ID: 1175808514

View in Genome Browser
Species Human (GRCh38)
Location 20:61844981-61845003
Sequence GGGACAGTGCCCAGCGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 239}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175808514_1175808526 9 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808526 20:61845013-61845035 TCAGCAGGGTGGGCCCAGGGTGG 0: 1
1: 0
2: 9
3: 43
4: 450
1175808514_1175808525 6 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808525 20:61845010-61845032 AATTCAGCAGGGTGGGCCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 201
1175808514_1175808522 -1 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808522 20:61845003-61845025 CCCGTCTAATTCAGCAGGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1175808514_1175808517 -5 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808517 20:61844999-61845021 GTCCCCCGTCTAATTCAGCAGGG 0: 1
1: 0
2: 1
3: 3
4: 32
1175808514_1175808520 -2 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808520 20:61845002-61845024 CCCCGTCTAATTCAGCAGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 39
1175808514_1175808528 15 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808528 20:61845019-61845041 GGGTGGGCCCAGGGTGGGCCTGG 0: 1
1: 0
2: 11
3: 126
4: 935
1175808514_1175808524 5 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808524 20:61845009-61845031 TAATTCAGCAGGGTGGGCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 176
1175808514_1175808529 16 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808529 20:61845020-61845042 GGTGGGCCCAGGGTGGGCCTGGG 0: 1
1: 0
2: 12
3: 83
4: 613
1175808514_1175808516 -6 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808516 20:61844998-61845020 TGTCCCCCGTCTAATTCAGCAGG 0: 1
1: 0
2: 2
3: 3
4: 45
1175808514_1175808527 10 Left 1175808514 20:61844981-61845003 CCCAGGTCGCTGGGCACTGTCCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1175808527 20:61845014-61845036 CAGCAGGGTGGGCCCAGGGTGGG 0: 1
1: 0
2: 9
3: 71
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175808514 Original CRISPR GGGACAGTGCCCAGCGACCT GGG (reversed) Intronic