ID: 1175809099

View in Genome Browser
Species Human (GRCh38)
Location 20:61848008-61848030
Sequence AAGAATAAACAGACGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175809099_1175809102 16 Left 1175809099 20:61848008-61848030 CCTCCATTCGTCTGTTTATTCTT 0: 1
1: 0
2: 0
3: 29
4: 329
Right 1175809102 20:61848047-61848069 GCAGAGCTTTGCTCAGCACCAGG 0: 1
1: 0
2: 1
3: 21
4: 318
1175809099_1175809103 27 Left 1175809099 20:61848008-61848030 CCTCCATTCGTCTGTTTATTCTT 0: 1
1: 0
2: 0
3: 29
4: 329
Right 1175809103 20:61848058-61848080 CTCAGCACCAGGCTCTACCCAGG 0: 1
1: 1
2: 2
3: 23
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175809099 Original CRISPR AAGAATAAACAGACGAATGG AGG (reversed) Intronic
900704998 1:4074980-4075002 AAGAAGAAACAAATGAATGAAGG + Intergenic
902894048 1:19466589-19466611 AAGAAGAAAAAGAGGCATGGGGG + Intronic
903440717 1:23386025-23386047 AAGAAGAATCAGACTCATGGCGG - Intronic
904703470 1:32373142-32373164 AGAAATAAAAAGAAGAATGGGGG - Intronic
907697817 1:56751682-56751704 GAGAAGGAACAGAAGAATGGTGG - Intronic
909351080 1:74654105-74654127 AATAATAAACAGAATATTGGTGG - Intronic
909783273 1:79576738-79576760 AATAATAAACAGAAAAATGGAGG + Intergenic
910556365 1:88538558-88538580 AAGAAAAAATAGGGGAATGGTGG - Intergenic
910574239 1:88740958-88740980 AAAAATAAACATACAAATGTGGG - Intronic
912099395 1:106186754-106186776 AAGAATAGAGAGAACAATGGAGG + Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915907353 1:159888504-159888526 AAGAATAAACAGAGTTAGGGAGG + Intronic
916330679 1:163612847-163612869 AAGATTAAACACACAAATTGGGG + Intergenic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
919846539 1:201646342-201646364 AAGAATAACAAGAGGAGTGGAGG - Intronic
920061594 1:203230545-203230567 AAAAAAAAACAGAAGAATGGTGG + Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
921312624 1:213859293-213859315 ATGAATAAACAGGCGAGGGGAGG - Intergenic
921525501 1:216211621-216211643 AAGAAGAAAAAGACAAAAGGAGG - Intronic
921845441 1:219874521-219874543 AAAAATAAAAAGACAAATGGGGG + Intronic
923828690 1:237529111-237529133 ATGAATAAATAAAGGAATGGAGG + Intronic
924531371 1:244896680-244896702 TAAAATAAACAAACGAATGATGG - Intergenic
1063839839 10:10058289-10058311 AAGAAAAAAAAGATGAAAGGAGG + Intergenic
1064420790 10:15189097-15189119 AAGAATAAATAAAAGAATGACGG - Intergenic
1064526297 10:16260339-16260361 AAGAATGAAGAGAGGAAGGGAGG + Intergenic
1064829763 10:19449676-19449698 AAGAACAAAGAGAAGATTGGAGG + Intronic
1065837070 10:29668246-29668268 AAGAAAAAACAGAGGAATATGGG + Intronic
1068241559 10:54308417-54308439 AAAAAGAAACAGTCGAAAGGAGG - Intronic
1071473273 10:86002798-86002820 TGGAATAAACAAACCAATGGAGG - Intronic
1072072352 10:91931426-91931448 AAGGATAGACAGACAGATGGAGG - Intronic
1072507436 10:96082685-96082707 AACAACAAACAAACAAATGGAGG + Intergenic
1072677103 10:97475796-97475818 AAGTAAAAACAGAAGAATGTGGG + Intronic
1072935448 10:99708114-99708136 GAGAATAAATAGAAGATTGGTGG - Intronic
1073163415 10:101421452-101421474 AAAAATAAACAGACCCAGGGAGG - Intronic
1073660657 10:105472454-105472476 AAGAATACACTGCCTAATGGAGG + Intergenic
1073680102 10:105693867-105693889 AAAAAAAAACAGAGGAAGGGAGG - Intergenic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1076414594 10:130276828-130276850 AAGAACAAAGAGAAGATTGGGGG - Intergenic
1077605787 11:3610774-3610796 CAGAATAACCAGACAAATGGAGG + Intergenic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1078129068 11:8596950-8596972 AAGAATTAATAGAAGAAAGGAGG + Intergenic
1079046949 11:17113404-17113426 TACCATAAACAGAAGAATGGAGG - Intronic
1079151355 11:17902556-17902578 AAGAACACCCAGAAGAATGGAGG + Intronic
1079379944 11:19929263-19929285 AAAAAGAAACAGACAAAGGGAGG + Intronic
1079778895 11:24573067-24573089 AAAAATAAACAGATAAATGAAGG + Intronic
1079949187 11:26780675-26780697 AAGCATAAACATAAGAAAGGAGG + Intergenic
1080905483 11:36540732-36540754 AAGAACAAAGAGAAGATTGGAGG - Intronic
1083246348 11:61430835-61430857 AAGAATAAAGATAGGGATGGGGG - Intronic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085703426 11:78764916-78764938 AAGGATAAAAAGGAGAATGGGGG + Intronic
1086641487 11:89162957-89162979 AGGAAAAAACAGATGAATGCTGG + Intergenic
1087278825 11:96187390-96187412 ATGAATAAACAAAAGAATTGAGG + Intronic
1087288673 11:96296342-96296364 AAGAATAAAAATAAGAAGGGAGG + Intronic
1087605421 11:100371357-100371379 AAGAAATAAGAGACAAATGGAGG + Intergenic
1088221304 11:107572709-107572731 AAGAATAAATAGACCATTTGGGG - Intergenic
1090030179 11:123199535-123199557 AAGAATAGAAAGATGGATGGAGG - Intergenic
1090374318 11:126278127-126278149 AAGAAGAGACAGAAGACTGGAGG - Intronic
1090942296 11:131397659-131397681 AAGAATAAACTCAGGAAAGGAGG - Intronic
1092726603 12:11492521-11492543 AAGAAAAAATAGACAAAAGGAGG - Intronic
1093047333 12:14463599-14463621 AGTAATGAACAGAAGAATGGGGG + Intronic
1093623090 12:21315353-21315375 TAGAATAAAGAAACTAATGGGGG + Intronic
1095427468 12:42092588-42092610 AAGAGAAAACAGACAACTGGGGG + Intronic
1095481589 12:42641821-42641843 AAGAAGAAATAGACAAATGAGGG + Intergenic
1095853480 12:46835516-46835538 AAAAATAAAGAGAAGATTGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096990098 12:55794124-55794146 AAGAAAAGACAGACAAATGTTGG + Intronic
1098331742 12:69360241-69360263 AAAAACAAACAGATAAATGGTGG + Intronic
1098895704 12:76057814-76057836 AAGAAAAAACAGAAGAGAGGTGG + Intronic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1100208999 12:92381875-92381897 AGGAAAAAAGAGAGGAATGGAGG + Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1101172105 12:102108235-102108257 TAGAAAAAACAGACAGATGGAGG + Intronic
1102288481 12:111679479-111679501 AAGATTAAAAAGTCCAATGGGGG - Intronic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1104440634 12:128790644-128790666 AAGAAAAAGCAGCCGAATGATGG - Intergenic
1106934034 13:34698433-34698455 AAGAATAAACAGACCACTTCTGG + Intergenic
1107379360 13:39839523-39839545 ACGAATAAACTGATGAATAGAGG + Intergenic
1107406154 13:40115767-40115789 AAGAATAAACACGAGAAGGGTGG - Intergenic
1109429749 13:62216330-62216352 GAGAATACACAGACACATGGAGG - Intergenic
1109847615 13:68016411-68016433 AAGAATAAAAGGAGGGATGGGGG - Intergenic
1111394886 13:87652498-87652520 AAGAATAAACAGACCAACAAAGG - Intergenic
1112382653 13:98906990-98907012 AAGCATAAACAGAAGATTGCAGG - Intronic
1112549931 13:100409761-100409783 AAAAATAAATAAACGAGTGGGGG - Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113423971 13:110192694-110192716 AAGCATAATCAGAAGAATGTTGG - Intronic
1113497165 13:110740213-110740235 AAGAATAAAAAGGAGATTGGAGG + Intergenic
1113659800 13:112098158-112098180 ACAAATAAACAGAATAATGGTGG - Intergenic
1113680683 13:112242219-112242241 AAGTAAAAACAGAGGGATGGAGG + Intergenic
1114390586 14:22303821-22303843 AAAAAAAAACAAAAGAATGGGGG - Intergenic
1114909689 14:27175208-27175230 AAGAAAATACAGTCTAATGGAGG - Intergenic
1115802324 14:37009087-37009109 AAGAATAAAGAGAGAGATGGTGG - Intronic
1117249463 14:53921962-53921984 AAGAATAATCAGATACATGGTGG - Intergenic
1118179042 14:63472653-63472675 AGGAATAAACAAAGGAAAGGTGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118756391 14:68847497-68847519 TAGAATAGACACACAAATGGTGG + Intergenic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1118916178 14:70108451-70108473 AAGAATGAAAAGAGGAAGGGAGG - Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119129424 14:72157815-72157837 AAGAATGAACAAAGGAATGGTGG - Intronic
1119848962 14:77852473-77852495 AAGAATAAAGATACGAATGATGG - Intronic
1120690173 14:87583597-87583619 AAGAATAAACAGACCACAGAAGG + Intergenic
1121567860 14:94924070-94924092 AATAATAGACAGAGGAATGAAGG - Intergenic
1122250221 14:100433667-100433689 CAAAATAAACAGACTAATGGGGG - Intronic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1124794799 15:32767204-32767226 AAGAAAAAAAGGACGCATGGAGG - Exonic
1126556475 15:49993621-49993643 AAGAATGAATAGACGAATTAAGG - Intronic
1126919751 15:53507995-53508017 AAGAATAAACAGAGAAATCAGGG - Intergenic
1127029911 15:54850708-54850730 AAGAATCAAAAGATCAATGGTGG + Intergenic
1127692179 15:61408139-61408161 AAGAAAGAACAGAGAAATGGAGG - Intergenic
1128095607 15:64952228-64952250 AAGAATAAGAAGAAGAAAGGAGG - Intronic
1128955686 15:71940939-71940961 AAGAAGAGACAGAAGAAAGGAGG + Intronic
1129938688 15:79474282-79474304 AAAAATGAACAGACCAAAGGAGG - Intergenic
1130009672 15:80140944-80140966 AAAAAAAAAAAGACAAATGGGGG + Intergenic
1130435809 15:83898296-83898318 AAGAAAAAGAAGAAGAATGGCGG + Intronic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1132034200 15:98467001-98467023 AAGATTAAAAAGACAAGTGGCGG + Intronic
1133142066 16:3752983-3753005 AAGAATAAACAAGCGGGTGGAGG + Intronic
1134535592 16:15024398-15024420 AAAAATAAACAGAAGAATTGGGG - Intronic
1139860449 16:70016379-70016401 AAAAATAAACAGAAGAATTGGGG + Intergenic
1140581497 16:76235742-76235764 AAAAATAAAGACACAAATGGAGG - Intergenic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1145014502 17:19387547-19387569 AAGAATAAACAGACATCTGCAGG - Intergenic
1146812087 17:35911918-35911940 AAGAATAAGCATAAAAATGGAGG - Intergenic
1148467554 17:47873959-47873981 AAGAAGAAAGAGAGGAAAGGAGG - Intergenic
1148952325 17:51324343-51324365 AAGAAAAAAAAGAGGGATGGAGG - Intergenic
1149185532 17:53992782-53992804 TAGAATAAAAAGTGGAATGGTGG - Intergenic
1149449021 17:56735060-56735082 AAGGATAAACAGATGAACAGAGG - Intergenic
1150198860 17:63332272-63332294 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1150924788 17:69521671-69521693 ATGAATAAATGGATGAATGGGGG - Intronic
1153618842 18:6957367-6957389 ATGAATGAACAGACAACTGGGGG + Intronic
1153685839 18:7544357-7544379 AAGCATAAGCAGACAAATGTAGG + Intergenic
1153849773 18:9082338-9082360 AATAAGAAACAGACTAAGGGAGG - Intergenic
1154123495 18:11670260-11670282 AAGAAGAAAAAGACGGGTGGAGG - Intergenic
1155363720 18:25029860-25029882 TGCAATAAACATACGAATGGAGG - Intergenic
1156783733 18:40883075-40883097 AAAAATAAACAGTTCAATGGAGG - Intergenic
1158584115 18:58715183-58715205 AAGAATTAACAGACTAATTTAGG - Intronic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159192441 18:65063540-65063562 AAGAATAAATACATGAATGAAGG + Intergenic
1160099334 18:75905423-75905445 AAGAATAAACAAACAAACGTTGG - Intergenic
1161364534 19:3870581-3870603 ATGAATAAACAAATAAATGGAGG + Intergenic
1161900426 19:7114691-7114713 AAAAATAAACAGGTGAATGGGGG - Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1163751525 19:19081136-19081158 AAGAATAAAGAAAAGAAAGGAGG + Intronic
1164266182 19:23619967-23619989 AGTAATAAACAGATGAATGCAGG - Intronic
1164612108 19:29639524-29639546 AAGAATAAACAGCCAGATGAAGG + Intergenic
1165599652 19:37043305-37043327 AAGAATAAAGGGACAAATCGAGG + Intronic
1166014246 19:39968271-39968293 AAGAGTATACATACAAATGGTGG + Intergenic
1167218680 19:48182875-48182897 ATGAATGAACGGATGAATGGAGG - Intronic
1167637563 19:50663842-50663864 AAAAATAAACAAACAAATGTGGG - Intronic
1167684145 19:50945089-50945111 AAAAAAAAAGAGACGAAGGGAGG - Intronic
1168488925 19:56791019-56791041 AAGAAAAAACAGATTAATGAAGG - Intronic
925487802 2:4355311-4355333 AAGAAAACACAGATGTATGGGGG + Intergenic
928536371 2:32245325-32245347 AAAAAAAAACAGATGAATAGAGG + Intronic
930514344 2:52387274-52387296 AAAAAAAAACAGAAGAATAGGGG - Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
932175154 2:69594045-69594067 AAGAATAAAAAGACTGAGGGAGG + Intronic
934743184 2:96740676-96740698 AAGAAAAAAAAGAGGAAGGGAGG - Intergenic
934880122 2:97969411-97969433 AAGAAGTAACAGACTAATGGAGG - Intronic
935030154 2:99313812-99313834 ATGAATAAACAGAGAAATGTAGG - Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
938241365 2:129744692-129744714 ATGAATAATCAAGCGAATGGGGG + Intergenic
939122141 2:138129954-138129976 AAGAACAAAGAGAAGATTGGGGG + Intergenic
939190008 2:138905289-138905311 AAGAAAAAACAGACTAATACAGG - Intergenic
939471821 2:142631894-142631916 AAGAACAAACAGGGGAATGCTGG - Intergenic
941595913 2:167476837-167476859 AAGAAGAAAAAGAAGAAAGGGGG + Intergenic
941613365 2:167689436-167689458 AAGAATAAAAGGAGGAATAGTGG + Intergenic
942330510 2:174818693-174818715 TAGAATAAACATATGAAAGGAGG + Intronic
943474798 2:188340936-188340958 AAGAAGAAACAGCTGAATGTCGG - Intronic
943753112 2:191530711-191530733 AAGAAAAAACAGATAACTGGAGG - Intergenic
943812153 2:192200514-192200536 AAGAAAAAATAGAAAAATGGAGG + Intergenic
944478626 2:200132030-200132052 AAGAATAATCAGGGGAAAGGAGG + Intergenic
945744060 2:213699128-213699150 AAAAATAAAAAGAGGAGTGGGGG - Intronic
945912841 2:215669179-215669201 AAGAACAGGCAGATGAATGGAGG - Intergenic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946781541 2:223196720-223196742 AAGGATCAACAGACTCATGGTGG - Intronic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
1171083452 20:22212601-22212623 AAGCATAAAAAGACAAATAGTGG - Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1172351499 20:34246245-34246267 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173260774 20:41432998-41433020 AAGACTCAACAGCAGAATGGTGG + Intronic
1173922383 20:46756188-46756210 AAAAAGAAACAGACGATTGATGG - Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177186759 21:17806043-17806065 AATAATAACCAGATGAATGAGGG + Intronic
1177979029 21:27887279-27887301 AAGAATAAAAAGACTAAAAGGGG - Intergenic
1178116726 21:29425516-29425538 AAGAAGAAACAGAAGTGTGGGGG + Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180287489 22:10762280-10762302 AAGAATAACCAAAAAAATGGGGG - Intergenic
1181365417 22:22372823-22372845 AACAATAAACAGTCTCATGGAGG - Intergenic
1182031628 22:27163536-27163558 AAGAAGAAAGAGAGGAATGAAGG + Intergenic
1182369152 22:29798877-29798899 AATAATGAACACATGAATGGAGG + Intronic
1182498591 22:30728877-30728899 TAGAATGGACAGACAAATGGTGG - Intronic
1183054150 22:35291763-35291785 AAGAATAAACAGACTTAAAGAGG + Intronic
1183663385 22:39234219-39234241 AGGAATCAACAGACGGCTGGGGG - Intronic
1184749338 22:46475642-46475664 AAAAATAAAGAAACGAATGGGGG + Intronic
1185305231 22:50111863-50111885 AAAAATAAGCAGACTGATGGAGG - Intronic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
949961894 3:9319110-9319132 AAGATTAAACAGGAGAATGCAGG - Intronic
952609957 3:35196709-35196731 AAGAAGAAACAGAGGAAAGGAGG - Intergenic
952812541 3:37417395-37417417 AATAATAAACAGAGGAAGGCGGG + Exonic
953165957 3:40465159-40465181 AACAATCAAGAGACGAATAGAGG + Intergenic
954491512 3:50910986-50911008 AAAAAAAAACAGACAAATGAGGG - Intronic
955809789 3:62775642-62775664 AACAATCAACAGACAAATGTAGG - Intronic
956918927 3:73905489-73905511 AAGAATTCACAGACTAATCGAGG - Intergenic
957240384 3:77653412-77653434 AAGAGGGAACAGACAAATGGTGG + Intergenic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
958777877 3:98507391-98507413 AAAAAAAAAGAGATGAATGGAGG - Intronic
959404352 3:105941996-105942018 AAGAAGAAAGGGAAGAATGGAGG - Intergenic
959432124 3:106267904-106267926 AAGAATAAATTGGAGAATGGGGG + Intergenic
959530587 3:107430961-107430983 AAGAATAGATAGACGAACGAAGG + Intergenic
960074570 3:113470182-113470204 AAGAACAAAGAGATAAATGGTGG + Intronic
960162698 3:114367781-114367803 AAAAAAAAACATACAAATGGGGG + Intronic
960223894 3:115147562-115147584 AAGTATTAACAGGCGATTGGTGG + Intergenic
961761657 3:129174362-129174384 AAAAAAAAAAAAACGAATGGCGG + Intronic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
963263563 3:143216755-143216777 AAAAATAAAAAGAGGAAAGGGGG - Intergenic
965314185 3:167170511-167170533 AACAATAAAAAGGCAAATGGAGG + Intergenic
965348473 3:167582564-167582586 AAGAATAAACAGACACATAGTGG - Intronic
965960936 3:174427638-174427660 AAGAAAAAAATGAGGAATGGAGG + Intergenic
965969734 3:174540081-174540103 AATATTAAAAAGACTAATGGAGG + Intronic
966025826 3:175280093-175280115 AGAAATAAACAGATGAATGTGGG - Intronic
966863829 3:184245333-184245355 ATGAAGAAAAAGACGAAGGGAGG + Exonic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967628706 3:191717111-191717133 AAGAATAAACAGACTAGTGATGG + Intergenic
969612324 4:8234327-8234349 ATGGACAGACAGACGAATGGAGG - Intronic
969931751 4:10637572-10637594 AAAAAAAAAAAGAGGAATGGTGG - Intronic
971551046 4:27955814-27955836 TAGAACACACAGACGCATGGTGG - Intergenic
971895526 4:32588862-32588884 AAGCAAAAGCAGACAAATGGTGG - Intergenic
972493975 4:39615378-39615400 AAAAATAAATAAATGAATGGGGG + Intronic
973083885 4:46030104-46030126 AAGATTGAAGAGATGAATGGGGG - Intergenic
973784470 4:54322182-54322204 AAAAATAATCAGAAAAATGGTGG - Intergenic
975801607 4:78065398-78065420 AAGAATAAATTCACAAATGGAGG + Intronic
976469774 4:85414787-85414809 AAGACAAAACAGGCAAATGGTGG + Intergenic
976526052 4:86090215-86090237 AAAAATAAACAGAAGAATTAGGG + Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978181726 4:105805802-105805824 AAGAAGAGGCAGAAGAATGGAGG - Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978625455 4:110680149-110680171 AAGAATAAAGAGAGAAAGGGAGG - Intergenic
978981001 4:114945223-114945245 AAAAAAAAAAAGACAAATGGAGG + Intronic
979032561 4:115668589-115668611 AAGAATAATAGGATGAATGGAGG - Intergenic
979321970 4:119335474-119335496 AAGAAGAAACAAACAAATGATGG - Intergenic
980345833 4:131617569-131617591 AAACATAAACACATGAATGGAGG - Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
982079557 4:151775523-151775545 AAGAACAAAGGGAAGAATGGTGG + Intergenic
982339198 4:154277174-154277196 AAGAATAAACACACAACTTGGGG + Intronic
982349179 4:154396244-154396266 AAGAAGAAACAAAGGAAGGGAGG + Intronic
982933480 4:161439244-161439266 CAGAACAAACAAACAAATGGTGG + Intronic
983239945 4:165221083-165221105 AAGAAGAAACAAACAAATGATGG - Intronic
983832522 4:172345921-172345943 GAGAATAAATAGTCGTATGGTGG - Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984456776 4:179978844-179978866 AACATTTAACAGAGGAATGGTGG + Intergenic
986914934 5:12607853-12607875 AAGAACACACAGACACATGGGGG - Intergenic
987073247 5:14357926-14357948 GAAAATAAACAGGCGAACGGCGG - Intronic
987319638 5:16756471-16756493 AAGAAAAAAGAGACAGATGGAGG - Intronic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
989604475 5:43230730-43230752 AAGAAAGAACAGATGAAGGGGGG + Intronic
989663810 5:43827908-43827930 AAAAATAAACAAAGAAATGGTGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
991339870 5:65596845-65596867 AAGAAGAAACAGAGTATTGGTGG - Intronic
992320651 5:75610811-75610833 AAGAATAAGCAGAGAAATTGGGG - Intergenic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
993103350 5:83569007-83569029 AAGAATAAATAAAGAAATGGGGG - Intronic
993488312 5:88514339-88514361 AGAAATAAACAGAGGAAGGGAGG + Intergenic
994475151 5:100258537-100258559 AAGAATGGAGAGAAGAATGGAGG - Intergenic
995419329 5:111945550-111945572 AAGAAGAAACAGAAGAAAAGAGG + Intronic
995949437 5:117691906-117691928 GAGAATACCCAGAGGAATGGGGG - Intergenic
996443393 5:123516026-123516048 AAGAAAAAACAGATCATTGGTGG - Intronic
996553598 5:124755113-124755135 AAGAAGAAGCAGAGAAATGGAGG - Intergenic
996652344 5:125894812-125894834 AAGAACAAAGAGAAGATTGGAGG - Intergenic
997849459 5:137317883-137317905 AAGAATAAAAATATGAATTGAGG - Intronic
998174995 5:139896227-139896249 CAGAACAAACAGACATATGGTGG + Intronic
998798493 5:145843776-145843798 ATGAATAAACTGAAGCATGGAGG + Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999639523 5:153658220-153658242 AAGAATACACAGAACAAGGGTGG + Intronic
1000010971 5:157232580-157232602 AAGAAGAAAGAGAGGAAGGGAGG + Intronic
1000161011 5:158597809-158597831 AAGAACAGAGAGAAGAATGGTGG + Intergenic
1000218111 5:159184098-159184120 AAGAAAAGACAGAAGAATTGAGG + Intronic
1000888139 5:166771434-166771456 AAAAATAAATAGAAGATTGGGGG - Intergenic
1001264571 5:170264198-170264220 AAGAACAAAAAGAAGATTGGAGG - Intronic
1001496383 5:172190204-172190226 AACAATAAACAGTCTAATTGGGG + Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004849289 6:19680485-19680507 AAGAAATAACAGAAGAATGCGGG + Intergenic
1005591675 6:27335176-27335198 AAGAAAACATAAACGAATGGTGG - Intergenic
1005946183 6:30597654-30597676 AAGAAAAAACAGACAGATTGGGG - Intergenic
1010045024 6:71431783-71431805 AAGAAAAAAGAGAGGAAGGGAGG - Intergenic
1012882998 6:104814117-104814139 AAGAATAAAGAAAAGAAAGGGGG + Intronic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013567163 6:111378151-111378173 AAGAATAAAAAGATGAGTGAAGG + Intronic
1014659769 6:124155481-124155503 AAGAATGAACAGGCCAATGAAGG + Intronic
1014930227 6:127326636-127326658 AAAAATAAACAGACAAAGTGGGG + Intronic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015591597 6:134827967-134827989 AAGAATAAAGAGATGAATCCCGG + Intergenic
1016447116 6:144145763-144145785 AAGAAAAAAAAGTAGAATGGTGG + Intergenic
1017067619 6:150543760-150543782 AAGAATAAATGAATGAATGGTGG + Intergenic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1022437964 7:30408308-30408330 AAGGAAAAGCAGACGGATGGTGG - Intronic
1022843776 7:34190242-34190264 AAGAATAAAGAAATGAATGAAGG + Intergenic
1023112824 7:36831308-36831330 AAGTATAGAAAGAAGAATGGAGG - Intergenic
1023676733 7:42637740-42637762 GTGAATAAACAGACAAGTGGAGG - Intergenic
1024669765 7:51583895-51583917 AAGATTAAACAGACCAAAGAAGG + Intergenic
1025913425 7:65846447-65846469 AAGAAGAAACATAGGAATGGAGG - Intergenic
1026515489 7:71067187-71067209 ATGAAATAACAGACAAATGGGGG - Intergenic
1027585842 7:80057618-80057640 TAGAATAGAGAGCCGAATGGTGG + Intergenic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1028399300 7:90407511-90407533 ATGAATGAACAAACAAATGGAGG - Intronic
1030580148 7:111344811-111344833 AAGGACAAACAGGAGAATGGAGG + Intronic
1032255144 7:130291225-130291247 AAAAACAAACACACAAATGGTGG + Intergenic
1034603201 7:152283163-152283185 AAGAATAACCAAAAAAATGGGGG - Intronic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1040442013 8:47453209-47453231 AAGAGGATACAGACAAATGGAGG + Intronic
1040576475 8:48655855-48655877 AATAATAAACATACAAATGGGGG - Intergenic
1041204855 8:55488637-55488659 GAGAATAAAAAGACCAATGGTGG + Intronic
1041213441 8:55576071-55576093 AAGAGGAAACAAACAAATGGAGG + Intergenic
1041239656 8:55838610-55838632 AAAAACAAACAGATGAAAGGTGG + Intergenic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1044014393 8:87032885-87032907 AAGAATTAACAGAAGATGGGAGG - Intronic
1044215525 8:89605058-89605080 AATAATAAACAGACAAATTCAGG - Intergenic
1044804780 8:95993984-95994006 AATAATGAACAGAAGAAAGGGGG + Intergenic
1044899249 8:96926519-96926541 AAGAAGAAAAAGAAGAAAGGAGG - Intronic
1045908734 8:107380115-107380137 AAGAATAAAAATACAAATAGAGG + Intronic
1047153957 8:122296264-122296286 AAGAAGAAAGGGAAGAATGGAGG + Intergenic
1048350958 8:133615937-133615959 AAGAAGAAAGAGAGGAAGGGAGG - Intergenic
1052078751 9:24177348-24177370 AAGCAAAAACTGACAAATGGGGG - Intergenic
1056135499 9:83626100-83626122 AAGACAACACAGACCAATGGGGG - Intronic
1057990223 9:99761184-99761206 AAGAAAAACCATAGGAATGGAGG - Intergenic
1059812615 9:117872639-117872661 AAGAATGCACAGACGAATGTAGG + Intergenic
1060557949 9:124519040-124519062 AAGAACAAACAAACAAATGTAGG + Exonic
1060675647 9:125512257-125512279 AAGAAGACACAGAGCAATGGAGG - Intronic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1185610954 X:1393259-1393281 AAGAAAAAACAGAGGAAGGGCGG - Intergenic
1186065635 X:5760451-5760473 AATAATAAACAGCCCTATGGGGG - Intergenic
1186257984 X:7743433-7743455 TTGAATAAATAGACAAATGGAGG + Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187209606 X:17216304-17216326 AAAAAAAAAAAGACGAATGGTGG - Intergenic
1187211415 X:17236111-17236133 AAGAAGAAAAAGAAGAAAGGAGG - Intergenic
1188050659 X:25481384-25481406 AAGAATTAACAGGGGAATGCAGG - Intergenic
1189231668 X:39456825-39456847 AAGAACAAACAAACGAATGAAGG + Intergenic
1190373120 X:49762264-49762286 AAGAAGAGAAAGAGGAATGGAGG - Intergenic
1190411026 X:50137284-50137306 AAAAAAAAACTGACGAATTGAGG - Intergenic
1194192461 X:90854751-90854773 GACTATAAACAGACGCATGGGGG + Intergenic
1194795223 X:98202696-98202718 AAGAAGAAGAAGAAGAATGGGGG + Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195681375 X:107549464-107549486 AAGAATCATCAGAGGTATGGAGG + Intronic
1196846937 X:119903935-119903957 AAAAATAAACAAAATAATGGTGG - Intronic
1199554718 X:149093932-149093954 AACACTAAACAGACTAATGCAGG + Intergenic
1200539093 Y:4437195-4437217 GACTATAAACAGACGCATGGGGG + Intergenic
1201728611 Y:17182462-17182484 GAGAATAAATAAACAAATGGTGG + Intergenic