ID: 1175813789 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:61873159-61873181 |
| Sequence | CCGTCAGATGGAGCACATCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175813789_1175813797 | 19 | Left | 1175813789 | 20:61873159-61873181 | CCCAGATGTGCTCCATCTGACGG | No data | ||
| Right | 1175813797 | 20:61873201-61873223 | CCCTGCTCAGAGTCCCTTCTAGG | 0: 1 1: 0 2: 11 3: 106 4: 1112 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175813789 | Original CRISPR | CCGTCAGATGGAGCACATCT GGG (reversed) | Intronic | ||