ID: 1175812491

View in Genome Browser
Species Human (GRCh38)
Location 20:61866022-61866044
Sequence GCCAGGATGCTGGTGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175812491_1175812495 -7 Left 1175812491 20:61866022-61866044 CCTGTCACCACCAGCATCCTGGC 0: 1
1: 0
2: 1
3: 32
4: 320
Right 1175812495 20:61866038-61866060 TCCTGGCACTGAGGTCATCAAGG 0: 1
1: 0
2: 2
3: 18
4: 203
1175812491_1175812498 13 Left 1175812491 20:61866022-61866044 CCTGTCACCACCAGCATCCTGGC 0: 1
1: 0
2: 1
3: 32
4: 320
Right 1175812498 20:61866058-61866080 AGGGACCGAAGTTTCCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1175812491_1175812497 -6 Left 1175812491 20:61866022-61866044 CCTGTCACCACCAGCATCCTGGC 0: 1
1: 0
2: 1
3: 32
4: 320
Right 1175812497 20:61866039-61866061 CCTGGCACTGAGGTCATCAAGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1175812491_1175812499 16 Left 1175812491 20:61866022-61866044 CCTGTCACCACCAGCATCCTGGC 0: 1
1: 0
2: 1
3: 32
4: 320
Right 1175812499 20:61866061-61866083 GACCGAAGTTTCCTACCTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175812491 Original CRISPR GCCAGGATGCTGGTGGTGAC AGG (reversed) Intronic
900001553 1:17490-17512 GCCAGGAGCCAGGGGGTGACGGG - Intergenic
900021274 1:188014-188036 GCCAGGAGCCAGGGGGTGACTGG - Intergenic
902756633 1:18553255-18553277 TCCAGGATGCTTTTGGAGACAGG - Intergenic
902764756 1:18606854-18606876 ACAAGGATGATGGTGGTGCCAGG - Intergenic
902919338 1:19657038-19657060 GCCAGGATGGGGGTGGGGATGGG - Exonic
903594275 1:24482290-24482312 GCCAGGATGGGGGTGGGGAAGGG - Intergenic
905179734 1:36158015-36158037 GCCTGAATGGGGGTGGTGACTGG + Intronic
905309352 1:37038471-37038493 GGCAGGCTGCTGGTCGTGGCTGG + Intergenic
906275866 1:44515077-44515099 TCCAGGAGGCTGGTGTTGAATGG + Intronic
906697609 1:47834029-47834051 GCCAGGCTGCTGGTTTTCACTGG - Intronic
906811835 1:48834918-48834940 ACCAGGGTGCTGGTGGCGGCTGG + Intronic
912501211 1:110123325-110123347 GACAGGCTGCTGGTGGTGGGTGG - Intergenic
912949674 1:114111968-114111990 GCAAGAATGCTGGGGGTGTCTGG + Intronic
913346875 1:117818365-117818387 GCCAGGGTGCTGCTGCTGCCTGG - Intergenic
914370796 1:147022715-147022737 GCCAGGGGGCTGGTGGGGAATGG + Intergenic
914803198 1:150974863-150974885 GCCGGGAGGCTGGGCGTGACGGG + Exonic
915308338 1:154993813-154993835 GCCATGGTGCTGGTGGGGAGAGG - Exonic
919495713 1:198265400-198265422 GCCAAGATGCAAGTGATGACTGG - Intronic
920705050 1:208244462-208244484 GGCAGGGTGCTGGCGGTGGCGGG - Intergenic
921252039 1:213307348-213307370 GCCAGGATGCAGGTTTTGAAGGG + Intergenic
921377025 1:214485184-214485206 GCTAGGATGGTGGTGGTGGTGGG - Intronic
921453985 1:215344785-215344807 GCCAGGCTGCAGCTGATGACTGG - Intergenic
924847037 1:247784333-247784355 GACAGGTGGCTGGTGGTGAGTGG + Intergenic
924902660 1:248418192-248418214 CACAGGATGATGGTGGGGACAGG - Intergenic
1063230080 10:4057209-4057231 CACAGGCTGCTGGGGGTGACTGG - Intergenic
1065778417 10:29143805-29143827 GCAAGGATGCAGGTAGTTACAGG - Intergenic
1066358620 10:34709540-34709562 ACCAGGATGGTGGTGGAGGCGGG + Intronic
1067691483 10:48504780-48504802 GCTGGGATGCAGGTGGTGACAGG + Intronic
1069030919 10:63595294-63595316 GCCAGGAAGCTAGTGCTGAGTGG - Intronic
1069659905 10:70116792-70116814 ACCAGGAGGCTGGTGGGGACAGG + Intronic
1069830049 10:71277425-71277447 GACAAGATGCTGGTGGTGGGTGG + Intronic
1070728333 10:78807681-78807703 GGCAGGATGCTGGGGGAGGCAGG + Intergenic
1072799586 10:98383913-98383935 GCCAGGGTGGGGGTGGGGACAGG + Intronic
1072964994 10:99964293-99964315 GCCACCATGCTGGTAGTGATGGG + Intronic
1074407030 10:113188450-113188472 GCCAGGTTGCTGAGGGAGACTGG + Intergenic
1075087193 10:119421617-119421639 CCCAGGCTGCTGTTGGTAACTGG + Intronic
1075742571 10:124704850-124704872 GCAAGGATTCTTGTGGTAACTGG - Intronic
1076307722 10:129476646-129476668 GCCAGGCTGCTGGGAGTGGCTGG + Intronic
1076496899 10:130903530-130903552 GCCAGGAAGCTGCTGGTCCCAGG - Intergenic
1077093938 11:791530-791552 GCCAGGATGGCTGTGGAGACTGG + Exonic
1077129559 11:964014-964036 GCCAGGATGTCAGTGGTGCCAGG + Intronic
1077209975 11:1365834-1365856 GAGATGATGATGGTGGTGACAGG + Intergenic
1077209985 11:1365916-1365938 GAGATGATGATGGTGGTGACAGG + Intergenic
1077210004 11:1366080-1366102 GAGATGATGATGGTGGTGACAGG + Intergenic
1077210014 11:1366162-1366184 GAGATGATGATGGTGGTGACAGG + Intergenic
1077432482 11:2522719-2522741 GCCAGGCAGATGGTGGGGACAGG - Intronic
1077897367 11:6463598-6463620 GCCAGGACGCAGCTGGTGACTGG + Intronic
1079182358 11:18204807-18204829 GCTAGGGTGCTGGTGGTGGCAGG - Intronic
1079529052 11:21427037-21427059 GCCAGGCAGCTGGTGGTGCGTGG + Intronic
1080343826 11:31298413-31298435 GTTAGGATGCAGGTGGTGACTGG + Intronic
1080485698 11:32704571-32704593 GACAGCATGTTGATGGTGACAGG + Intronic
1081216366 11:40404217-40404239 GCTAGGATTCTGGGAGTGACTGG - Intronic
1081746555 11:45477090-45477112 GCCAGGAGGCTGGAGAAGACAGG - Intergenic
1082983257 11:59143363-59143385 AGCAGGATGCTGGTGGGGACAGG + Intronic
1083252203 11:61475632-61475654 CCCAGGAGGCTGGGGGTGGCAGG - Intronic
1083259060 11:61513461-61513483 GCCTGGAGGCTGGTGGGGGCGGG - Intergenic
1084425801 11:69084023-69084045 CCCAGGCTGCTGCTGGTGGCGGG + Intronic
1084557163 11:69882006-69882028 GCCAGGCTGCTGCTGGGGACGGG + Intergenic
1084640303 11:70421875-70421897 GGCAGAATGCTGCTGGAGACCGG - Intronic
1085076514 11:73597375-73597397 GGCAGGATGATGGAGGTGGCAGG - Intronic
1087094568 11:94306798-94306820 GCCAGGATGCTAGTAGGAACAGG + Intronic
1087191568 11:95259592-95259614 GCCAGGAGCTGGGTGGTGACTGG + Intergenic
1088727359 11:112651331-112651353 CCCAAGATGCTGGGGGTGAAGGG + Intergenic
1090124902 11:124075552-124075574 GCCAGGCTGCTGGTGGAGTGGGG - Intergenic
1090464926 11:126925337-126925359 TCCAGGATGCCTGTGGTGGCGGG + Intronic
1090848973 11:130554667-130554689 ACCAGGGTGATGGTGGTGAGGGG + Intergenic
1091034150 11:132218105-132218127 CCCCGGATGCTGGTGCTGACAGG - Intronic
1091168391 11:133500363-133500385 GCCAGGATTCTCTTGGTGACAGG - Intronic
1091219373 11:133920937-133920959 GGCTGTATGCTGGTGGTGGCAGG + Exonic
1091610629 12:2004557-2004579 GGCAGGAGGGTGGGGGTGACTGG - Intronic
1096423268 12:51478798-51478820 ATCAGGATTCTGGTTGTGACTGG + Intronic
1096672809 12:53210413-53210435 GCCTGGATTGTGGTGGGGACAGG - Intergenic
1101325529 12:103712275-103712297 GCCAGGATACTGAGGGTGAAGGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102773827 12:115501853-115501875 GCCAGGATTCTGGCAGTGCCGGG + Intergenic
1103954572 12:124568925-124568947 GCCAGGATGCTGGGTTTGCCGGG + Intergenic
1106143128 13:27027566-27027588 GCCATGATGCAGGTGCAGACAGG + Intergenic
1107717165 13:43211851-43211873 GTCAGGATGATGGTGGTAGCAGG + Intergenic
1111194839 13:84860974-84860996 GCCAAGAGGGTGGTGGTGGCTGG - Intergenic
1112287406 13:98116492-98116514 GCGAAGATGGTGGTAGTGACTGG + Intergenic
1112697869 13:101970872-101970894 TCCTGGAGGGTGGTGGTGACAGG - Intronic
1113704963 13:112424198-112424220 GCAGAGATGCTGGTGGAGACAGG - Intronic
1114487467 14:23071478-23071500 GCCAGGCTGCTGGTAGTGGCTGG + Intronic
1114612563 14:24052290-24052312 GCCAGGATGCATGGGGTGAGGGG - Intronic
1115814916 14:37153417-37153439 GCCAGGAAGCGGGTGCTGTCAGG + Intronic
1116044833 14:39732002-39732024 GCCAGGATGCTGTAGGTGGTGGG + Intergenic
1116330810 14:43595700-43595722 GCCAGGCTGCTCCTGGAGACTGG + Intergenic
1117076162 14:52106811-52106833 GCCAGGATTCTGGTGGTTCCTGG + Intergenic
1119267188 14:73269885-73269907 GCCAGGCTGAGGGTGGAGACTGG + Intronic
1121034079 14:90684710-90684732 CCCTGGATGGGGGTGGTGACTGG + Intronic
1121617419 14:95321852-95321874 GCCAGGGAGCTGTTGCTGACTGG - Intergenic
1122164749 14:99813901-99813923 GCCAGGAGGTTGCTGGTGCCTGG + Intronic
1122259316 14:100503222-100503244 GACAGCATGCTGGGCGTGACTGG - Intronic
1122320079 14:100850230-100850252 ACCAGCATGAAGGTGGTGACCGG + Intergenic
1122412190 14:101531336-101531358 CCAATGATGCTGGTGTTGACTGG + Intergenic
1123023649 14:105413550-105413572 TCCAGGATGCTGGTGATGCTGGG + Exonic
1123037015 14:105475635-105475657 GACAGGATGCAGGTGGTGGCGGG + Intronic
1127834478 15:62779604-62779626 GCCAGGATGCTGGAGCTGAAGGG - Intronic
1127959125 15:63878064-63878086 CCCTGGATGCTTGTGGTGAGAGG - Intergenic
1127982008 15:64042269-64042291 GCCAGGATGTTGGGGATGAGGGG - Intronic
1128888007 15:71305913-71305935 CATAGGATGGTGGTGGTGACTGG - Intronic
1129245534 15:74276670-74276692 GCCAGGAGGCTGGAGGGCACAGG - Intronic
1131503868 15:92998451-92998473 ACCAGGATGTGGGTGGTGGCGGG + Intronic
1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG + Intergenic
1132451955 15:101973446-101973468 GCCAGGAGCCAGGGGGTGACTGG + Intergenic
1132576412 16:666382-666404 GCCTGGGTGCTGGTGGGGGCAGG + Intronic
1138429624 16:56960581-56960603 GCCAGGGTACTGGTGGTCAGTGG - Intergenic
1139321262 16:66116307-66116329 GCCAGGCTGATAGAGGTGACAGG - Intergenic
1139983489 16:70879478-70879500 GCCAGGGTGCTGTAGGGGACAGG + Exonic
1140148241 16:72333167-72333189 GGCAGGATGCTGGTGGGCACAGG + Intergenic
1141228101 16:82138547-82138569 GGCAGGTTGCTGCAGGTGACGGG - Intergenic
1141608310 16:85168107-85168129 GCCAGTCTGCTGATGGGGACGGG - Intergenic
1141674136 16:85508699-85508721 CTCAGTATGCTGGTGGAGACTGG + Intergenic
1142259925 16:89037915-89037937 GCCAGGCTCCTGGTGGGGCCTGG + Intergenic
1142741474 17:1934296-1934318 GGCAGGCGGCTGGTGGGGACGGG - Intergenic
1142762717 17:2051150-2051172 GCCAGGCTGCGGGAGGCGACCGG - Intergenic
1143324246 17:6088083-6088105 GCCAGGATGCGTGTGCTGAGCGG + Exonic
1143437311 17:6938937-6938959 CCCAGGATGCTGGTGGTACATGG - Intronic
1144058390 17:11560540-11560562 GGCAGGATGCTGGTGGTGAGGGG + Exonic
1144743208 17:17595875-17595897 GCAAGGATGTTGGTGCTGGCAGG + Intergenic
1145007186 17:19344479-19344501 GCCAGGAGGCCGGGGGTGTCAGG + Intronic
1146135120 17:30313336-30313358 GTCATGATGGTGGTGATGACAGG + Intergenic
1147182308 17:38694052-38694074 GCCAGGAAGCTGCTGGAGAGTGG + Intergenic
1147454481 17:40528305-40528327 CCCAGGGTGCTGGGGATGACAGG - Intergenic
1147494132 17:40899769-40899791 GCCAGCATGGTGGTGGTGTGAGG + Intergenic
1148483831 17:47977827-47977849 TCCAGGATCCTGGAGGTGATGGG + Exonic
1148683349 17:49486999-49487021 GCCTGGAGGCTGGTGGGCACTGG - Intergenic
1148859491 17:50596608-50596630 GCCTGGATGGTGATGGGGACAGG + Exonic
1149949192 17:60966939-60966961 GTCAAGATGCTGGGGGTGCCAGG - Intronic
1150492454 17:65583874-65583896 CCCAGGAGGCTGGTGGGGGCTGG + Intronic
1151551783 17:74826609-74826631 GCCAAGATGCTTTTGGTGCCTGG + Intronic
1152026078 17:77810244-77810266 GCGATGATGGTGGTGGTAACGGG + Intergenic
1152070544 17:78131861-78131883 GCCTGGACGGGGGTGGTGACAGG - Exonic
1152583833 17:81180454-81180476 GCCAGCAGGGTGGTGGTGAGCGG - Intergenic
1152732391 17:81978662-81978684 GCCAGGAGGCTGTTGGTGCCAGG + Intronic
1152768323 17:82152750-82152772 ACCAGGAAGCTGGCGGGGACAGG - Intronic
1155417656 18:25617207-25617229 GCTGGGATGGTGGTGGTGAAGGG + Intergenic
1155834283 18:30559473-30559495 GTAAGGATGCTAGTGGAGACTGG + Intergenic
1155965778 18:32034084-32034106 GCCAAGGTGCTGGAGGTGCCAGG - Intronic
1157292330 18:46419111-46419133 GCCAGGGTGCTTCTGTTGACAGG + Intronic
1158408806 18:57186457-57186479 GCAAGGTTGCTGGTGGTGGTGGG + Intergenic
1158826902 18:61231764-61231786 GCCAGGTGGGTGGTGGTGATGGG - Intergenic
1159996417 18:74969713-74969735 GCTAGGCTGCTTGTGGTAACTGG + Intronic
1160128712 18:76204882-76204904 GCCATGATGGCGATGGTGACAGG - Intergenic
1160461400 18:79041658-79041680 GCCAGGATTTCAGTGGTGACTGG + Intergenic
1160753929 19:748037-748059 CCGAGGCTGCAGGTGGTGACTGG - Exonic
1161233244 19:3186025-3186047 GCCAGGATGCTGGAGGAAGCGGG + Exonic
1161556159 19:4944012-4944034 GGCAGGATGGTAGTGGTGCCAGG + Intronic
1161616489 19:5273685-5273707 CCCATGATCCTGGGGGTGACTGG + Intronic
1161756144 19:6135717-6135739 GCCAGGATGATGGTGGTGGTGGG - Exonic
1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG + Intronic
1162456242 19:10786722-10786744 GCCAGGGTGGTGGTGGTGGTGGG - Intronic
1164936984 19:32222865-32222887 GCCAGGATGCTGCTGCTGCCGGG - Intergenic
1165102575 19:33447563-33447585 GCCAGGCTGCTGGTGGGCACAGG - Intronic
1165732129 19:38152604-38152626 GCCAGGGAGCTGGTGGCGGCGGG - Intronic
1165947364 19:39452234-39452256 TCCAGGATGCTGCTGGTGCATGG + Intronic
1166010184 19:39935709-39935731 GCCAGGCTGCAGGTGGGCACTGG + Intergenic
1166841271 19:45698673-45698695 GCCTGGATCCTGGTGGGGCCGGG - Exonic
1168128045 19:54298104-54298126 CCCCTGGTGCTGGTGGTGACAGG - Intergenic
1168315943 19:55484839-55484861 GCCAGGATGCTGAGCGTGGCCGG + Intergenic
1168472942 19:56654482-56654504 GCCAGGGTGGTGGTAGTGAAGGG + Intronic
925362536 2:3289496-3289518 GCCAGGAGGCTGGTGCAGAGTGG - Intronic
925587302 2:5476264-5476286 TCCTGGCTGCTGGTGGTTACCGG - Intergenic
927638540 2:24832718-24832740 GCCTGCATGCTGGTGATGCCAGG + Intronic
927936300 2:27078650-27078672 GACCGGATCCTGGGGGTGACAGG - Exonic
928490526 2:31778387-31778409 GCGGGGGTGCTGGTGGGGACTGG - Intergenic
929319508 2:40525961-40525983 GACACGATGCTGGTGGGGATGGG + Intronic
929927967 2:46230897-46230919 GACAGGATGTTGCTGGGGACAGG + Intergenic
931490542 2:62741259-62741281 GCCAGCATGGTGGTGGTGGTTGG + Intronic
932095832 2:68847521-68847543 GACAGTCTTCTGGTGGTGACTGG + Intergenic
932446005 2:71782057-71782079 TCCAAAATGCTGGTGGTGAAGGG + Intergenic
932468760 2:71940266-71940288 GCCAGGTTCCCGGTGGGGACTGG - Intergenic
932736202 2:74256403-74256425 GCCAGGAAGCTGGTGGCAAAGGG - Intronic
933750946 2:85601960-85601982 GCCAGGGTGGTGGTGGTGTTGGG + Exonic
935456094 2:103269139-103269161 CCGAGGATGCAGGTGGTGAGAGG + Intergenic
936083719 2:109452745-109452767 CCCAGGAGGCTGGTGCTGGCAGG + Intronic
936568171 2:113595923-113595945 GCCAGGAGCCAGGGGGTGACTGG + Intergenic
936881335 2:117254857-117254879 GCCAGCATGCTGGGGAGGACAGG + Intergenic
937204416 2:120226298-120226320 CCTAGGATGCTGGTGATGAAAGG - Intergenic
937825553 2:126365147-126365169 CCCAGGTTGATGGTGGTGACTGG + Intergenic
939057589 2:137382890-137382912 GCCAGGATGCTGCTGCTGCCTGG + Intronic
939886547 2:147687074-147687096 GCCATGATGTTTGTGGTGATCGG + Intergenic
946444521 2:219726952-219726974 GCCAGGGTGGTGGTGGAGTCGGG + Intergenic
947586585 2:231360537-231360559 GGCACACTGCTGGTGGTGACAGG - Intronic
947948225 2:234124788-234124810 CCCTGGAGGCTGGTGGTGAGGGG - Intergenic
948098139 2:235352797-235352819 GCCAGGGTGGTGGTGATGAGGGG + Intergenic
948695581 2:239731659-239731681 GCCAGGCTCCTGGTGGCCACTGG + Intergenic
948872714 2:240811792-240811814 GCCGAGAAGCTGGTGGTGGCAGG + Intronic
1170244250 20:14203870-14203892 GCTTGGGTGCTGGTGGTGGCAGG + Intronic
1170577045 20:17672005-17672027 GCCAGGAGGCTGGCTGTGCCAGG + Intronic
1171150132 20:22820562-22820584 GGCAGCCTGCTGCTGGTGACAGG - Intergenic
1172307947 20:33894980-33895002 CCAAGGAAGCTGGTGGTGAGAGG - Intergenic
1172772192 20:37388307-37388329 GCCAGGAGGCTGGGGCTGCCAGG + Intronic
1172801413 20:37578970-37578992 GCCTGGCTGCTGGTGGAGAAGGG - Intergenic
1173672295 20:44807220-44807242 CCCAGGATGCTGGTCATTACTGG - Intronic
1173787255 20:45803254-45803276 GCCAGCTTGCTGGTGGTGGTAGG - Intronic
1174185520 20:48703461-48703483 GCGAGGATGCTGGGGGTCCCAGG - Intronic
1174200789 20:48805121-48805143 GCCAGGAGGCTGGTGGGCACTGG - Intronic
1175240218 20:57541952-57541974 GCCAGGAACCTGGTGCTGTCAGG + Intergenic
1175812491 20:61866022-61866044 GCCAGGATGCTGGTGGTGACAGG - Intronic
1179430507 21:41317764-41317786 GCCAGAATGCTGGTGCTGGCAGG - Intronic
1179768035 21:43588705-43588727 GAGAGGATGCTGGTGGTGCCAGG - Intronic
1180070533 21:45433886-45433908 GCCAGGAGCCAGGTGGTGTCAGG + Intronic
1181064065 22:20297406-20297428 GCCAGGGTGCTTGTGAGGACTGG + Intergenic
1181130216 22:20726830-20726852 GCCATGATGATGGTGGAGAAGGG - Intronic
1181167648 22:20992136-20992158 GCCAGGATGGTGGGGGTCTCTGG + Intronic
1181480928 22:23198637-23198659 GGCACCATGCTGGTGGTGCCTGG + Intronic
1181865588 22:25852063-25852085 CCCAGGGTGCTGGTGCTGAATGG - Intronic
1184656256 22:45943610-45943632 GCCAGGATCCAGGTGCTGAGAGG - Intronic
1184659673 22:45960095-45960117 GCCATGATCCTGCTGGTGTCAGG - Intronic
1184694258 22:46131016-46131038 GACAGGAAGCTGGTGGGGATAGG + Intergenic
1184888908 22:47367636-47367658 CCCAGGATGGTGGTTGTGAGTGG - Intergenic
1184924719 22:47629268-47629290 CCCAGGACCCTGGTGTTGACTGG - Intergenic
1185148056 22:49149932-49149954 TCCAGGATGTGGGTGGTGGCAGG - Intergenic
1185156457 22:49196114-49196136 GCCTGTTTGCTGATGGTGACTGG - Intergenic
1185172011 22:49299647-49299669 GGCAGGATGTGGGTGGTGTCTGG - Intergenic
949115353 3:314654-314676 GCCAGGATGATGGGGATGATGGG + Intronic
950334147 3:12180471-12180493 CCCAGGATGCTCTGGGTGACTGG + Intronic
950639614 3:14340323-14340345 GCCAGGGGGAGGGTGGTGACTGG + Intergenic
951822500 3:26827838-26827860 GCAATGCTGCTGGTGGGGACAGG - Intergenic
954363276 3:50133610-50133632 GCCAGGAGGCAGGTGGGGGCAGG - Intergenic
954424879 3:50438070-50438092 GCCAGGATGCTGGTGGGACAGGG + Intronic
956231179 3:67018509-67018531 GCCAGGATGGGTGTGGAGACAGG + Intergenic
956481926 3:69681636-69681658 CCCAGGATGCTGGGGTTGGCAGG + Intergenic
957590139 3:82186136-82186158 GGCAGGAAGCGGGTGGTCACAGG - Intergenic
960169963 3:114448420-114448442 TCAGGGTTGCTGGTGGTGACGGG + Intronic
960298024 3:115967961-115967983 CCTAGGATGGTGGTGGTCACAGG - Intronic
961059657 3:123817694-123817716 GCCATGAGGCTGGTGATTACAGG + Intronic
961129653 3:124454149-124454171 GACAAGATTCTGGTGGTGACAGG + Intronic
961699869 3:128734769-128734791 GCCAAAAGGCTGGTGGTGAAAGG - Intronic
961750843 3:129093724-129093746 GCCAGGAAGAGGGTGGTGCCTGG - Intronic
963642201 3:147874682-147874704 GGTAGGATGCTGGTCATGACTGG + Intergenic
966874801 3:184315602-184315624 GACAGCATGTTGGTGGGGACAGG + Exonic
968262081 3:197333579-197333601 TCCTGGCTGCTGGTGGTGGCGGG - Intergenic
968513834 4:1007674-1007696 TTCAAGATGCTGGAGGTGACAGG - Intergenic
968513841 4:1007748-1007770 TTCAAGATGCTGGAGGTGACAGG - Intergenic
968513848 4:1007822-1007844 TTCAAGATGCTGGAGGTGACAGG - Intergenic
968931761 4:3583757-3583779 GCCTGGATGCTGGAGGAGACAGG - Intronic
969379259 4:6783212-6783234 GCCCCGATCCTGGTGGTGCCCGG + Intronic
970101273 4:12524887-12524909 GGCAGAGTGCTGGTGGGGACTGG - Intergenic
974240340 4:59238198-59238220 GGCAGGATGCTGGTGGGGATGGG + Intergenic
974869062 4:67615893-67615915 GGCAGGGAGCTGGTTGTGACTGG + Exonic
975899197 4:79129814-79129836 GACAGGGTGCTGGTGGGCACAGG + Intergenic
976983659 4:91265571-91265593 GCCATGATGCTGAAGGTGATAGG + Intronic
977676713 4:99756368-99756390 GACGGGATGGGGGTGGTGACGGG - Intergenic
979728376 4:123992084-123992106 GCCACTCTGCTGGTGGGGACTGG - Intergenic
980554654 4:134387326-134387348 GACAGGAAGCTGCAGGTGACGGG - Intergenic
981014674 4:139961468-139961490 GCCAGGATGATGGAATTGACTGG - Intronic
981747218 4:148063401-148063423 TCCAGGATGCTGGGGGTATCTGG - Intronic
984593838 4:181645301-181645323 CCCAGGATTCTGGTGGTTAGAGG + Intergenic
985577311 5:679367-679389 GGCAGGATCCTGGTGGGGGCTGG + Intronic
985592225 5:771418-771440 GGCAGGATCCTGGTGGGGGCTGG + Intergenic
985592251 5:771483-771505 GGCAGGATCCTGGTGGGGGCAGG + Intergenic
986008971 5:3695028-3695050 ACCACCATGCTGGTGGAGACGGG + Intergenic
986320911 5:6632541-6632563 GCCAGGATGCTGGAGGTTAAAGG - Intronic
986723300 5:10575918-10575940 GCCTTGATGGTGGTGGTTACAGG + Intronic
988336438 5:29914128-29914150 GGCAGGGTGCTGGTGGGGGCAGG - Intergenic
988524958 5:31978898-31978920 GCCAGGAAGCTGGAGAGGACAGG + Intronic
988835428 5:35027896-35027918 GCAAGGATTCTGGTGCTGAATGG - Intronic
989559942 5:42838525-42838547 TCCCTGATGCTGGTGGTGATTGG - Intronic
989782610 5:45287258-45287280 GCCTAGAGGTTGGTGGTGACAGG - Intronic
992327114 5:75671133-75671155 ACTATGATGATGGTGGTGACAGG + Exonic
993047807 5:82888406-82888428 ACCAGGAAGGTGGTGGTGAAGGG - Intergenic
993178470 5:84518651-84518673 GGCAGGGTGCTGGTGGGCACAGG + Intergenic
993718315 5:91296982-91297004 GCCAGGATGTTGATGCTGCCAGG + Intergenic
995589022 5:113679142-113679164 GCCAGGGTGGTGGTGGTGGTGGG + Intergenic
995742334 5:115368464-115368486 GCCAGCATGATGGTAGTGGCTGG - Intergenic
995978788 5:118076160-118076182 GACAGGAAGTTGGTGGTGTCAGG + Intergenic
996045973 5:118873793-118873815 GGCAGGATGCTGGTTGGTACAGG - Intronic
998096937 5:139401348-139401370 GGAAGGATGCATGTGGTGACAGG - Intronic
998275933 5:140753493-140753515 GGCAGGGTGCTGGTGGTGGCTGG + Intergenic
998486975 5:142511533-142511555 CCCAGGCTGCTGGTGGGGAAGGG + Intergenic
999251238 5:150183615-150183637 GCCAGGAGGCTGGTGTTGCTGGG - Exonic
1001772388 5:174306016-174306038 GCCAGGGAGCTGGTGGAGAGAGG + Intergenic
1003242516 6:4357317-4357339 GCCAGCATGCTGATGTTTACAGG - Intergenic
1003545051 6:7052008-7052030 GGCAGGTAGCGGGTGGTGACGGG - Intergenic
1003873409 6:10418521-10418543 GCCAGGATGGTGGCGGTAAAAGG - Intronic
1003995704 6:11537878-11537900 GCCAGGAGGCCGGTGCTGATGGG - Intergenic
1007701528 6:43769108-43769130 GCCAGGGGGCTGGTGGGGGCGGG - Intergenic
1007747762 6:44053575-44053597 GCCAGGCTGATGATTGTGACTGG - Intergenic
1008621539 6:53276275-53276297 GCTCAGATGCTGTTGGTGACTGG - Intronic
1008639083 6:53443180-53443202 ACCAGGAGGCTTGTGGTGACAGG + Intergenic
1009773469 6:68175297-68175319 GCTTGCATGCTGGTGGTGAAGGG - Intergenic
1012294314 6:97501581-97501603 GCCACGGTGGTGGTGGTGACTGG - Intergenic
1012889898 6:104885862-104885884 CCCAGGCTGCTTGTGCTGACGGG - Intergenic
1013438610 6:110138945-110138967 GACAGCATGTTGATGGTGACAGG - Intronic
1017416206 6:154223512-154223534 GACAGGAGGCCGGTGGAGACAGG - Intronic
1017442024 6:154473515-154473537 GCCACGATGCTGGGGGAGAATGG + Intronic
1017483681 6:154883034-154883056 GGAAGGGTGCTGGTGGTCACTGG - Intronic
1017970224 6:159305984-159306006 CACAGGGGGCTGGTGGTGACAGG + Intergenic
1019091435 6:169538187-169538209 GGCAGGATCCTGATGGTCACAGG + Intronic
1019275155 7:172334-172356 GCCAGGATGGTGGGGGTCCCGGG - Intergenic
1019452499 7:1107004-1107026 GCAAGGAGGCTGGTGCTGGCAGG - Intronic
1020423445 7:8036189-8036211 GCCAGGATGGTGGAGGTCTCAGG - Intronic
1020808457 7:12821145-12821167 GGCAGGAAGTTGGCGGTGACTGG - Intergenic
1022248559 7:28584539-28584561 TCCTGGATTCTGGTGGTGGCTGG - Intronic
1022687299 7:32608837-32608859 GCCAGGACGCTGTAGGTGCCTGG + Intergenic
1024184701 7:46938449-46938471 GGAAGAATACTGGTGGTGACAGG + Intergenic
1024189137 7:46987459-46987481 GGCAGGAAGTTTGTGGTGACTGG - Intergenic
1024657360 7:51462643-51462665 ACGATGATGCTGGTGGTGTCAGG - Intergenic
1025263991 7:57440649-57440671 GGCAGGATTCTGGTGATCACTGG + Intergenic
1027138087 7:75638867-75638889 GCCAGGATTCTGGAGGCGGCTGG - Intronic
1027674756 7:81143561-81143583 CCTGGGATGCTGGTGGTTACTGG + Intergenic
1029551911 7:101241045-101241067 GCTAGGGTGCTGGGAGTGACTGG - Intronic
1031478740 7:122253105-122253127 GGCAGGATGAAGGTGGAGACAGG - Intergenic
1032076212 7:128837325-128837347 GCCAGGGTGCAGGGGGAGACTGG + Intronic
1032737060 7:134702225-134702247 AGCAGGATTCTGCTGGTGACAGG - Intergenic
1034740699 7:153470999-153471021 GGCAGGAGGCTGCTGGTGTCCGG + Intergenic
1035583089 8:752497-752519 CCCAGGCGGCTGGTGCTGACCGG - Intergenic
1039862761 8:41473123-41473145 GGCAGGATGCTGGAGGTCAAAGG + Intergenic
1040715708 8:50249352-50249374 GCCTGGCTGTTGGTGGGGACAGG - Intronic
1040977898 8:53214628-53214650 GGCAGGATGCTGGTGGGGGTGGG + Intergenic
1041721749 8:60982555-60982577 GTCAGGATCTTGGTGGTGAGTGG + Intergenic
1042333906 8:67610573-67610595 AGCAGGTTGCTGGAGGTGACAGG + Intronic
1043012293 8:74895739-74895761 GCCATCAGGCAGGTGGTGACAGG - Intergenic
1044493088 8:92844229-92844251 CCCAGGATGGAGGTGGTGAAAGG + Intergenic
1046491011 8:114953036-114953058 GCCAGGATTCTGGAGGTCCCTGG - Intergenic
1047758135 8:127934350-127934372 ACCAGTCTGGTGGTGGTGACTGG + Intergenic
1048203013 8:132392405-132392427 GCAAGGATGCTGGTGTGGCCGGG - Intronic
1049257147 8:141620179-141620201 CCCGGGATGCTGGTGGGGATTGG + Intergenic
1049884362 9:17603-17625 GCCAGGAGCCAGGGGGTGACTGG - Intergenic
1049989982 9:981580-981602 GCTGGGATGCTGCTGGGGACCGG + Intronic
1050567623 9:6902561-6902583 GTGAGGATGCGGGTGGTGATGGG + Intronic
1050675929 9:8053215-8053237 GGCAGGATGCTGGTGGATGCAGG + Intergenic
1051116225 9:13697631-13697653 GGCAGGATGCTGGTGGGGATGGG + Intergenic
1051852680 9:21527892-21527914 GGCAGGGTGCTGGTGGGTACAGG + Intergenic
1051891271 9:21945123-21945145 GCCAGGATACCAGTGGTGAGGGG - Intronic
1054915787 9:70494181-70494203 GCCCTGATCCTGGTGGGGACAGG + Intergenic
1055800849 9:80033905-80033927 GCCAGCATGCTTCTGGTGAGAGG + Intergenic
1056814660 9:89792449-89792471 GCCAGGAGGCTGGAGGAGAAGGG - Intergenic
1057025864 9:91733496-91733518 GCCAGGCTGGGGGTGGGGACTGG - Intronic
1060478277 9:124000818-124000840 GCCAGGATTATGGGGGTGAAGGG - Intergenic
1061766939 9:132887495-132887517 TCCAGGAGGTTGTTGGTGACTGG - Exonic
1061869959 9:133515291-133515313 GCCATGGTGCTGGTGGTGCTGGG + Intronic
1062121753 9:134837592-134837614 CCCAGGATGCAGGTGGAGCCAGG - Intronic
1062177981 9:135174907-135174929 GACAGGCTGCTGGGGGTGGCCGG - Intergenic
1062194625 9:135266044-135266066 GCCAGGAGGCTGCTGGTGAGGGG + Intergenic
1062629126 9:137455768-137455790 GCCAGCATCCTGCTGGTGGCTGG - Intronic
1062731425 9:138112371-138112393 ACCAGGATGATGGTGGGGAAGGG - Intronic
1185432725 X:18940-18962 GCCTGAATGATGGTGGTGAGCGG - Intergenic
1185440790 X:226644-226666 GCCTGAATGATGGTGGTGAGCGG - Intergenic
1185442076 X:231762-231784 GCCTGAATGATGGTGGTGAGCGG - Intergenic
1186858184 X:13645932-13645954 TCCAGGCTGCTGGAGGTGAATGG + Intergenic
1187143550 X:16617172-16617194 GTCAGGATGTTGATGGAGACAGG - Exonic
1187255420 X:17637393-17637415 GCGGGGGTGGTGGTGGTGACAGG + Intronic
1189373766 X:40450263-40450285 GCCAGGATGTTTGTGGTATCAGG + Intergenic
1190060100 X:47205297-47205319 GCCAGCATCCTGGTGGTGGTTGG + Intronic
1192177910 X:68897436-68897458 TCCAGGGTGCTGGTGGGGATGGG - Intergenic
1195244572 X:102983799-102983821 GCCTGGTTGCTGGTCGTGTCTGG + Intergenic
1197374397 X:125664142-125664164 GGCAGGATGCTGGTGGAGCTGGG - Intergenic
1197790464 X:130249021-130249043 GGCAGGGTGCTGGTGGGCACAGG - Intronic
1198226193 X:134648054-134648076 GGCAGGGTGCTGGGGGTGAGGGG - Intronic
1199737386 X:150696548-150696570 GCCAGGATGCTTCTGGTTGCAGG + Intronic
1200401443 X:156022553-156022575 GCCAGGAGCCAGGGGGTGACTGG + Intergenic