ID: 1175812518

View in Genome Browser
Species Human (GRCh38)
Location 20:61866129-61866151
Sequence GATTTTGCCCAGAGGACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175812504_1175812518 21 Left 1175812504 20:61866085-61866107 CCCTCAGTTGTTCTGTAGTGGCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812514_1175812518 -9 Left 1175812514 20:61866115-61866137 CCCCTGGCATGGGGGATTTTGCC 0: 1
1: 0
2: 2
3: 13
4: 134
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812512_1175812518 -5 Left 1175812512 20:61866111-61866133 CCACCCCCTGGCATGGGGGATTT 0: 2
1: 0
2: 0
3: 15
4: 207
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812502_1175812518 30 Left 1175812502 20:61866076-61866098 CCTGGAGGACCCTCAGTTGTTCT 0: 1
1: 0
2: 0
3: 25
4: 137
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812515_1175812518 -10 Left 1175812515 20:61866116-61866138 CCCTGGCATGGGGGATTTTGCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812505_1175812518 20 Left 1175812505 20:61866086-61866108 CCTCAGTTGTTCTGTAGTGGCCA 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812509_1175812518 0 Left 1175812509 20:61866106-61866128 CCACACCACCCCCTGGCATGGGG 0: 1
1: 0
2: 0
3: 39
4: 372
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155
1175812513_1175812518 -8 Left 1175812513 20:61866114-61866136 CCCCCTGGCATGGGGGATTTTGC 0: 1
1: 1
2: 1
3: 11
4: 132
Right 1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175812518 Original CRISPR GATTTTGCCCAGAGGACCCT CGG Intronic
901143360 1:7050015-7050037 GTCTTTGCCCAGATGTCCCTGGG - Intronic
901650996 1:10743216-10743238 GATTTCGCCCAGAATCCCCTGGG - Intronic
901873223 1:12150757-12150779 AACTTGGCCCAGAGGACCCAGGG - Intergenic
907304908 1:53508013-53508035 GATTGTGCCCACAGGCCCGTGGG - Intronic
911764099 1:101653680-101653702 GTTTGTGGCCAGAGGACCCATGG + Intergenic
916395585 1:164383334-164383356 AATTTTGCCCAGATCACTCTGGG - Intergenic
917637091 1:176947850-176947872 TACTTTGCACAGAGAACCCTGGG - Intronic
920201201 1:204260871-204260893 GTTTTTGAGCAGAGGAACCTCGG + Intronic
1066166658 10:32795870-32795892 GTTTGTGCCCAGAGGACCTGTGG + Intronic
1066586680 10:36943884-36943906 GCTTTTTCCTCGAGGACCCTAGG + Intergenic
1066984597 10:42454086-42454108 GATGCCTCCCAGAGGACCCTGGG + Intergenic
1069662392 10:70132347-70132369 GCTTCTACCCAGCGGACCCTCGG + Intronic
1069932760 10:71893773-71893795 GAGTTTGCCCAGACCAGCCTAGG + Intergenic
1070933307 10:80275586-80275608 GGTGTTGCCCAGAGGACACTTGG - Intronic
1074722330 10:116273455-116273477 TCTTCTGGCCAGAGGACCCTCGG + Exonic
1074788800 10:116865634-116865656 GATTTTGCCCAGGGGACATTTGG + Intronic
1075735779 10:124663877-124663899 GATTTGGCCCAGAGCCTCCTGGG - Intronic
1077091350 11:779750-779772 GATCTTGCCCACAGGAGACTCGG - Intronic
1077394194 11:2313133-2313155 GCTTTTGACCAGAGAAGCCTTGG - Intronic
1078529053 11:12122308-12122330 GAATTGGCCCACAGGAGCCTTGG + Intronic
1079105461 11:17569346-17569368 GCTTTTAGCCAGAGGATCCTGGG - Intronic
1083261640 11:61526259-61526281 GACCTTGCCCAGGGGACCCTTGG + Intronic
1083349003 11:62013783-62013805 GAATCTGCCCACAGGGCCCTGGG + Intergenic
1086431771 11:86743146-86743168 GAGTTTACCCAGAGGACTGTGGG + Intergenic
1088227030 11:107632286-107632308 AATTTTGCACTGAGGACACTGGG + Intronic
1088742886 11:112781197-112781219 GAGTTTGGCCAGAGGAGCCTGGG - Intergenic
1088981571 11:114868805-114868827 AATTTTGCCCAGAGTACTCAAGG - Intergenic
1089850171 11:121488856-121488878 GTTTTTGCTCAGAGAAACCTTGG + Intronic
1091685173 12:2556344-2556366 GCTTCTGCCCAGAGGTCCCCAGG + Intronic
1094847307 12:34366940-34366962 CATGTGGCCCAGGGGACCCTGGG - Intergenic
1094847570 12:34368051-34368073 CATGTGGCCCAGGGGACCCTGGG - Intergenic
1094849834 12:34377418-34377440 CGTGTTGCCCAGGGGACCCTGGG - Intergenic
1095259630 12:40083297-40083319 GATTTGGAAAAGAGGACCCTAGG - Intronic
1095537328 12:43266590-43266612 GATTTTGCTTATATGACCCTTGG + Intergenic
1097710182 12:62909337-62909359 GATTTTGCGCAGAGGAACATGGG - Intronic
1102012909 12:109629719-109629741 GGATTTGCCCAGAGGGTCCTGGG + Intergenic
1104353180 12:128062372-128062394 GATTTTCGACAGAGGACCCTGGG - Intergenic
1104864581 12:131945293-131945315 GATTTTGGCCAGAGGAGCAGTGG + Exonic
1106550442 13:30766344-30766366 TAATATGCCCAGTGGACCCTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108356368 13:49631909-49631931 GATTTTCCCCAGTGGCCCCTGGG + Exonic
1110119783 13:71866610-71866632 GAGTTGGCCCAGAGGACGCCGGG + Exonic
1114492381 14:23111413-23111435 GATTTTGTCCAGTGGTCCTTAGG - Intergenic
1117272871 14:54163076-54163098 CATTTTCTCCAGAGAACCCTGGG + Intergenic
1119644176 14:76336635-76336657 GCTTTTGCCCTGGGGATCCTGGG - Intronic
1123143468 14:106105747-106105769 GGTTCTTCACAGAGGACCCTGGG - Intergenic
1124648308 15:31456304-31456326 GATTTTTCCCAGAGAACCTGAGG - Intergenic
1124792368 15:32740583-32740605 GATGTTGCCCATAAGACCCTTGG - Exonic
1127188082 15:56500883-56500905 GCTTTTGCACAGAGGACCTGTGG - Intergenic
1130892570 15:88145524-88145546 GATTTCTCCCAGAGGATCATGGG - Intronic
1131498276 15:92934330-92934352 GATTTAGCCAAGAGGCCCCAAGG - Intronic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1132587280 16:711038-711060 TGTCTTGCCCAGAGGGCCCTTGG - Intronic
1134197471 16:12170145-12170167 GATGTTGCCCAGTGTCCCCTGGG + Intronic
1136733364 16:32440598-32440620 GTGTTTTACCAGAGGACCCTTGG - Intergenic
1138616411 16:58171037-58171059 GATTTTGCCCAATGTCCCCTGGG + Intronic
1139065033 16:63302166-63302188 TATTTTCCCCACAGCACCCTCGG + Intergenic
1139630245 16:68227207-68227229 GCTTTTTCCCTCAGGACCCTGGG + Exonic
1141597566 16:85106683-85106705 GATTTGGCCCAGTGGGCCCACGG + Intronic
1142290552 16:89192065-89192087 CATTGTGCCCAGAGGACGGTGGG + Intronic
1203019719 16_KI270728v1_random:389004-389026 GTGTTTTACCAGAGGACCCTTGG + Intergenic
1203038054 16_KI270728v1_random:662162-662184 GTGTTTTACCAGAGGACCCTTGG + Intergenic
1142905173 17:3036529-3036551 GATTTTTCAGTGAGGACCCTTGG + Exonic
1145814762 17:27787754-27787776 AAGTTTGACCAGAGGACCCAGGG - Exonic
1156402775 18:36755896-36755918 GAGTTTCCCCATAGCACCCTGGG + Intronic
1160062901 18:75548863-75548885 GGATTAGCCCAGAGGATCCTCGG - Intergenic
1161316064 19:3618214-3618236 GACGTTGCCCAGAGTCCCCTGGG - Intronic
1162400735 19:10445087-10445109 GATTTTGCCCAGAGTAAGGTGGG + Intronic
1163311474 19:16517519-16517541 GATTTGGCTCAGAGGAGTCTGGG - Intronic
1164803522 19:31097886-31097908 GCTTTGGCCCAGAGGAGCATTGG + Intergenic
1164906679 19:31973818-31973840 CATCTTGCCCAGAGGACAGTGGG + Intergenic
1164947606 19:32309707-32309729 GATTTTGCAGAGAAGGCCCTCGG - Intergenic
1165758125 19:38305708-38305730 GATTTTGCCCACAGGGCCCGGGG - Intronic
1167009267 19:46796210-46796232 GCTTTTCCCCTGAGGACCCAGGG + Intergenic
1167076485 19:47252904-47252926 GAGGCTGCCCAGAGCACCCTGGG - Intergenic
926107208 2:10159971-10159993 GACTTTCCCCCGAGGGCCCTGGG - Intronic
926511009 2:13778129-13778151 AATTTTGTCCAAATGACCCTAGG + Intergenic
926588162 2:14711772-14711794 CCTTTGGCCCACAGGACCCTTGG - Intergenic
927518063 2:23683370-23683392 GGCTTTGCCCAGGGGATCCTGGG + Intronic
931704382 2:64935210-64935232 GATTTAACCTAGAGGAGCCTCGG + Intergenic
931716696 2:65034554-65034576 GATGAGGCCCAGAGGAACCTAGG + Intergenic
933841115 2:86286273-86286295 GACATTGCCCAGATTACCCTGGG - Intronic
936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG + Intergenic
936903777 2:117513590-117513612 TATTTTGCCCAGAGGATTCTGGG + Intergenic
937804121 2:126117657-126117679 AATGTTGACCAGAGGACACTGGG + Intergenic
940992348 2:160110685-160110707 CAATTTGCTTAGAGGACCCTGGG + Intronic
944444560 2:199776233-199776255 GATATTGCCCAAAGAACCTTAGG + Intronic
947305379 2:228740602-228740624 GTTTGTGCCCAGAGGACCTGTGG + Intergenic
947328381 2:229002327-229002349 GACTATGCCCAGAAGAGCCTTGG - Intronic
948245532 2:236481062-236481084 GTTTTTGCCCAGGGGACCTGTGG + Intronic
1172125314 20:32622136-32622158 GAGTTTGCCCCGGGGACACTGGG + Intergenic
1172414965 20:34757734-34757756 CATTGTGCCCAGAGAACCCTGGG + Exonic
1172768534 20:37363722-37363744 GGTTTTGCCAAGAGGAGCCCAGG + Intronic
1173189167 20:40863120-40863142 GATTTTGTCCTGAGGACAATGGG + Intergenic
1175725820 20:61317701-61317723 GATGTTGCCCAGTGTCCCCTGGG + Intronic
1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG + Intronic
1175933863 20:62506186-62506208 GAGTCTCCCCACAGGACCCTGGG - Intergenic
1176411484 21:6451621-6451643 TGTTTTGCCCAGAGGCCCCTCGG - Intergenic
1179686977 21:43059943-43059965 TGTTTTGCCCAGAGGCCCCTCGG - Intronic
1180875949 22:19175339-19175361 GATCTTGCCCAGAGGCCACAGGG + Intergenic
1181036111 22:20170431-20170453 GATGTTGCACCGGGGACCCTGGG + Intergenic
1184858841 22:47161845-47161867 GCTGTTGCCCAGATGTCCCTGGG + Intronic
949771797 3:7587385-7587407 TATTTTGCTAAGAGGAACCTAGG - Intronic
953913412 3:46904093-46904115 GAGTTGGCCCAGAGGAGCCTGGG - Intergenic
954190394 3:48955942-48955964 GCTTTTGCTCAGAGGACTCTGGG + Intronic
954195033 3:48991255-48991277 GATTTTCCCCAGAGGTCCTGAGG - Intronic
954609516 3:51936976-51936998 GACTTTGCCCAAAGGTCTCTAGG + Intronic
954956676 3:54527358-54527380 GATTGTGCCCAGGGGAGGCTGGG - Intronic
954990105 3:54833347-54833369 GATTTTGCCCAGATGGACCATGG + Intronic
956273349 3:67471207-67471229 GCATTTGGCCAGAGAACCCTGGG + Intronic
956767991 3:72500604-72500626 GATTGTGCCCAAATGGCCCTGGG - Intergenic
961332865 3:126153341-126153363 CATTTTCTCCAGAGGAGCCTAGG + Intronic
961380187 3:126492002-126492024 GATTATCCCCAGAGGGGCCTTGG + Intronic
961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG + Intronic
962477312 3:135766462-135766484 GATCTTGTCCAGAGCACTCTAGG - Intergenic
963109753 3:141678147-141678169 TTTTTTTCCCAAAGGACCCTAGG - Intergenic
963824474 3:149937038-149937060 GTTTGTGCGCAGAGGACCCGTGG + Intronic
964155439 3:153579740-153579762 CATTCTGCCCATAGGCCCCTAGG + Intergenic
964926930 3:161970559-161970581 GATTTGGTCCAGAACACCCTGGG + Intergenic
965452581 3:168857131-168857153 TTTTATGCCCAGGGGACCCTTGG + Intergenic
966632959 3:182098807-182098829 GATTTTGCTCAGAGAAGCCCTGG + Intergenic
968068116 3:195770217-195770239 TATCCTGCCCAGTGGACCCTCGG - Exonic
969184951 4:5468118-5468140 GATTCTGCCAGGAGGACCTTGGG - Intronic
981730569 4:147892784-147892806 GATATTGCCCAGTGTCCCCTAGG - Intronic
983658986 4:170113054-170113076 CATTTTTCCCAGGGGATCCTGGG - Intergenic
990084563 5:51958183-51958205 GCTTTTGCCGACAGGACTCTAGG + Intergenic
991396474 5:66209525-66209547 GATTTTGCCCTGAGGGCACTGGG - Intergenic
995606365 5:113860048-113860070 GTTTGTGCCCAGCGGACCCGTGG + Intergenic
997530195 5:134577190-134577212 GGATTTTCCCAGAGGCCCCTGGG + Intronic
998185450 5:139975613-139975635 GATATTCCCCAGATGGCCCTAGG - Intronic
1002476255 5:179468130-179468152 GATAGTGTCCAGAGGACCCCGGG - Intergenic
1002862742 6:1094690-1094712 GGTTTTGCTCATAGGTCCCTGGG - Intergenic
1006896528 6:37474930-37474952 GTTTTTGACCAGAGATCCCTTGG + Intronic
1009473312 6:64055976-64055998 TATGCTGCCCAGAGGCCCCTCGG + Intronic
1009768237 6:68109967-68109989 GATTTTGACGAGAAGAACCTTGG - Intergenic
1018238148 6:161745927-161745949 GAGCTTGCTCAGAGGATCCTGGG + Intronic
1018705420 6:166460537-166460559 GAATCTGCCCGGAGGTCCCTCGG - Intronic
1021544157 7:21794589-21794611 GTTTGTGCCCAGAAGACCCATGG + Intronic
1022821193 7:33962582-33962604 AATGTTGCCCAGAGTCCCCTGGG + Intronic
1022922838 7:35033842-35033864 GATTTTGGCCATTGTACCCTGGG - Intronic
1029806640 7:103004397-103004419 GTTTGTGCCCAGAGGACCCATGG + Intronic
1032093421 7:128923488-128923510 GCTGTTGTCCAGAGGACCCTTGG - Intergenic
1035116526 7:156529208-156529230 CATTTTGCCCATTGCACCCTGGG - Intergenic
1037620805 8:20561920-20561942 GCTTTAGCCCAGAGGACCCTGGG - Intergenic
1037760497 8:21738557-21738579 GATTTTCCCCAGAAGACGGTGGG - Intronic
1039181480 8:34871676-34871698 GATCTTGCCAAACGGACCCTAGG - Intergenic
1040399425 8:47033635-47033657 GGTTTTGCCCAGGTGACCCTAGG - Intergenic
1040587594 8:48757866-48757888 GGCTTTTCCCAGAGGAACCTTGG + Intergenic
1041143559 8:54847368-54847390 TTTTTTGCCCTGAGGGCCCTGGG - Intergenic
1044491062 8:92815541-92815563 GATTTTGTCCTGATGTCCCTGGG + Intergenic
1044745497 8:95366876-95366898 GCTTCTGCCCAGGGGCCCCTTGG + Intergenic
1045357654 8:101403744-101403766 GATGTTGGCAAGAGTACCCTTGG - Intergenic
1047205184 8:122797448-122797470 GTTTCTGCACAGAGAACCCTGGG + Intronic
1047618640 8:126584268-126584290 GGATGTCCCCAGAGGACCCTGGG - Intergenic
1049373325 8:142277966-142277988 GCCTCTGCCCATAGGACCCTTGG + Intronic
1049469031 8:142767147-142767169 GATTCCGCCCACAGGACCCAGGG - Intronic
1050050781 9:1599257-1599279 GATTTTGTCCTGAGCTCCCTTGG + Intergenic
1051134143 9:13899155-13899177 GCTTTTCCCCAGAGGACAGTTGG - Intergenic
1051474626 9:17491801-17491823 TATTTTGCAGAGAGGACACTGGG - Intronic
1055557336 9:77488559-77488581 GTTTGTGCCCAGAGGACCTGTGG - Intronic
1057518774 9:95743888-95743910 GCTTTTGCCCAGAGGGTGCTAGG - Intergenic
1057568537 9:96185837-96185859 GATTTTGCCAAGTGTCCCCTGGG + Intergenic
1059285153 9:113166005-113166027 GATTTTGCACAGCCAACCCTGGG - Exonic
1060738814 9:126084112-126084134 GATTATCCCCAGAAGACACTGGG + Intergenic
1061221464 9:129254386-129254408 GGTCTTGCCCAGGGGACCATGGG + Intergenic
1061841301 9:133359887-133359909 GCTGTGGCCCAGAGGACCGTGGG + Intronic
1062287099 9:135778147-135778169 CTTTTTGCCCAGGGGACCCTAGG + Intronic
1062372391 9:136246816-136246838 GATTCTCCCCAGAGGGCCCCTGG + Intergenic
1062485899 9:136775494-136775516 GATTTTACCCAGAGGAGGCATGG - Intergenic
1185802365 X:3024559-3024581 GATATTGCCCAGTGTCCCCTGGG + Intronic
1187220497 X:17321088-17321110 GAGTTTTCCCAAAGGACCCTGGG + Intergenic
1195038581 X:100992810-100992832 AATTTTTCCCTGGGGACCCTGGG + Intergenic
1195073563 X:101304604-101304626 GTTAGTGGCCAGAGGACCCTTGG + Intergenic
1196015772 X:110938689-110938711 GTTGTTGCCCATAGTACCCTTGG - Intergenic
1197336041 X:125210540-125210562 GATTTTGCCCTAAGGACCACAGG + Intergenic
1197551097 X:127893783-127893805 GTTTGTGCCCAGAGGACCTGTGG + Intergenic
1199582673 X:149376073-149376095 TATGTTGCCAAGAGGCCCCTGGG - Intergenic
1200076080 X:153551899-153551921 GACCTTGCCCTGAGGGCCCTGGG - Intronic