCTCCCCCACCAGCAGG + Intronic
1060974035 9:127754540-127754562 CGGGTCTCTCCCAGCCCAGCTGG - Intronic
1061130409 9:128704976-128704998 CTCCTCCCAGCCACCCCACCCGG - Intronic
1061180749 9:129023751-129023773 CTGGGCCCTCCCAGCCCTGCAGG - Intronic
1061317188 9:129803535-129803557 CGCTCCCCGCCCACCCCAGCTGG - Intronic
1061401747 9:130372275-130372297 CACGCCCCTCCCTCCCCAGGTGG + Intronic
1061656161 9:132091937-132091959 CTCGTCCCTCCCACGACACTTGG - Intergenic
1061864386 9:133484964-133484986 CCCCTCCCTCTTACCCCAGCTGG - Intergenic
1061880532 9:133566708-133566730 CCCGCCCCACCCAACCCAGCTGG - Intronic
1061945649 9:133907040-133907062 CTTGTCCCTCCCCCCGCCGCCGG - Intronic
1062070864 9:134554294-134554316 CACCTCCCACCAACCCCAGCGGG - Intergenic
1062190398 9:135245072-135245094 CTTGTCCATCTCTCCCCAGCCGG + Intergenic
1062363691 9:136199114-136199136 CCCAGCCCTCCCACCCCGGCCGG + Intronic
1062440048 9:136565768-136565790 CTCCTCCCTCCCACACGCGCAGG - Intergenic
1062519010 9:136949977-136949999 CCCGGCCCGCCCACCCCAGGCGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1062625954 9:137441578-137441600 CTCCTGCCTCCCACCCCCCCGGG - Intronic
1185740280 X:2526478-2526500 CTGGTCCCTCCCACACCACGTGG - Intergenic
1186223833 X:7376296-7376318 CACGTCTCCCCCACCACAGCCGG + Intergenic
1189129756 X:38485527-38485549 CTCTTCCCACCCTCCCCACCCGG - Intronic
1189355954 X:40310107-40310129 GTCTTCCCTCCAGCCCCAGCCGG + Intergenic
1189554919 X:42132346-42132368 CTTGTGCCTCCCATCCCAGGAGG - Intergenic
1189913971 X:45838768-45838790 CTCCTCCCTGCCACCACACCTGG - Intergenic
1189966365 X:46377878-46377900 CCCGTCCCTCACCCCCCAACTGG + Intergenic
1190227703 X:48559048-48559070 CTCTGCCCTCCAACCACAGCTGG - Intronic
1190493698 X:51007129-51007151 CTTGCCCCTCACCCCCCAGCAGG + Intergenic
1190641312 X:52484016-52484038 CCCATCCCTGCAACCCCAGCAGG + Intergenic
1190646360 X:52528849-52528871 CCCATCCCTGCAACCCCAGCAGG - Intergenic
1191214522 X:57921225-57921247 CGACCCCCTCCCACCCCAGCTGG + Intergenic
1192663775 X:73068616-73068638 CTCTTCCCGGCCACCCCATCTGG + Intergenic
1193135484 X:77966900-77966922 CTCACCCCTCACCCCCCAGCAGG + Intronic
1193195784 X:78630396-78630418 CAGGTCCCTCCCACCACAGGAGG - Intergenic
1196048018 X:111276422-111276444 CTCCTCCTTCCCTCCTCAGCTGG + Intergenic
1197744260 X:129920435-129920457 CTCTTCCCTCCTACCCCTACAGG + Exonic
1198031902 X:132761357-132761379 CTCTCCCCTCCCACAGCAGCAGG - Intronic
1200246974 X:154531641-154531663 CTCGTCCCTCCCTCCCACCCTGG + Exonic
1201933566 Y:19380959-19380981 ATCTTCCCTCCAACCCCAACAGG + Intergenic