ID: 1175813334

View in Genome Browser
Species Human (GRCh38)
Location 20:61870512-61870534
Sequence AGGGACATGCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175813334_1175813343 13 Left 1175813334 20:61870512-61870534 CCCTCCACCTTCTGCATGTCCCT 0: 1
1: 0
2: 1
3: 62
4: 527
Right 1175813343 20:61870548-61870570 CACCCCCACCATCAAGCTACTGG 0: 1
1: 0
2: 1
3: 18
4: 154
1175813334_1175813344 14 Left 1175813334 20:61870512-61870534 CCCTCCACCTTCTGCATGTCCCT 0: 1
1: 0
2: 1
3: 62
4: 527
Right 1175813344 20:61870549-61870571 ACCCCCACCATCAAGCTACTGGG 0: 1
1: 0
2: 0
3: 3
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175813334 Original CRISPR AGGGACATGCAGAAGGTGGA GGG (reversed) Intronic
900585576 1:3430873-3430895 GCGGACATGCAGATCGTGGACGG + Exonic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
902701185 1:18173506-18173528 AGGGACAGGAAGCAGGTGGGTGG - Intronic
903217009 1:21848858-21848880 GGGGTCATGCAAATGGTGGAGGG - Intronic
905453767 1:38073785-38073807 AGGCACCGGCAGAAGTTGGAGGG - Intergenic
905934145 1:41810476-41810498 AGGGACTAGGAGATGGTGGATGG - Intronic
906321743 1:44821543-44821565 AAAGCCATGCAGCAGGTGGAAGG - Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908023230 1:59920283-59920305 GGGGAAATGCAGAAGGTGTTTGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908395263 1:63719688-63719710 AGGGACCAGTAGAAGGTGGTAGG - Intergenic
908611716 1:65868597-65868619 AGGCAGATTCAGCAGGTGGATGG + Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912128056 1:106564973-106564995 ATGAACATGAAGAAGGTAGAAGG + Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912459805 1:109823031-109823053 AAGGACATGCAGAATGTGGTGGG + Intergenic
912670591 1:111620362-111620384 GGGGACATGCAAGAGGAGGAAGG - Intronic
913049369 1:115103423-115103445 AGGTACATATAAAAGGTGGATGG - Intergenic
913345900 1:117810919-117810941 AGAGACATGAAGAAGATTGAGGG - Intergenic
914325505 1:146611540-146611562 AGGCACCAGCAGATGGTGGAAGG + Intergenic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
916562129 1:165942054-165942076 AGGAAAATGCAGACGGAGGAAGG - Intergenic
917715052 1:177726562-177726584 GGGGTCTTTCAGAAGGTGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919833844 1:201560392-201560414 AGGGATATGCTGATGGTGGAGGG - Intergenic
920107183 1:203562259-203562281 TGGGAAATGCAGAAGGGTGAGGG - Intergenic
921006737 1:211101055-211101077 AGTGCCATGCAGAAACTGGAAGG - Intronic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
921520595 1:216150831-216150853 AGGAACATCGAGAAGGTGAAAGG - Intronic
921588452 1:216975985-216976007 ATGGACATTTAGAAGGTGGTTGG - Intronic
921817263 1:219577912-219577934 AGGGATATGCACAGGGTGGGTGG - Intergenic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
922751754 1:228073392-228073414 AGGAACATGCAGAGGGTGGGTGG - Intergenic
922794874 1:228335055-228335077 AGGGGCAGGCAGGAGGTGGTGGG - Intronic
923380432 1:233411917-233411939 AGGGAACTGCAGAAGCAGGAAGG + Intergenic
924024260 1:239816487-239816509 AGGCACAGGCAGAAGAGGGAGGG + Intronic
924334833 1:242977105-242977127 AGGGACAGGGAGAAAATGGAAGG + Intergenic
1062931174 10:1353698-1353720 AGGAACATCGAGAAGGTGAAAGG - Intronic
1063179412 10:3584330-3584352 AGGGACAGGCAGGAGGTGGCAGG - Intergenic
1063434784 10:6021037-6021059 AGGAACATGCTGACCGTGGAGGG + Intronic
1063915821 10:10880990-10881012 TGTGACATGAAGAAGGTGGGTGG - Intergenic
1065130347 10:22613630-22613652 AGGGGACTGCAGAATGTGGATGG + Intronic
1065338354 10:24678420-24678442 GGGGACATGTAGGAGGTGGAGGG - Intronic
1066331300 10:34426383-34426405 AAGCACATGCAAAAAGTGGATGG - Intronic
1066446627 10:35490000-35490022 AGGGACATGCAGAATGCGGTGGG - Intronic
1067065880 10:43103923-43103945 GGGGGCATGCTGAAGGCGGAAGG - Intronic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1069536674 10:69258811-69258833 AGGAACATCGAGATGGTGGAGGG + Exonic
1069762974 10:70827796-70827818 AGGGACATTAAGAAGCTGGCTGG - Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1071020166 10:81044623-81044645 AGGGACTACCAGAAGGTGGAGGG - Intergenic
1071191108 10:83102049-83102071 AGGGACCTGCAGGAGGTGATTGG + Intergenic
1071836037 10:89417879-89417901 ATGTACATGCAGAAGCTGAAGGG + Exonic
1073709108 10:106018558-106018580 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1073876338 10:107926440-107926462 GGGGACTTTCAGAGGGTGGACGG + Intergenic
1073967468 10:109007819-109007841 AGGGAAATGTGGAAGGTGCAAGG + Intergenic
1074809419 10:117088418-117088440 AGGGAAATGGAGAAGTTAGAAGG - Intronic
1074875556 10:117610535-117610557 AGGGACTTGCGGGAGGGGGAGGG + Intergenic
1075192408 10:120321846-120321868 GGGGCCATGAGGAAGGTGGAGGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075311472 10:121417484-121417506 AGAGACAAGCAAAAGCTGGAAGG + Intergenic
1075821275 10:125314252-125314274 AGAAAAATTCAGAAGGTGGATGG + Intergenic
1076463139 10:130660076-130660098 AGGGGCATTCAGAAGGAGGTTGG + Intergenic
1076485910 10:130816844-130816866 TGGGAACTGCAGCAGGTGGAGGG - Intergenic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077183800 11:1227701-1227723 GGGAACCTGCAGAAGTTGGATGG + Exonic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077343884 11:2037623-2037645 AGGGACATTGAGGAGGTGGGAGG + Intergenic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1078060395 11:8039354-8039376 GGAGACAGGCAGAAGCTGGAAGG - Intronic
1078127696 11:8584635-8584657 AGGGCCAGGCATAAGGAGGAAGG - Intronic
1078640407 11:13090251-13090273 AGGGACAGGAAGAAGGTAGCTGG - Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1081647002 11:44797069-44797091 AGGAACATCCAGAATATGGAAGG - Intronic
1083534793 11:63457694-63457716 AGGAACATCAAGAAGGTGAAAGG - Intergenic
1083745409 11:64733448-64733470 TGGGGCCTGCAGGAGGTGGAGGG + Intronic
1084765520 11:71305726-71305748 AGGCAAATTCAGCAGGTGGAAGG + Intergenic
1084892199 11:72242101-72242123 TGGGACATGGAGAAGGTGCCTGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085088673 11:73691080-73691102 AGGGACACACAGAAAGGGGATGG + Intronic
1085159998 11:74331826-74331848 AGGGGCATGATGAAGGGGGAAGG - Exonic
1085461391 11:76696001-76696023 AGGGCCATGCAGGAAGTGGTGGG + Intergenic
1085518304 11:77123901-77123923 GGGGACATGCAGATGGTGGTGGG - Exonic
1086005400 11:82030001-82030023 ATGGACATTGAGAAGGTGAAAGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088265829 11:107986739-107986761 GGGGCCTTTCAGAAGGTGGAGGG + Intergenic
1088883065 11:113986777-113986799 AGACACATGCAGGAGGTGGGAGG - Exonic
1089680992 11:120118832-120118854 AGGCACATGCAGACGTTGGGAGG - Intronic
1090397576 11:126429374-126429396 GGGGAAATGCAGAGGGTGGCAGG - Intronic
1090790489 11:130089318-130089340 AGGGTCATGCACACGCTGGAAGG + Intronic
1202826870 11_KI270721v1_random:92812-92834 AGGGACATTGAGGAGGTGGGAGG + Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1091688668 12:2581315-2581337 AGGCACATGCAGCAGGTAGCCGG + Intronic
1092105170 12:5916308-5916330 ATGTACATGCAGAACGTGAATGG + Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1092580483 12:9835703-9835725 AGGAACATGGAGAAGGTGAAGGG + Intronic
1093265147 12:16994558-16994580 GGGGCCTTTCAGAAGGTGGAGGG + Intergenic
1093951466 12:25167924-25167946 AGGAACATCGAGAAGGTGAAAGG - Intronic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1094110214 12:26854201-26854223 AGGAACATTCAGAAGGGGAAGGG - Intergenic
1094450425 12:30577963-30577985 AGGGAAATGCAGAGTGTAGAGGG + Intergenic
1094490216 12:30956153-30956175 TGGGACATGTGGATGGTGGATGG + Intronic
1094723550 12:33089639-33089661 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1094848486 12:34371931-34371953 GGGGACAAGCTGAAGGTGGCAGG - Intergenic
1095506030 12:42899280-42899302 TGGGACCTGCAGAAAGTTGATGG - Intergenic
1095598990 12:43993542-43993564 AGAGACTTGGAGAAGATGGAGGG + Intronic
1095806135 12:46323035-46323057 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1095999244 12:48115017-48115039 AGAGTCATGGAGAAGGGGGATGG + Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096700474 12:53380069-53380091 AGGGACTTGCAGAAGAAAGACGG - Intergenic
1097176642 12:57147224-57147246 AGGGACGTGGAGCAGGGGGAGGG - Intronic
1097235477 12:57536437-57536459 AGGGACAGGGAGAAGGGGCAAGG + Intronic
1097398434 12:59103054-59103076 AGAGACATGGAGAAGGGGTAGGG - Intergenic
1099593256 12:84623225-84623247 AGGGCCTTTCAGAAGGCGGAGGG - Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101483725 12:105129731-105129753 AGGGACATTCAGAATGAAGAGGG + Intronic
1102777760 12:115535417-115535439 AGGGTCTTGCAGAATGGGGATGG - Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103613702 12:122139221-122139243 AGCCACTTGCAGAAGGTGCAGGG + Intronic
1103620602 12:122184907-122184929 AGGGAGATGAAGCAGATGGAGGG - Intronic
1103666320 12:122569012-122569034 GGGGCCTTTCAGAAGGTGGAGGG + Intronic
1104437293 12:128766176-128766198 AGGGACATGCAGCTGGTAGCAGG - Intergenic
1104521518 12:129480200-129480222 AGGGAGAGGAAGAAGGTGCATGG + Intronic
1105032633 12:132894731-132894753 AGGAACATCGAGAAGGTGAAAGG - Intronic
1107244962 13:38282538-38282560 GGGGCCTTTCAGAAGGTGGAGGG + Intergenic
1108084352 13:46769673-46769695 AGGGACAGGCACAAGCAGGACGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108372627 13:49785831-49785853 AGGGAAATGCACAGGATGGATGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108804031 13:54132210-54132232 AGGGACACGGAGAAGGGGGGTGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1110402429 13:75108919-75108941 GGGGACTTTCAGAGGGTGGAGGG + Intergenic
1112111910 13:96310632-96310654 AGGGACATAGAGAAGGAGGGAGG - Intronic
1112240430 13:97676289-97676311 AGTGCCAGGTAGAAGGTGGATGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113356191 13:109582694-109582716 AAGGAGATGCAGAAGGTGTTTGG + Intergenic
1113484043 13:110641781-110641803 AGGCACCTGCAGGAGGTGGCGGG + Intronic
1115426917 14:33270930-33270952 AGGAACATTCAGAGGGTGAAGGG - Intronic
1115452950 14:33569663-33569685 AGGAACATGCAGATAGAGGATGG + Intronic
1115764906 14:36613697-36613719 AGGCACATACAGAAGGTTGGAGG + Intergenic
1116194205 14:41701668-41701690 AGGGAAATGCAGAATGTGATAGG + Intronic
1116780025 14:49226883-49226905 AGGGACAGTAAGAAGGTGGTAGG - Intergenic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1118129341 14:62945162-62945184 AGGTAGATTCAGAAGGTAGATGG + Intronic
1118513228 14:66499277-66499299 AGGTCCATGCACAAAGTGGAAGG + Intergenic
1118806806 14:69245046-69245068 TGGGACAGGCAGAAGGTGCTGGG - Intergenic
1119857464 14:77911279-77911301 AGGGAAATGGAGAAGGTAGAGGG - Intronic
1120618102 14:86732524-86732546 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1121835557 14:97088941-97088963 AGGCAGAGGCACAAGGTGGAAGG + Intergenic
1122679436 14:103446594-103446616 AGGGGTATGCAGAAGTTGGCAGG + Intronic
1122721272 14:103723914-103723936 AGGGACACGCTGAGGGTGGCGGG + Intronic
1122783128 14:104152142-104152164 AGGGGCCTGCAGCAGGTGCATGG - Exonic
1123773031 15:23548288-23548310 AGGGACAAGCAGGAGGCAGAGGG - Intergenic
1124791453 15:32731075-32731097 AGGCACATCCGGAAGGAGGAAGG + Exonic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1125799699 15:42434534-42434556 AGGAACATAAAGAAGGGGGAGGG - Intronic
1126054443 15:44716518-44716540 AGTGGCATGAAGAAGGTGTATGG + Intronic
1126196478 15:45937272-45937294 GGGGATATGCAGAAGGGTGATGG - Intergenic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1126940858 15:53763514-53763536 AGTGACTTGCAGTAGGAGGAAGG - Intergenic
1127804417 15:62505749-62505771 TGGTACATGAGGAAGGTGGAAGG + Intronic
1128308479 15:66615546-66615568 ATGGACAGGCAGATGATGGAAGG + Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128600707 15:68993198-68993220 ATGGCCATGCAGAAAGTGCATGG - Intronic
1128904042 15:71451733-71451755 AGGGACCTGGAGAAGGAGGGAGG - Intronic
1129032037 15:72626231-72626253 AGGAACATGCACAACTTGGACGG - Intergenic
1129277856 15:74459165-74459187 AGGGGCATACAGAAGGGAGAGGG - Intronic
1129406807 15:75324970-75324992 AGGAACATGCACAACTTGGATGG - Intergenic
1129735007 15:77955297-77955319 AGGAACATGCACAACTTGGATGG + Intergenic
1130054555 15:80511364-80511386 GGGGACTTTCAGAGGGTGGAGGG + Intronic
1130129082 15:81121868-81121890 GGGGCCTTTCAGAAGGTGGAAGG - Intronic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1131465893 15:92654840-92654862 AGGGAGCTGCAGATGGTAGAAGG + Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132867876 16:2102817-2102839 GGGGAAATGAAGAAGGTGTAGGG + Exonic
1133900131 16:9966271-9966293 GGGGCCTTGCAGAGGGTGGAGGG - Intronic
1134523897 16:14930297-14930319 GGGGAAATGAAGAAGGTGTAGGG - Intronic
1134549007 16:15130638-15130660 GGGGAAATGAAGAAGGTGTAGGG + Intronic
1134711488 16:16328782-16328804 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134719339 16:16372081-16372103 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134948087 16:18339804-18339826 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1134955341 16:18379911-18379933 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1136028660 16:27486633-27486655 AGGGCCATGGAGAGGGTGGAAGG + Intronic
1136360959 16:29779478-29779500 AGGGGCAAGCAGGAGTTGGAGGG - Intronic
1136541216 16:30928485-30928507 AGGCACCTGAAGAAGGTGGGTGG + Exonic
1137071097 16:35905494-35905516 AGGAAAATGCAGCAGCTGGAGGG + Intergenic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138173539 16:54875491-54875513 AGAGCCATGCAGGAGATGGAAGG - Intergenic
1138346346 16:56322572-56322594 AGGGAGATGCATAAGATAGAAGG - Intronic
1138622690 16:58224458-58224480 AAGGTCATGCAGAAAGTGGCTGG + Intergenic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1139878379 16:70164424-70164446 AGGGACTTACAGAAGGAGCAGGG - Intergenic
1140008057 16:71099407-71099429 AGGCACCAGCAGATGGTGGAAGG - Intronic
1141669286 16:85483372-85483394 AGGGACTTGCCCAAGGTTGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142066503 16:88065918-88065940 AGGGACAGGAAGGAGGTGGAAGG - Intronic
1142143758 16:88484076-88484098 AGGGAAAGGCAGAAGATGGGAGG - Intronic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142280739 16:89146366-89146388 AGGCCCATGCAGGAGGTGCATGG + Intronic
1143218124 17:5240248-5240270 AGGAACAATCACAAGGTGGATGG - Intergenic
1143218272 17:5240952-5240974 AGGAACAATCACAAGGTGGATGG - Intergenic
1143373819 17:6455790-6455812 AGGGACAGGCATCAGGCGGAGGG + Intronic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1146308803 17:31751269-31751291 AGGCACATGCAGCACATGGAGGG - Intergenic
1146401517 17:32503713-32503735 AGTGACATCCAGATGGAGGACGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147549450 17:41429189-41429211 AGGAACAGGCAGTAGGTGGAAGG + Intergenic
1147647574 17:42043059-42043081 AGGGCCAGGCTGAAGGTGGAGGG - Intronic
1147658312 17:42103641-42103663 AGCGACCTGCGGAAGGTGGAGGG - Exonic
1148792806 17:50183194-50183216 AGGAGCAGGCAGAAGGTGAAGGG + Intergenic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1150965643 17:69964929-69964951 AGGCAGATGCAGAAGATGAAAGG - Intergenic
1151350650 17:73530007-73530029 ATGGACATGGGCAAGGTGGAAGG + Intronic
1151352040 17:73537518-73537540 AGAGGCAGGCAGAGGGTGGAAGG + Intronic
1151508892 17:74546356-74546378 AGGGACATGCAGATGGTGTCTGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151816226 17:76472771-76472793 AGGGACCTGGAGAAGCTGGCCGG - Exonic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1153227193 18:2907926-2907948 AGGGACATGCAGACACTGGCAGG + Intronic
1153434757 18:5057604-5057626 AGGGACAGGCGGAAGGTCGGAGG - Intergenic
1154002805 18:10498251-10498273 AGGGACCTGGAGGAAGTGGATGG - Intergenic
1154261935 18:12842633-12842655 AGGGACATGAAGAATGTGGCTGG + Intronic
1154322901 18:13368879-13368901 AGGGCCATGGGGAAGGTGGCAGG + Intronic
1155240084 18:23856629-23856651 AAGGACCTGCAGATGGTTGAGGG + Intronic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155961790 18:32001452-32001474 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1156237778 18:35220746-35220768 AGGAACATTGAGAAGGTGAAAGG - Intergenic
1156566102 18:38192867-38192889 AGGGCCTATCAGAAGGTGGAGGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157274256 18:46298987-46299009 AGGGGCATGAAAAAGGTGGGAGG - Intergenic
1157417240 18:47513947-47513969 AGGGATATGCAGGAGGCCGATGG - Intergenic
1158547594 18:58409413-58409435 AGGGTCAAGTAGAAAGTGGAAGG + Intergenic
1158570672 18:58594819-58594841 ACGGTCCTGCAGAAGGTGGGAGG - Intronic
1160011978 18:75112939-75112961 AGGGCCATGCCCAGGGTGGATGG + Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160800286 19:964489-964511 AGGGGCCTGCAGAAGAGGGAGGG + Intronic
1162125201 19:8495850-8495872 AGGGACATGCAGGGAGTGGAGGG + Intronic
1163090467 19:15016095-15016117 AGGGACAGGCTGAGGGTCGAGGG + Intronic
1163732286 19:18956012-18956034 AGGGAGGTTGAGAAGGTGGATGG + Intergenic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166396998 19:42448746-42448768 AGGAACACGGAGAAGGTGAAAGG + Intergenic
1166696630 19:44855462-44855484 AGGGACTTGGAGGAGGTGAAGGG + Intronic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167758404 19:51427487-51427509 AGGGTCATGCAGAGGGAGGCTGG + Intergenic
1168318686 19:55495695-55495717 AGGGCCAGGCAGGAGGTAGACGG + Intronic
1168670683 19:58238907-58238929 AGGGACAGGCAGAACAGGGAGGG + Intronic
924995986 2:361614-361636 AGGGACACGCAGAAGATAAAGGG + Intergenic
924996020 2:362108-362130 AGGGACACGCAGAAGATAAAGGG + Intergenic
924996055 2:362618-362640 AGGGACATGCAGAAGATAAAGGG + Intergenic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926624588 2:15080640-15080662 AGGGAAATTCAGCTGGTGGATGG + Intergenic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
928184239 2:29095199-29095221 AGGGACATCCTGCAGGTAGAGGG - Intergenic
928778683 2:34794481-34794503 AGGAACATCGAGAAGGTGAAAGG - Intergenic
929279963 2:40066789-40066811 AGGGCCAATCAGAAGGTGAAGGG - Intergenic
929457814 2:42078389-42078411 AGAGACAGGAAGAAGGTGCAGGG + Intergenic
931874720 2:66499399-66499421 AGGATCAGGCAGAAGTTGGAGGG - Intronic
931908561 2:66869428-66869450 AGGGAACTGCAGAAGGAGTAAGG + Intergenic
933698489 2:85237758-85237780 AGGGGCATGAAGAAGGAGGGAGG + Intronic
934123039 2:88858210-88858232 TGGAACAGTCAGAAGGTGGAGGG - Intergenic
934942532 2:98512871-98512893 AGGAACACGGACAAGGTGGAGGG - Intronic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
935638429 2:105268613-105268635 AGGGATATGCTGAAGGAGGTGGG + Intronic
937791275 2:125964933-125964955 AGGGAAATGCAGATGAAGGAGGG + Intergenic
938135918 2:128756391-128756413 AGAGTCATGCAGAAGATGGTTGG + Intergenic
938969924 2:136422741-136422763 AGGGGCCTGGAGAAGGTGGAAGG + Intergenic
939619860 2:144405512-144405534 TGTGACATTCAGAGGGTGGAGGG - Intronic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940820286 2:158346422-158346444 AGGGACATACAGAAGAAGCAAGG - Intronic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941110539 2:161415606-161415628 AGCGACAAGCAGAAGGGGGGAGG - Intergenic
942345001 2:174993505-174993527 ACAGACATGTAGAAAGTGGAAGG + Intronic
943186661 2:184615772-184615794 AGGGACATTCAGAGGTAGGATGG + Intronic
943418795 2:187639908-187639930 AGAGACAAAGAGAAGGTGGAAGG + Intergenic
945477626 2:210304108-210304130 AGAAACATGCAGAATGTGCATGG - Intronic
945769072 2:214016943-214016965 ATGGACATGCAGATGGTGTTAGG + Intronic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
945985912 2:216353499-216353521 GGGGACATGTTCAAGGTGGAAGG - Intronic
946254923 2:218435379-218435401 AGGGCCATCCAGAAGTTGGCTGG - Exonic
948458843 2:238119521-238119543 GGGGAGATGGAGGAGGTGGATGG + Intronic
949070035 2:242018930-242018952 AGGGAAAGGCAGATGTTGGATGG + Intergenic
1168739684 20:177021-177043 AGGAACATCGAGAAGGTGAAAGG - Intergenic
1169302616 20:4457378-4457400 AGGGCCTATCAGAAGGTGGAGGG + Intergenic
1169631379 20:7636495-7636517 AGGGAAATGAAGAAAGTGGAGGG + Intergenic
1171317155 20:24205438-24205460 AAGGCCATGCAGCAGGTGGCAGG + Intergenic
1171431855 20:25087923-25087945 AGGGGCATGAAGGAGGTAGAAGG - Intergenic
1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG + Intronic
1172254063 20:33501478-33501500 AGGGAAATGCAGAATGGTGAGGG + Intronic
1172635953 20:36410073-36410095 AGGAACAGGAACAAGGTGGATGG - Intronic
1174050866 20:47766422-47766444 AGGGTCATTCAGAGGGAGGAGGG + Intronic
1174924117 20:54738312-54738334 GGGGTCTTCCAGAAGGTGGAGGG + Intergenic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175619431 20:60430988-60431010 AAGGACATGGTGAAGGTCGACGG - Intergenic
1175626853 20:60495761-60495783 AGGAACAGGCAGACAGTGGATGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1176118137 20:63442097-63442119 CGGGACACGGAGCAGGTGGAGGG + Intronic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1177349181 21:19912931-19912953 AGGGCCTTTCAGAAGCTGGAGGG + Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178664397 21:34533957-34533979 AGGGTCATGGAGAAAGTGGTTGG + Intronic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179547386 21:42121966-42121988 AGGGACCTGCAGGAGATGGGTGG + Intronic
1179549740 21:42136365-42136387 AGAGACAGGGGGAAGGTGGATGG - Intronic
1180168019 21:46040133-46040155 AGGGACATGCAGAGGGTCCTGGG - Intergenic
1181574685 22:23786434-23786456 AGAGGAATGGAGAAGGTGGAAGG + Intergenic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1181673851 22:24439362-24439384 AGGGACACTCAGAAGGTGCAAGG - Intronic
1181743501 22:24939814-24939836 TGTGCCATGAAGAAGGTGGAGGG - Intronic
1183097545 22:35562212-35562234 AGGGAAAGGCAGAGGGGGGAGGG + Intergenic
1183784891 22:40023599-40023621 AGGGACACGCAGAAGGCAGCGGG - Intronic
1184281912 22:43442236-43442258 AGGGACTTGCACAAGCTGCAGGG - Intronic
1184285227 22:43466862-43466884 AGGGACAATCAGGAGGTGGAGGG - Intronic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1184851740 22:47125000-47125022 AGGGGCTTGCAGAGGGTGGCGGG + Intronic
1185048235 22:48539896-48539918 GGGTACAGGCAGAAGGTGGGAGG + Intronic
1185082791 22:48718944-48718966 GGGGACAGACAGATGGTGGAGGG - Intronic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
951331946 3:21379468-21379490 AGGAACATCAAGAAGGTGAAAGG + Intergenic
951762157 3:26159422-26159444 AGGAACATCAAGAAGGTGAAAGG + Intergenic
951780909 3:26362057-26362079 AGGGACTACCAGAGGGTGGAGGG - Intergenic
952080340 3:29750704-29750726 GGGGCCCTTCAGAAGGTGGAAGG - Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952998258 3:38906183-38906205 AGGGAGATGTAGTAGGTAGAAGG - Intronic
953841354 3:46392458-46392480 AGAGACATGGAGAAGGGGGGAGG + Intergenic
954366973 3:50151415-50151437 AGGGACCTGCAGCAGGAGGCCGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954743645 3:52774355-52774377 AGGGATATTCAGAGGGTGGGAGG + Intergenic
954807593 3:53229467-53229489 AGGGGCAGGCAGAGGGTGGTCGG + Intronic
955183925 3:56697065-56697087 ATAGACATGCATAAGGTGGAGGG - Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
956706211 3:72001315-72001337 AGGGAAATGGAGAAGATGCAGGG + Intergenic
956729841 3:72186648-72186670 AGGGACATGCAGAGGATGCCAGG - Intergenic
957642772 3:82879310-82879332 AAGGAAATGTAGCAGGTGGAAGG + Intergenic
958421794 3:93938948-93938970 AGAGACATGGAGAAGGGGGGTGG - Intronic
959045872 3:101472912-101472934 AGAGCCTTTCAGAAGGTGGAGGG - Intronic
959520449 3:107317787-107317809 AGGCACCTGTAGAAGGTGGCTGG + Intergenic
960432388 3:117584945-117584967 AGGGCCTTTCAGAAGGTGGAGGG + Intergenic
960964859 3:123097698-123097720 AAGGACATGAAGAAAATGGAGGG - Intronic
961264300 3:125628479-125628501 AGGTACATTCACAAGGTGGGGGG + Intergenic
961405105 3:126672800-126672822 AGGGAGATCAACAAGGTGGAAGG - Intergenic
962010714 3:131387711-131387733 AGAGACCTGAAGAAGGTGGGAGG - Intronic
962025461 3:131542642-131542664 AGTGACATGCAGATGCTGGACGG - Exonic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
963056250 3:141188528-141188550 AGGGGTATGCAGGAGGTGTAGGG + Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963320409 3:143804102-143804124 AGGAACATCGAGAAGGTGAAAGG - Intronic
963520282 3:146354747-146354769 AGAGACATGGAGAAGGGGGTGGG - Intergenic
963948435 3:151171407-151171429 AGGGACAGGCTAAAGGTGGCAGG + Intronic
964062987 3:152547158-152547180 AGGGACAACCAGAGAGTGGAGGG - Intergenic
965335743 3:167429401-167429423 AGGAACATCAAGAAGGTGAAAGG - Intergenic
965625862 3:170683609-170683631 AGGAACATCGAGAAGGTGAAAGG + Intronic
965725078 3:171707155-171707177 AGGGCCTTTCAGAAGGTAGAGGG + Intronic
966067468 3:175834393-175834415 AGGAACATCGAGAAGGTGAAAGG - Intergenic
966282676 3:178251270-178251292 ATGGACATCCGGAAGGTGGAGGG + Intergenic
966313969 3:178625099-178625121 AGGGCCAGGCAGAGGGTGCAAGG - Intronic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
967643989 3:191899903-191899925 AGAGACATGGAGAAGGGGTAGGG + Intergenic
968735916 4:2296556-2296578 AGGGGCATGAAGTGGGTGGAAGG + Intronic
969439355 4:7208183-7208205 TGGGACATGCAGAAGGGGCTTGG + Intronic
970397403 4:15682255-15682277 AGGGAAATGCAAGAGGTGGAAGG + Intronic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971282252 4:25250434-25250456 AGGGCCTTTCAGAAGGTGGAGGG + Intronic
971918840 4:32910238-32910260 AGGCACCTGCAGGAGGTGGCTGG - Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
973126274 4:46589404-46589426 GGGGACTATCAGAAGGTGGAGGG - Intergenic
973288849 4:48449465-48449487 AGGGACATATAGAAGGAGAAAGG + Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
974972620 4:68848044-68848066 AGAGACTTTCAGATGGTGGAAGG - Intergenic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
977112232 4:92972759-92972781 AGGGCCTTTCAGAGGGTGGAAGG - Intronic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
979242281 4:118458172-118458194 AGGGACAGGGAGAAAATGGAAGG - Intergenic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979545367 4:121933776-121933798 AGAGAAACGCATAAGGTGGAGGG - Intronic
982084116 4:151817099-151817121 AGAGACATGGAGAAGGGGTAGGG + Intergenic
982267179 4:153548697-153548719 AGGTAAAGGCAGAAAGTGGAGGG + Intronic
983019785 4:162661288-162661310 AGTGACATACAGAAAATGGAAGG + Intergenic
983267100 4:165518879-165518901 TGGGACATGCAGTAGTTGGGTGG - Intergenic
984164968 4:176295797-176295819 AGGAACATCGAGAAGGTGAAAGG + Intergenic
984593316 4:181640108-181640130 AGGGACATCAAGAAGATGAAGGG + Intergenic
984679690 4:182593375-182593397 AGGGACAGGCAGAAACTGGGTGG - Intronic
984959850 4:185086187-185086209 AGGGAGCTGCAGATGGCGGAGGG + Intergenic
985702973 5:1384705-1384727 AGGGACAGGCAGATGGGAGAGGG - Intergenic
985932257 5:3067789-3067811 AGTGACAAGCAGAAGGTTGCAGG - Intergenic
986519813 5:8602702-8602724 AGGGACACACAGAATGTGCAAGG + Intergenic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
988518945 5:31929105-31929127 ACAGCCATGCAGCAGGTGGATGG - Intronic
989013811 5:36904940-36904962 AGGGAATTACACAAGGTGGATGG + Intronic
992915435 5:81446902-81446924 AGGGTCCTCCAGGAGGTGGAGGG - Exonic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
996358100 5:122618706-122618728 AGGAACATCAAGAAGGTGAAAGG + Intergenic
996408929 5:123135593-123135615 AGGGAGTTGCAGGGGGTGGAGGG - Intronic
998359582 5:141573650-141573672 CGGGAAATGGAGGAGGTGGAGGG + Exonic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999547895 5:152651051-152651073 AGGAAAATGGAGAAAGTGGAGGG - Intergenic
999833778 5:155347189-155347211 AAGCCCATGCAGAAGATGGAGGG - Intergenic
1000382640 5:160642829-160642851 AGGAACATGCAGAATATGAATGG + Intronic
1001021174 5:168183583-168183605 ATGGAAATGAAGAAGGTGCAGGG - Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1002083134 5:176749210-176749232 TGGGACATGTAGAAGGTGACAGG + Intergenic
1002313936 5:178331369-178331391 AGGGCCATGCAGCAGGTGACTGG - Intronic
1002993810 6:2264059-2264081 AGGGACATTCAGTGGCTGGAAGG + Intergenic
1003109690 6:3243260-3243282 GGGGACATGAAGACGTTGGAGGG - Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003276088 6:4654341-4654363 AGGGACATGCAAAATGTGTAAGG - Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1005887847 6:30110688-30110710 AGGGACAGGCAGAGGGTGAGAGG + Intronic
1006133359 6:31881665-31881687 AGGGACAGGCAGTGAGTGGATGG + Intronic
1006512692 6:34530212-34530234 AGGGAGATGGGGGAGGTGGAGGG - Intronic
1007162842 6:39806160-39806182 AGGGAGATGCTCAAAGTGGATGG + Intronic
1007300323 6:40863166-40863188 AGGAACATTGAGAAGGTGAAAGG + Intergenic
1007687613 6:43676365-43676387 AGGGAATGGCAGGAGGTGGAGGG - Intronic
1007698185 6:43747138-43747160 GGGGACATGGAAAAGGAGGAAGG - Intergenic
1007877787 6:45126027-45126049 AGAGACATGCAGAAGCTTGTTGG - Intronic
1008849832 6:56011749-56011771 AGGAACATTGAGAAGGTGGAAGG + Intergenic
1009635487 6:66259676-66259698 AGGGACCTTCAGAAGGGGAAAGG + Intergenic
1009729437 6:67580883-67580905 GGGGCCAACCAGAAGGTGGAGGG - Intergenic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012331039 6:97987911-97987933 AGGGACTTGCAGAGAGTAGAAGG - Intergenic
1014115506 6:117664229-117664251 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1014353698 6:120377001-120377023 AGGCAAATGTAGAGGGTGGAAGG + Intergenic
1014500988 6:122189159-122189181 GGGGTCTTTCAGAAGGTGGAGGG - Intergenic
1015697277 6:135995039-135995061 GGGGACATGAAGAAGCAGGATGG - Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017633554 6:156422494-156422516 AGGGACTTGCAGCAGGCGTATGG + Intergenic
1018247995 6:161840602-161840624 GGGGCCTGGCAGAAGGTGGAGGG - Intronic
1018279568 6:162171220-162171242 AGGGTCATGGAGAAACTGGAAGG + Intronic
1018401367 6:163423973-163423995 AGTGACACCCAGGAGGTGGATGG + Intronic
1018471326 6:164101070-164101092 AGGGACCTGCAGGTGGAGGAGGG - Intergenic
1018471498 6:164101549-164101571 AGGGACCTGCAGGTGGAGGAGGG - Intergenic
1019088899 6:169507927-169507949 AAGTACATGCAGCAGTTGGAAGG - Intronic
1019477895 7:1252756-1252778 AGGGACAAGAAGCAGGTGGCCGG + Intergenic
1020794041 7:12660758-12660780 AGAGACATGGAGAAGGGGGGTGG - Intergenic
1021627648 7:22610104-22610126 AGCGACTTGGACAAGGTGGATGG - Intronic
1022031380 7:26494190-26494212 AGGGAAGTGGAGCAGGTGGATGG - Intergenic
1022332815 7:29396684-29396706 AGGGACATGCAGCAGGAGAGTGG - Intronic
1023931223 7:44707802-44707824 AGGCACATGCAGCAGAGGGATGG + Intronic
1024210000 7:47194884-47194906 AGGGCCATGCAGGAGCTGAACGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026974913 7:74491480-74491502 GGGGCCTTTCAGAAGGTGGAGGG - Intronic
1027158067 7:75782459-75782481 AGAGACATGGAGAAGGGGGGTGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027878259 7:83799689-83799711 GGGCACAGGCAGAAGATGGATGG + Intergenic
1027933765 7:84575637-84575659 AGGCAATTACAGAAGGTGGAAGG + Intergenic
1027960017 7:84933513-84933535 AGGAAAATATAGAAGGTGGAGGG + Intergenic
1029219083 7:98973829-98973851 AAGGACATGCAGCAAGTGGGCGG - Intronic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030791718 7:113738571-113738593 AGGTACCTGCATAAGGTGTAAGG + Intergenic
1031296451 7:120010069-120010091 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1031714355 7:125089271-125089293 AGGGCCTTTCCGAAGGTGGAGGG + Intergenic
1032573994 7:133033310-133033332 TGGGACATTCAGAAGTTAGAGGG + Intronic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033528755 7:142243112-142243134 AGGGAAGTGCAGAAGGAAGAAGG - Intergenic
1033656978 7:143381288-143381310 AGGGACACACGGAAGGAGGAGGG - Exonic
1033965088 7:146965574-146965596 GGGTACAAGCAGAAGTTGGATGG + Intronic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1034393636 7:150803818-150803840 ATGGACATGCTGAAGGTAGGTGG + Exonic
1034416122 7:150965129-150965151 TGGGAAATGCAGCAGGTTGAGGG + Intronic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035268153 7:157703648-157703670 AGGCACCTGCAGGAGGTGAAAGG + Intronic
1035761983 8:2075252-2075274 AGGCACATGCAGAAGACGGAAGG - Intronic
1036497628 8:9283839-9283861 AGGGAGAGGAAGAAGCTGGAAGG - Intergenic
1037023261 8:14000270-14000292 GGGGCCATTCAGAGGGTGGAAGG - Intergenic
1037882836 8:22581252-22581274 AGGGACATGCAGGAGGGTGCAGG + Intronic
1037966514 8:23138240-23138262 AGGAACAGGCAGAAGCTGAAGGG - Exonic
1037974086 8:23197184-23197206 AGGGACCGGCAGAAGCTGAAGGG - Exonic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041324774 8:56652617-56652639 AGGGACACGCAGGGAGTGGAGGG + Intergenic
1041917698 8:63152847-63152869 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1043461534 8:80465230-80465252 AGGGATGTGGAGAAAGTGGAAGG + Intergenic
1046089719 8:109487249-109487271 AGGAGCATGAAGAAAGTGGATGG - Intronic
1046612909 8:116445311-116445333 GGGGAGGGGCAGAAGGTGGAGGG + Intergenic
1046744643 8:117863779-117863801 AGGGTGAGGAAGAAGGTGGAAGG + Intronic
1046968718 8:120196007-120196029 GGGGAAATGCAGAAGGTGAATGG - Intronic
1047214297 8:122864203-122864225 AGGGACAGGCAGTGGGAGGAGGG + Intronic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048165928 8:132061386-132061408 AGGGACAGAGAGAAGGAGGAAGG - Intronic
1048318179 8:133377304-133377326 AGGCCCATGCAGAATGTGGCTGG + Intergenic
1049061096 8:140276857-140276879 AGGGACAGGAAGAAGGTAGTGGG - Intronic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049632364 8:143665597-143665619 AGGGACAGGGATAAGGGGGATGG + Intergenic
1049632431 8:143665798-143665820 AGGGACAGGAAGAAGGTGGGTGG + Intergenic
1049709366 8:144056750-144056772 TGGGACCTGCAGCAGGTGGTTGG + Exonic
1050572708 9:6957957-6957979 AGGGCCATGGAGAAGTTGGGTGG + Intronic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1053174086 9:35909893-35909915 AGGGACATGAGGAGGGAGGAAGG - Intergenic
1053302237 9:36960454-36960476 AGGGACATGGGGACGGTGAAGGG + Intronic
1053527184 9:38842063-38842085 AGAGACACGGAGAGGGTGGAAGG + Intergenic
1053600923 9:39608766-39608788 AGGCACATCCATAAGGTGCAAGG - Intergenic
1053858575 9:42362576-42362598 AGGCACATCCATAAGGTGCAAGG - Intergenic
1054199407 9:62066494-62066516 AGAGACACGGAGAGGGTGGAAGG + Intergenic
1054252611 9:62733672-62733694 AGGCACATCCATAAGGTGCAAGG + Intergenic
1054566727 9:66768170-66768192 AGGCACATCCATAAGGTGCAAGG + Intergenic
1054638948 9:67521863-67521885 AGAGACACGGAGAGGGTGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055115411 9:72600056-72600078 AGGGCCATGTAGTAGGTCGACGG + Intronic
1055347337 9:75352716-75352738 AGGGACATTGAGAAGGTGAAAGG + Intergenic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056123305 9:83510853-83510875 GGGGAAATGAAGAGGGTGGAGGG + Intronic
1056990154 9:91403167-91403189 AGGAACCTGCAGAATCTGGAAGG - Intergenic
1057448162 9:95133599-95133621 AAGGACATGGAGAAGGTTCAGGG + Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1060034640 9:120244242-120244264 ATGGACAGCCAGAAGGTGCATGG - Intergenic
1060276021 9:122183254-122183276 AGGGACGTGTAGGAGGGGGAAGG - Intronic
1060982066 9:127798679-127798701 AGGGACATGGAGAAAGTACAAGG + Intronic
1061205762 9:129162363-129162385 AGGGACCAGGAGAAGGTGGCAGG + Intergenic
1061264007 9:129495335-129495357 AGGGACAGGAAGAAGGGTGAGGG - Intergenic
1061930317 9:133829014-133829036 AGTGACATGCACAAGATGGTTGG - Intronic
1062097919 9:134712292-134712314 GGGGACAGGAAGAAGGGGGAAGG - Intronic
1062117106 9:134815392-134815414 TGGGACATGCTGCACGTGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062590334 9:137271798-137271820 AGGGACAGGAGGAGGGTGGAGGG - Intronic
1062727287 9:138082752-138082774 AAGGACAAGCACTAGGTGGAAGG - Intronic
1203493440 Un_GL000224v1:128418-128440 AGGGACATTCAGATGATGGCAGG - Intergenic
1203506060 Un_KI270741v1:70293-70315 AGGGACATTCAGATGATGGCAGG - Intergenic
1186118647 X:6333454-6333476 GGGGCCTTTCAGAAGGTGGAGGG - Intergenic
1186540337 X:10393654-10393676 AGAGTAATGCTGAAGGTGGATGG - Intergenic
1186596309 X:10985357-10985379 AGAGACTTGAAGAATGTGGAGGG - Intergenic
1187103931 X:16221342-16221364 AGAGACATGGAGAAGGGGGTTGG + Intergenic
1187333246 X:18359914-18359936 AGGGACTGGCGGAAGCTGGAAGG - Intergenic
1187927711 X:24265077-24265099 ACAGTCATGCAGAAGGTGAAGGG + Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188200295 X:27288029-27288051 AGGAACATTGAGAAGGTGAAAGG + Intergenic
1188985640 X:36766247-36766269 AGGGACATGCAGAATAAGGGAGG - Intergenic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1189142348 X:38620036-38620058 AGGGACATGGCGAGGGTGGATGG + Intronic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1191989942 X:67024319-67024341 GGGGACTTTCAGAGGGTGGAAGG - Intergenic
1192034640 X:67548579-67548601 GGAGGCATGCAGAAGATGGAAGG - Intronic
1192369089 X:70498655-70498677 AGGGACCTGGAGGAGGAGGAAGG + Intronic
1192886608 X:75341927-75341949 GGGGCCTTTCAGAAGGTGGAGGG - Intergenic
1194511865 X:94806548-94806570 AGGAATATGAAAAAGGTGGATGG - Intergenic
1194817935 X:98468001-98468023 AGGGACTACCAGAGGGTGGAGGG + Intergenic
1195017119 X:100790965-100790987 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1195104220 X:101587563-101587585 GGGGACATTCTGAGGGTGGAAGG - Intergenic
1195676659 X:107511982-107512004 AGAGAATTCCAGAAGGTGGAGGG - Intergenic
1195832792 X:109077987-109078009 AGGGAAGTGCAACAGGTGGAGGG - Intergenic
1196226832 X:113177720-113177742 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1196525090 X:116721885-116721907 AGGAACATTGAGAAGGTGAAAGG + Intergenic
1198016269 X:132614424-132614446 GGGGCCATTCAGAAGGTAGAGGG + Intergenic
1198416008 X:136420431-136420453 GGGGCCTTGCAGAGGGTGGAGGG + Intergenic
1199866893 X:151859783-151859805 GGGGACTTTCAGAGGGTGGAGGG + Intergenic
1200013522 X:153140045-153140067 AAAGACATGCAGAAGATAGAGGG + Intergenic
1200026079 X:153259873-153259895 AAAGACATGCAGAAGATAGAGGG - Intergenic
1201233667 Y:11890192-11890214 AGGAACATCAAGAAGGTGAAAGG + Intergenic
1202390030 Y:24360286-24360308 AGGGACAGGGAGAAAATGGAAGG - Intergenic
1202480754 Y:25309828-25309850 AGGGACAGGGAGAAAATGGAAGG + Intergenic