ID: 1175807747

View in Genome Browser
Species Human (GRCh38)
Location 20:61839268-61839290
Sequence ATCCCGCCGGGTGTGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175807738_1175807747 -1 Left 1175807738 20:61839246-61839268 CCCCTTTCCATTCTGAAAGGATA 0: 1
1: 1
2: 1
3: 30
4: 275
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1175807741_1175807747 -8 Left 1175807741 20:61839253-61839275 CCATTCTGAAAGGATATCCCGCC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1175807739_1175807747 -2 Left 1175807739 20:61839247-61839269 CCCTTTCCATTCTGAAAGGATAT 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1175807735_1175807747 19 Left 1175807735 20:61839226-61839248 CCATGAATGCAGAATGGCCGCCC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1175807740_1175807747 -3 Left 1175807740 20:61839248-61839270 CCTTTCCATTCTGAAAGGATATC 0: 1
1: 0
2: 1
3: 29
4: 246
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1175807734_1175807747 20 Left 1175807734 20:61839225-61839247 CCCATGAATGCAGAATGGCCGCC 0: 1
1: 0
2: 1
3: 3
4: 50
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1175807736_1175807747 2 Left 1175807736 20:61839243-61839265 CCGCCCCTTTCCATTCTGAAAGG 0: 1
1: 0
2: 1
3: 17
4: 257
Right 1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175807747 Original CRISPR ATCCCGCCGGGTGTGCATGG GGG Intronic
903058549 1:20653713-20653735 CTCCCGCTGGGTGTTCAAGGAGG - Exonic
904514989 1:31047653-31047675 ATCCCACTGGCTGGGCATGGTGG + Intronic
919728986 1:200900993-200901015 AGCCCGTCGGCTGTGCCTGGAGG + Exonic
924703924 1:246482602-246482624 ATCCCGCTGTATGTGCAGGGAGG - Intronic
1062801489 10:384656-384678 AACACGCAGGGTGAGCATGGAGG + Intronic
1070798421 10:79230630-79230652 TTCCCGCCGTCTGTGCAGGGAGG - Intronic
1071695077 10:87862486-87862508 ATCCTGCCGGGTTTTCACGGCGG + Exonic
1072913258 10:99521876-99521898 ACCGCGCCGGGTGGGCCTGGAGG - Intergenic
1076608859 10:131707901-131707923 ATCCCCCTGGCTGTGCTTGGGGG - Intergenic
1080603977 11:33848617-33848639 ATCACTCTGTGTGTGCATGGAGG - Intergenic
1084510350 11:69599507-69599529 AACCTGCAGGGTGTGCCTGGTGG - Intergenic
1084646427 11:70461287-70461309 ATGCCGCCTGGAGTGCATGGGGG - Intergenic
1087269457 11:96096839-96096861 ATCCCTCCAGCTGTGCTTGGTGG - Intronic
1089491462 11:118886740-118886762 CTCCCGGCTGGTGTGCAGGGTGG - Intronic
1089843524 11:121440083-121440105 ATACCCCAGGGTGGGCATGGTGG + Intergenic
1094297639 12:28926291-28926313 ATCCTGCCAGGTTTTCATGGGGG + Intergenic
1098416921 12:70244117-70244139 ATACCGAAGGCTGTGCATGGTGG + Intronic
1098482495 12:70982027-70982049 ATCACCCTGGGTGGGCATGGCGG + Intergenic
1112200309 13:97268245-97268267 ATTTAGCCGGGCGTGCATGGTGG - Intronic
1113456714 13:110454700-110454722 ATCCGGCGGGGAGTGCAGGGAGG - Intronic
1115851470 14:37593021-37593043 ATACCGCCTGGCGTGGATGGAGG - Intronic
1123071057 14:105642744-105642766 ATGCCCCCGAGTGGGCATGGAGG + Intergenic
1123076019 14:105667785-105667807 ATGCCCCCGAGTGGGCATGGGGG + Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1129587745 15:76885770-76885792 ATAGGGCCAGGTGTGCATGGTGG - Intronic
1132759456 16:1501732-1501754 AGCCCGCCAGCTGTGCTTGGGGG - Exonic
1132934561 16:2474105-2474127 AGCCCGCCGGCTGGGCAGGGCGG + Exonic
1147944210 17:44071112-44071134 CTCCCGCCGTGTGGGCATCGCGG + Exonic
1150658462 17:67055962-67055984 ATCCCAGCCTGTGTGCATGGAGG - Intronic
1150841113 17:68606565-68606587 ATCCAGGCTGGTGTGCAGGGTGG + Intergenic
1151706699 17:75772976-75772998 ATCCAGCCAGCTGTGCTTGGGGG + Intergenic
1151885598 17:76921588-76921610 GGCCCACTGGGTGTGCATGGAGG - Intronic
1152814476 17:82399319-82399341 AGCCAGCAGGGTGTGCATGCTGG + Intronic
1157380974 18:47217148-47217170 ATCTAGCCGGATGGGCATGGTGG + Intronic
1160905757 19:1451062-1451084 CTCCCTCTGGCTGTGCATGGGGG + Intronic
938925905 2:136042190-136042212 ACCCCCACGGGTGTGCATAGAGG + Intergenic
948838759 2:240638916-240638938 ATCCAGCCTGGTGTGCATCGTGG - Intergenic
1172701976 20:36859218-36859240 AACCCACTGGGTGTGGATGGAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG + Intronic
1175994053 20:62804615-62804637 ATCCTCCCGGGTGGGCATCGTGG + Intergenic
1179889002 21:44326459-44326481 ATCCTTTCGGGTGGGCATGGGGG + Intronic
1180210853 21:46294989-46295011 CCCCAGCAGGGTGTGCATGGCGG - Intronic
950373719 3:12552733-12552755 ATCCTGCAGGCTGGGCATGGTGG + Intronic
961698989 3:128726745-128726767 TGCCCGCCGGGTGGGCACGGCGG - Intronic
962749507 3:138423495-138423517 ATCACTCCAGGTGGGCATGGAGG - Intergenic
967068100 3:185938296-185938318 AACCTGCCGAGTGTGCAGGGAGG + Intergenic
972105980 4:35487721-35487743 ATCCCACCGGGTTGGCATGCTGG + Intergenic
997338045 5:133121710-133121732 ATCCGCCCCGGTGTGCAGGGTGG + Intergenic
1008070748 6:47096676-47096698 ATCCACCAGGGTGTGCCTGGGGG - Intergenic
1017130247 6:151102471-151102493 ATCCTGCAGGATGTGCCTGGGGG - Intergenic
1024079875 7:45847304-45847326 ATCACTCTGGGTGGGCATGGTGG + Intergenic
1025124907 7:56336692-56336714 ATCACTCTGGGTGGGCATGGTGG - Intergenic
1032688015 7:134255801-134255823 ATCTTTCCGTGTGTGCATGGGGG + Intronic
1034982613 7:155488562-155488584 ATCCCTCCAGGTGTGCAGGAAGG + Intronic
1037973455 8:23191811-23191833 ATCCAGCAGGGTGTGGATCGAGG + Exonic
1038329344 8:26595780-26595802 CTCCAGCCGGGTGTGGCTGGTGG + Intronic
1056874477 9:90314866-90314888 ATCCCTGAGGCTGTGCATGGTGG - Intergenic
1201295095 Y:12455523-12455545 ATCCTGCCGGCCGTGCGTGGTGG - Intergenic