ID: 1175813797

View in Genome Browser
Species Human (GRCh38)
Location 20:61873201-61873223
Sequence CCCTGCTCAGAGTCCCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175813791_1175813797 18 Left 1175813791 20:61873160-61873182 CCAGATGTGCTCCATCTGACGGA No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813789_1175813797 19 Left 1175813789 20:61873159-61873181 CCCAGATGTGCTCCATCTGACGG No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813786_1175813797 29 Left 1175813786 20:61873149-61873171 CCAGGGCGCCCCCAGATGTGCTC No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813787_1175813797 21 Left 1175813787 20:61873157-61873179 CCCCCAGATGTGCTCCATCTGAC No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813794_1175813797 -7 Left 1175813794 20:61873185-61873207 CCTATAGGCACAGCCTCCCTGCT No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813785_1175813797 30 Left 1175813785 20:61873148-61873170 CCCAGGGCGCCCCCAGATGTGCT No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813788_1175813797 20 Left 1175813788 20:61873158-61873180 CCCCAGATGTGCTCCATCTGACG No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data
1175813793_1175813797 7 Left 1175813793 20:61873171-61873193 CCATCTGACGGAGTCCTATAGGC No data
Right 1175813797 20:61873201-61873223 CCCTGCTCAGAGTCCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175813797 Original CRISPR CCCTGCTCAGAGTCCCTTCT AGG Intronic