ID: 1175813789

View in Genome Browser
Species Human (GRCh38)
Location 20:61873159-61873181
Sequence CCGTCAGATGGAGCACATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175813789_1175813797 19 Left 1175813789 20:61873159-61873181 CCCAGATGTGCTCCATCTGACGG No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175813789 Original CRISPR CCGTCAGATGGAGCACATCT GGG (reversed) Intronic