ID: 1175808317

View in Genome Browser
Species Human (GRCh38)
Location 20:61843897-61843919
Sequence GGGGGTTCCCTCAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175808317_1175808327 6 Left 1175808317 20:61843897-61843919 CCAACTTCCCTGAGGGAACCCCC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1175808327 20:61843926-61843948 TGGGAAGCGCCACTCACCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1175808317_1175808328 9 Left 1175808317 20:61843897-61843919 CCAACTTCCCTGAGGGAACCCCC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1175808328 20:61843929-61843951 GAAGCGCCACTCACCTGTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 53
1175808317_1175808329 10 Left 1175808317 20:61843897-61843919 CCAACTTCCCTGAGGGAACCCCC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1175808329 20:61843930-61843952 AAGCGCCACTCACCTGTGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 60
1175808317_1175808330 14 Left 1175808317 20:61843897-61843919 CCAACTTCCCTGAGGGAACCCCC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1175808330 20:61843934-61843956 GCCACTCACCTGTGGTGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175808317 Original CRISPR GGGGGTTCCCTCAGGGAAGT TGG (reversed) Intronic
901634499 1:10664316-10664338 GGGGGTTCCAGCAGGCAAGGGGG - Intronic
902719062 1:18292115-18292137 GGGGCTCCCCTTATGGAAGTGGG + Intronic
903737593 1:25540108-25540130 AGGGATTGGCTCAGGGAAGTAGG + Intergenic
907137112 1:52150252-52150274 GGGGGTGACCTCCTGGAAGTCGG + Intronic
909442035 1:75707603-75707625 GGGGGATCCGTCAGAGTAGTGGG - Intergenic
910206983 1:84758096-84758118 AGGGGTTCCACCAGGGAAGATGG + Intergenic
910301206 1:85708975-85708997 GAGGCTTCCCTAAGGGAAGGGGG - Intergenic
912606131 1:110991169-110991191 GGGGGTTAGGTGAGGGAAGTGGG - Intergenic
912799192 1:112710735-112710757 GGGGCTCACCTCAGGGAAGCAGG + Exonic
918164733 1:181934359-181934381 AGTGGTTGCCTCTGGGAAGTGGG + Intergenic
919814171 1:201427365-201427387 TGTGGTTCCCACAGGGAACTTGG + Intronic
920502880 1:206496538-206496560 TGGGGTTTCCCCAGGGCAGTAGG + Exonic
921193944 1:212734555-212734577 GGTGGTTCCCTCTGGGGAGAGGG - Intronic
921801745 1:219410573-219410595 AGGGGTTCCCACAGTGCAGTAGG - Intergenic
921929708 1:220745360-220745382 GGGGGTGCCTTCAGGGGAGCAGG - Intergenic
1062865381 10:847865-847887 GGGACTTCCCTCAGGGCAGTGGG - Intronic
1063126643 10:3142075-3142097 GGAGGTTCCCCCTGGGCAGTGGG - Intronic
1067474519 10:46556909-46556931 TGGGGTTGCGTCGGGGAAGTGGG - Intergenic
1067722536 10:48739943-48739965 GGGGGTTCCTTGGGGGAAGAGGG + Intronic
1067853102 10:49768228-49768250 GGGGGTTCGCTCCGAGAGGTGGG - Intergenic
1068130756 10:52892141-52892163 GGGAAATTCCTCAGGGAAGTTGG + Intergenic
1068842341 10:61629777-61629799 GAGGGAGCCCTCTGGGAAGTTGG - Intergenic
1070600853 10:77865351-77865373 GGGTGAGCCATCAGGGAAGTGGG - Intronic
1071618284 10:87095261-87095283 CGGGGGTCCCTCAGGGGGGTTGG + Intronic
1075730537 10:124632911-124632933 GGGTGTGCCCTGAGGGAACTTGG + Intronic
1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG + Intronic
1077523729 11:3051382-3051404 GGGGCTTCCCTCTGAGAAGAAGG + Intronic
1083537950 11:63489338-63489360 GGGGTTTGCCTCTGGGCAGTAGG - Intronic
1084649869 11:70482898-70482920 TGGGGTGCCCACAGGGGAGTGGG - Intronic
1084934895 11:72581560-72581582 GGAGGGTCCCTCAGGGATGGAGG - Intronic
1087031991 11:93715362-93715384 GGGACTTCCTTCAGGGCAGTGGG + Intronic
1089365757 11:117919990-117920012 GGGGGTTACCACAGGGATCTTGG + Intronic
1091177326 11:133573244-133573266 AGGGATTCCCTCTGGGAACTAGG + Intergenic
1095363638 12:41374680-41374702 TGAGGTTTCCTTAGGGAAGTTGG + Intronic
1095482440 12:42650202-42650224 TGGGGTTCCCTCAGCCAAGAGGG - Intergenic
1097141706 12:56908167-56908189 GTCGGTTGCCTCAGGGATGTGGG - Intergenic
1098361138 12:69655534-69655556 GGGGCTTCCTTCTGGGAAGCAGG + Exonic
1098728417 12:73999635-73999657 GGGAATTCCAGCAGGGAAGTTGG + Intergenic
1101563204 12:105879913-105879935 GGGGATGACGTCAGGGAAGTTGG + Intergenic
1101811872 12:108114452-108114474 GTGGGTCCCCTCAGGAAAGGGGG + Intergenic
1102195293 12:111021197-111021219 GTGGGTCCCCTCAAGGCAGTTGG + Intergenic
1102207228 12:111098912-111098934 GGGGGCTCCCTGAGGGGAGGAGG - Intronic
1103649797 12:122423243-122423265 GGTCGTTCCCGGAGGGAAGTGGG - Intergenic
1104434393 12:128744023-128744045 GGGATTTCAATCAGGGAAGTGGG + Intergenic
1104732392 12:131115091-131115113 GGGGGATCCGTCAGGGTAGGCGG + Intronic
1104859958 12:131918653-131918675 GAGGGTCTCCTCAGGGAGGTCGG - Exonic
1105403978 13:20118842-20118864 GGGGCATCCCGCAGGGAAGGGGG - Intergenic
1108427025 13:50312914-50312936 AGTGGTTCCCTCTGGTAAGTGGG + Intronic
1109225698 13:59692384-59692406 GGGGTGTCAGTCAGGGAAGTAGG - Intronic
1113877353 13:113602575-113602597 GGGGGATCCCTCAGTGCAGCTGG + Intronic
1116057841 14:39885790-39885812 GGTGCTTCCTTCAGGGCAGTGGG - Intergenic
1119557514 14:75565153-75565175 GGGGATTCCTTCCGTGAAGTAGG - Intergenic
1121096609 14:91221870-91221892 TGGGGTGCCTTCTGGGAAGTTGG - Intronic
1121317386 14:92970372-92970394 GGGGATGCCCTCAGGGGAGGAGG + Intronic
1122627751 14:103092813-103092835 CTGGGTTCCCTCTGTGAAGTGGG - Intergenic
1122841672 14:104467750-104467772 GGGGGATCCCACAGGCAAGGTGG - Intergenic
1122911039 14:104827679-104827701 GGAGGTCCCATCGGGGAAGTAGG + Intergenic
1124373064 15:29114384-29114406 GGGGGTTCAGCCAGTGAAGTGGG - Intronic
1126527431 15:49672228-49672250 GTGGGTTGCCTCTGGGAAGTGGG + Intergenic
1126799831 15:52288815-52288837 GGGAGGGCACTCAGGGAAGTTGG - Intronic
1126866353 15:52941433-52941455 TGGAGCTCCCTCAGGGAGGTAGG - Intergenic
1128315311 15:66655988-66656010 TGGGGTTCCCTTCGTGAAGTGGG + Intronic
1128747274 15:70123394-70123416 GGGACTTGCCTCAGGGATGTGGG + Intergenic
1132565352 16:619935-619957 GGGAGTTCCCTCGGAGATGTTGG + Intronic
1132718544 16:1304358-1304380 GGGGGTTCCCCCAGGGAGCTCGG + Intergenic
1132903936 16:2272560-2272582 GGGGGTTTCCTGAGTGAGGTGGG - Intergenic
1133226803 16:4344684-4344706 GGGGGTTCCGTGAGAGAAGGGGG + Intronic
1136081122 16:27853226-27853248 TGGGGTTCCCCCAGGGCAGAGGG - Intronic
1136419468 16:30122996-30123018 GGGGGTGCCCTCAGGGGAGGGGG - Intronic
1138104741 16:54282002-54282024 GGGAGTTCCCTCCGCGAAGGGGG - Intergenic
1141042496 16:80684216-80684238 TGAGCTGCCCTCAGGGAAGTGGG + Intronic
1141687219 16:85577307-85577329 CGCGGTCCTCTCAGGGAAGTGGG + Intergenic
1143135670 17:4710974-4710996 CGGGGTTCTCGCAGGGATGTGGG + Intronic
1143593549 17:7900415-7900437 AGTGGTTCCCTAAGGGTAGTTGG + Intronic
1143691025 17:8566150-8566172 GGAGGTTCCCCAAGGGACGTTGG - Intronic
1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG + Intronic
1146852234 17:36232450-36232472 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1146868142 17:36356321-36356343 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147071016 17:37956939-37956961 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1147082542 17:38036465-38036487 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147098486 17:38160433-38160455 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1147139409 17:38452936-38452958 GGTGGTTCCCACAGGGGTGTTGG + Intronic
1151222430 17:72623033-72623055 GGGGCTTCCCTGAGGGAACTGGG - Intergenic
1151816460 17:76473752-76473774 GGGGGCACCGGCAGGGAAGTGGG + Intronic
1152638615 17:81440290-81440312 GGGGACTCCCTCTGGGCAGTGGG + Intronic
1154198793 18:12285169-12285191 GGGGGGTCCCCCAGGGAGGCAGG + Intergenic
1155010279 18:21770431-21770453 GTGGGTTACATCAGGGGAGTGGG - Intronic
1160212948 18:76898356-76898378 GGAGGATCCCTGAGGGAATTTGG - Intronic
1161514741 19:4690142-4690164 GGGGCTTCCCACAGGAAGGTAGG - Intronic
1162935650 19:13980263-13980285 GGGGCTTCCTTCAGGCAAATGGG + Intronic
1165436228 19:35796969-35796991 GGGGGTCTCATCAGGGAAGGGGG + Intergenic
1165636747 19:37346829-37346851 AAGGCTTCCCTGAGGGAAGTAGG - Intronic
1165720047 19:38072721-38072743 GGAGGCTCCCAAAGGGAAGTCGG + Intronic
1167770070 19:51509352-51509374 TGGGTTTCCCTGAGGGCAGTGGG + Intergenic
1167783109 19:51613376-51613398 AATGGTTCCCACAGGGAAGTTGG + Intronic
925121209 2:1419802-1419824 GGGGGCTCCCTCGTGGAAGCAGG + Intronic
934967053 2:98731685-98731707 CGGGGTTCTCACCGGGAAGTTGG - Intergenic
935290318 2:101604662-101604684 GGGGGCTCCCTGAGGGATGAGGG - Intergenic
937209660 2:120260189-120260211 AGGGGTTCCCGCAGTGCAGTGGG + Intronic
938256362 2:129862712-129862734 GGGGCTTCCCTCTTGGAGGTGGG + Intergenic
938998302 2:136703998-136704020 GTGTGATCCCTCAGGAAAGTAGG - Intergenic
940095862 2:149973553-149973575 GGGGCTTCACACAGAGAAGTAGG - Intergenic
942653251 2:178190691-178190713 CGGGCTTCCATCAGGGAAGCAGG + Intergenic
945235424 2:207627379-207627401 GAGGGTAACCTCAGGGAACTTGG + Intergenic
945979957 2:216301388-216301410 GGTGCTTCTCTCATGGAAGTTGG - Intronic
946073149 2:217051600-217051622 ATGAGTTCCCTCAGGGAATTGGG - Intergenic
948943828 2:241209571-241209593 GCGGCTCCTCTCAGGGAAGTAGG - Exonic
1170643287 20:18175179-18175201 GGAGGTTCCCTGAGAGAAGAGGG - Intronic
1175808317 20:61843897-61843919 GGGGGTTCCCTCAGGGAAGTTGG - Intronic
1176103104 20:63373396-63373418 GGGGCTTCCCTCTGGGAGGCTGG - Intronic
1179575912 21:42308379-42308401 GGGAGCAGCCTCAGGGAAGTGGG - Intergenic
1179677333 21:42992725-42992747 GGGGGTTCCCTCACAGCACTGGG + Intronic
1179677340 21:42992746-42992768 GGGGGTTCCCTCATAGCATTGGG + Intronic
1179826476 21:43968885-43968907 GGGAGGGCCCTCAGGGAAGGTGG - Intronic
1181880923 22:25979453-25979475 GGTGGTTGACTCTGGGAAGTTGG + Intronic
1182275768 22:29187854-29187876 GGGGGAGCCGTCAGGGAAGGGGG - Intergenic
1182358091 22:29731268-29731290 GGGGGTGCCCGCAGGGATGGAGG + Exonic
1183479626 22:38056490-38056512 GTGGGTTCCCTGGGGGAGGTTGG - Intronic
1184225454 22:43126988-43127010 GGGGGAACTCCCAGGGAAGTGGG - Intronic
1184309474 22:43631904-43631926 CGGGGGTCCCTCAGGGAGGGAGG + Intronic
1184743604 22:46443366-46443388 GGGGCTGCCCCCAGGGAAATGGG + Intronic
1185299607 22:50072522-50072544 GGGGGTGCTCTCCGGGAAGATGG + Intronic
949890987 3:8733602-8733624 GGGGGCTGCCTCAGGGCACTGGG - Intronic
949999946 3:9649282-9649304 GGGGTTTCCCCCGGGGAAGCCGG - Intergenic
950407366 3:12813116-12813138 TGGGGATCCCTTTGGGAAGTTGG + Intronic
950513431 3:13447635-13447657 AGGGGCTCCCACAGGGCAGTGGG + Intergenic
953404548 3:42654069-42654091 GTGGGATCCCTCAGGGGAGCGGG + Intronic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
959317260 3:104823440-104823462 GGGGGTTCAGTCAGGATAGTGGG + Intergenic
961117013 3:124339177-124339199 GGAGGTTCTCTCAGAGAGGTGGG + Intronic
961220467 3:125195130-125195152 GAGGATTTCTTCAGGGAAGTTGG + Intronic
961507382 3:127379029-127379051 GGGGGGTCCCTTCCGGAAGTTGG + Intergenic
961649174 3:128408888-128408910 GAAGGTACCCACAGGGAAGTTGG + Intergenic
961684182 3:128618051-128618073 GGGGGTTCCCTAGGGGAAGCAGG + Intergenic
962181860 3:133214465-133214487 GAGGGTTCTCTCAGGCACGTTGG + Intronic
962365331 3:134775323-134775345 GGAAGTTCCCTCAGGGGATTGGG - Intronic
963067840 3:141278069-141278091 GGGGCCTCTCTCAGGGCAGTTGG - Intronic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
973123894 4:46559255-46559277 GGTGGTTGCCTCTGTGAAGTGGG + Intergenic
973961169 4:56111339-56111361 CGTGGTTGCCTCTGGGAAGTAGG + Intergenic
977551432 4:98447819-98447841 GTGGGTTCCCTCGGGAGAGTGGG - Intergenic
988155118 5:27439888-27439910 AGGGGTTCCCACAGTGCAGTGGG + Intergenic
990663295 5:58043145-58043167 AGGTGTTCCCTTGGGGAAGTGGG + Intergenic
993671918 5:90770795-90770817 AGCGGTTACCTCTGGGAAGTAGG - Intronic
997665697 5:135628033-135628055 GGAGGGTGGCTCAGGGAAGTTGG + Intergenic
999128633 5:149265689-149265711 GGGAGCTCCTTCAGGGAAGGAGG + Intergenic
999438300 5:151581443-151581465 GAGGGTTAGCTCAGGGAGGTAGG - Intergenic
1001109442 5:168883649-168883671 GGGGGTTGTCTCCGGGAGGTGGG - Intronic
1002294915 5:178224830-178224852 GGGGGCTCTGTCAGGAAAGTTGG - Intronic
1002536991 5:179881259-179881281 GGTGGTTACCTCGGGGAAGAGGG - Intronic
1003749703 6:9041635-9041657 TGGGGTTTCCTTAGGGAGGTTGG + Intergenic
1007071280 6:39040169-39040191 GGGGGGTTCCTAAGGGAAGTGGG - Intergenic
1018088691 6:160327145-160327167 GGGGATTATCTCAGGGAAGGAGG - Intergenic
1018715986 6:166533050-166533072 GGGTGTTCCCTCTGTGCAGTGGG + Intronic
1018848647 6:167572299-167572321 GGGGGTCCCCCCAGGCAAGCGGG + Intergenic
1019151682 6:170010773-170010795 GGGGATTCCCTGAGGGACTTGGG + Intergenic
1019155958 6:170039169-170039191 AGGGGCTAACTCAGGGAAGTTGG - Intergenic
1019479404 7:1259726-1259748 GGGGTCTCCCTCGGGGGAGTCGG - Intergenic
1019565373 7:1676310-1676332 GGGTGGTCCCTCAGTGAAGAGGG - Intergenic
1019606624 7:1913375-1913397 GGGGGATCCATCAGGGCAGACGG + Intronic
1023240839 7:38145961-38145983 TGGTGTTCCTTCAGGGGAGTGGG - Intergenic
1029440137 7:100582854-100582876 GGGGGCTCCCGGAGGGAAGATGG + Intronic
1032789677 7:135233187-135233209 AGGGGTTCACTCTGGGTAGTAGG - Intronic
1035389812 7:158496899-158496921 GGGGGATGCTTCAGGGAAGGGGG - Intronic
1035646333 8:1223740-1223762 TGGTTTTCCCTAAGGGAAGTGGG + Intergenic
1036729288 8:11248268-11248290 GGGGGCTCTCCCAGGGCAGTCGG - Intergenic
1041946580 8:63450411-63450433 TGGGGTTCCCTCAGCTAAGCTGG - Intergenic
1045115175 8:98973659-98973681 GGGACTTCTCTAAGGGAAGTCGG - Intergenic
1051239138 9:15033443-15033465 GGTGGTGGCCTCAGGGTAGTTGG - Intergenic
1053282098 9:36827040-36827062 TGGGGTTCCCACTGGGCAGTGGG + Intergenic
1053860295 9:42379921-42379943 GGGGGTTCAATCAGGCCAGTTGG + Intergenic
1057327552 9:94079792-94079814 GGGGGATCACTCAGAGAAGTGGG - Intronic
1058544970 9:106051677-106051699 GGGGCTCCACTCAGGGAACTTGG + Intergenic
1059593594 9:115691981-115692003 GTGGGCTCCCTGAGGGAAGGAGG + Intergenic
1061187590 9:129063695-129063717 AGGGGTTCCCTCTGGCAGGTGGG - Intronic
1061976431 9:134070234-134070256 GGGGGTCACCTTAGGGCAGTGGG - Intergenic
1062399074 9:136364589-136364611 ACGGGTTCCCTCAGGGGAGCCGG - Intronic
1186377840 X:9026337-9026359 GTGAGTTCCTTCAGGGAAGGCGG + Intronic
1189287311 X:39860911-39860933 GGGAGTTGCCTCTGGAAAGTGGG - Intergenic
1189541794 X:41999353-41999375 GGGGGTTCCCACAGAAAATTAGG + Intergenic
1201921024 Y:19233330-19233352 TGGGGTTCCCCCAGAGAAGCAGG - Intergenic