ID: 1175813944

View in Genome Browser
Species Human (GRCh38)
Location 20:61873942-61873964
Sequence GGTCCCCGCAGGACACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175813936_1175813944 25 Left 1175813936 20:61873894-61873916 CCGAGAGGTGAGGCGGGGTGGGG 0: 1
1: 0
2: 1
3: 49
4: 429
Right 1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG 0: 1
1: 0
2: 1
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175813944 Original CRISPR GGTCCCCGCAGGACACCCAC AGG Intronic
900139698 1:1134543-1134565 GGTGCCCGCAGGACCCTCAGTGG + Intergenic
900158297 1:1212211-1212233 GGTCCACGCTGGCCAGCCACAGG + Intronic
900525962 1:3128824-3128846 GCTCCCAGCAGGGCACTCACTGG - Intronic
900538513 1:3190984-3191006 GGATCCCGCAGGACCCCCAGGGG + Intronic
900707689 1:4090634-4090656 GGTGGCTGCAGGGCACCCACAGG + Intergenic
901452453 1:9344416-9344438 GGTCCCGTCACGAGACCCACAGG - Intronic
901459525 1:9383275-9383297 GGTCCCCGCAGGTCCCCCCTGGG - Intergenic
901461246 1:9393061-9393083 GGGCACAGCAGGACACCCTCAGG + Intergenic
902977404 1:20098863-20098885 TGGCCCCCCAGGACTCCCACTGG + Intergenic
903674500 1:25055556-25055578 CATCCCAGCAGGACCCCCACAGG + Intergenic
904893749 1:33798790-33798812 GGACCCTGGAGGACACCCACTGG + Intronic
911178856 1:94843445-94843467 AGGCCCCGCAAGACACCCAGAGG - Intronic
912775477 1:112504121-112504143 GATCCCAGCAGCACACCCACTGG + Intronic
915598584 1:156908720-156908742 GCTGCCCGCAGGACACGCATGGG + Exonic
917737279 1:177932642-177932664 GGTCCCCTCAGCACTCCCAAGGG - Intronic
920292201 1:204931038-204931060 GGCCCAGGCAGGACACACACTGG + Intronic
922062727 1:222107553-222107575 GGTCCAGACAGGACACTCACCGG + Intergenic
922099648 1:222470351-222470373 GGTCCGGTCAGGACCCCCACAGG - Intergenic
1063100256 10:2944353-2944375 TGTCCCCGCCGGACACCACCAGG - Intergenic
1064380696 10:14838784-14838806 GGACCCCCCGGGACACCCAGCGG - Intronic
1066733631 10:38453535-38453557 GGTCCGGTCAGGACCCCCACAGG + Intergenic
1067142821 10:43670659-43670681 GGTCCCCCCAGGCCAGACACAGG + Intergenic
1069723691 10:70564595-70564617 GGTCCCCGCAGGCCATGTACAGG - Intronic
1076250392 10:128979956-128979978 GGTGGCCAGAGGACACCCACAGG - Intergenic
1076679039 10:132162064-132162086 GGTGCCCTCAGGTGACCCACAGG + Intronic
1084727761 11:70953057-70953079 GGTCCTCGTAGGGCACACACAGG - Intronic
1085154134 11:74277835-74277857 CGTCTCCCCAGGAGACCCACTGG - Intronic
1090950065 11:131465261-131465283 GGCACCCGCAGGTCACCCATGGG - Intronic
1092070894 12:5630373-5630395 GGTCCCAGCAGTATCCCCACAGG - Intronic
1092218782 12:6699629-6699651 GGTCCAGGCAGGACAGCCAGAGG + Intronic
1096052920 12:48627200-48627222 GGTCCCGGCTGGGCACCAACAGG - Intergenic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1096774771 12:53957171-53957193 GGGTCCCCCAGGACACCCAGTGG + Exonic
1097778800 12:63679755-63679777 GGTCCCAGCTGGCCACTCACAGG - Intergenic
1101927067 12:108980962-108980984 GATCCTCGGAGGTCACCCACGGG - Intronic
1103070939 12:117941272-117941294 GGGCCAGGCAGGAAACCCACAGG - Intronic
1104914752 12:132258846-132258868 CGTCCACGCTGGAGACCCACAGG + Intronic
1112103774 13:96218375-96218397 GGTCCTCACAGGACAGCCTCTGG + Intronic
1113231709 13:108218808-108218830 GGCCCCCGCACGACCCCCAGGGG - Intronic
1113571059 13:111358359-111358381 GGACCTCGCAGGACAGTCACTGG + Intergenic
1113883417 13:113642693-113642715 GGGCCCTGCAGGACACCATCAGG + Intergenic
1114627652 14:24139723-24139745 GATCCCCGCAGGCCACCTACAGG - Intronic
1114832690 14:26164144-26164166 GGTCCTTGCTGGCCACCCACTGG - Intergenic
1122006254 14:98706255-98706277 GCACACAGCAGGACACCCACAGG - Intergenic
1122976134 14:105171545-105171567 GGCCCCAGCAGGACATTCACAGG - Intergenic
1127574682 15:60279451-60279473 GGTCCCTGTGGGACACCCAGTGG + Intergenic
1128108188 15:65059491-65059513 GGTCCCCCCAGGCCACACAGGGG - Intronic
1128349454 15:66879490-66879512 GCTCCAGGCAGGACACCCAGGGG + Intergenic
1132982075 16:2743335-2743357 GCTCCTCGGAGGACCCCCACAGG + Intergenic
1133031536 16:3013509-3013531 GCACCACGCAGGACATCCACAGG - Exonic
1133032063 16:3015853-3015875 GCACCACGCAGGACATCCACAGG + Exonic
1135410413 16:22230014-22230036 GGACCCCAGAGGAGACCCACGGG - Intronic
1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG + Exonic
1137621661 16:49880341-49880363 GCTCCCAGCTGGCCACCCACAGG - Intergenic
1140630913 16:76851210-76851232 GGTCACTGCAGGACTTCCACTGG - Intergenic
1141797692 16:86286179-86286201 GGTCACCGCAGGGCATGCACTGG + Intergenic
1142373306 16:89694786-89694808 GGTCTGCCCAGGACGCCCACCGG - Exonic
1142379141 16:89721796-89721818 CGTCCCCGCAGGACCCCACCGGG - Exonic
1143993132 17:10984013-10984035 GGACCCCACAGGAAACCCACTGG - Intergenic
1144144811 17:12387278-12387300 GGCCCCCGGAGGACTCCCAGGGG - Intergenic
1144867368 17:18345168-18345190 GGTCCCCTCACTGCACCCACAGG + Intronic
1147384733 17:40074407-40074429 GGCCCCCCCGGCACACCCACAGG - Exonic
1150721726 17:67619469-67619491 GGCCCCCCAAGGACCCCCACAGG + Intronic
1151552648 17:74830973-74830995 GGGCCCCCGAGGACACCCATAGG - Intronic
1152687359 17:81701158-81701180 GGCACCCGCAGGGCACCCTCAGG + Intronic
1155455243 18:26005028-26005050 GATCCCAGCAGGAGAGCCACAGG + Intergenic
1157454348 18:47812791-47812813 TGTCTCCCCAGGACCCCCACAGG + Exonic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1161264749 19:3359108-3359130 TGTGCCCGGCGGACACCCACGGG + Intergenic
1163179875 19:15591885-15591907 GGTCCTGGCAGGGAACCCACAGG + Intergenic
1163426079 19:17241661-17241683 GGTTCCAGCTGGACACCCAGGGG + Intronic
1167104061 19:47420088-47420110 CCTCACCGCAGGACAGCCACGGG - Intergenic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
925018365 2:548837-548859 GCTCCCTGCAGGACCCCCAGGGG + Intergenic
925532787 2:4883526-4883548 GGTCATCTCAGGACACCAACGGG + Intergenic
925984602 2:9206320-9206342 GGTCCCCGCAGGGTGCCCGCCGG + Intergenic
927095566 2:19745512-19745534 GGTGCCTGCAGAACACCCACAGG + Intergenic
927499916 2:23575790-23575812 GGCCCCAGCAGCTCACCCACCGG + Intronic
928218087 2:29379102-29379124 GGATCACGCAGGACACTCACCGG - Intronic
930068336 2:47345049-47345071 GGTCCCTGCAGGAAGCCCAGGGG + Intergenic
931257506 2:60585939-60585961 GGTCACTGCTGGACACCCAGTGG - Intergenic
935255735 2:101308330-101308352 GGTCTCCGCCGGGCGCCCACGGG + Exonic
936072541 2:109380879-109380901 GGCCCCAGCAGGGCACGCACTGG + Intronic
945871547 2:215231989-215232011 GGGCCCCTCAGGGCACCAACCGG + Intergenic
947530802 2:230907585-230907607 GGTCCCCAGGGCACACCCACAGG + Exonic
947545636 2:231008448-231008470 GGACCCAGCAGGGCAGCCACTGG + Intronic
947958553 2:234215402-234215424 GGACACAGCTGGACACCCACAGG - Intergenic
948461145 2:238130582-238130604 GGCCCCTGCAGGACACCTGCAGG + Exonic
1173470666 20:43321028-43321050 GTTCCCAGTAGGCCACCCACTGG - Intergenic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1175769870 20:61616868-61616890 GGTCCCCGCTGCACATCCAGGGG + Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1176151963 20:63596015-63596037 GGCACCTCCAGGACACCCACTGG - Intronic
1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG + Intronic
1179982405 21:44903220-44903242 GGTCCCCCCAGGGCATCCACAGG - Intronic
1180090532 21:45531593-45531615 AGTCCCCACAGGCCACCCGCAGG + Exonic
1181473906 22:23157067-23157089 GCTCCCCTCAGGACCCCAACAGG + Intronic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
950863858 3:16173708-16173730 GGACCATGCAGGACACCCCCTGG - Intergenic
951515931 3:23559573-23559595 GCTCACGGCAGGACAGCCACAGG - Intronic
953882269 3:46696753-46696775 GGTCCCTACAGGAAACTCACAGG + Intergenic
961390627 3:126550527-126550549 GGACCCAGCATGCCACCCACAGG + Intronic
962344809 3:134611137-134611159 ATTCCCCTCAGGACAGCCACAGG - Intronic
962388693 3:134953849-134953871 GGCCCTCTCAGGACAGCCACAGG - Intronic
962995861 3:140627576-140627598 GGTCCCTGCATTACATCCACAGG + Intergenic
965350201 3:167602197-167602219 TGGCCCCAAAGGACACCCACTGG + Exonic
967847518 3:194056143-194056165 GGTACCCCCAGGACACCCTGTGG + Intergenic
968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG + Intronic
969392896 4:6902542-6902564 GGTTCCCGCAGAGGACCCACGGG + Intergenic
969531372 4:7732920-7732942 GGTCCAAGCAGGACTCACACTGG + Intronic
970898749 4:21134098-21134120 GGTCTCCCCAGACCACCCACAGG + Intronic
973912119 4:55592045-55592067 GGGCCCAGCTGGAGACCCACTGG + Intronic
979259977 4:118636522-118636544 GGTCCGGTCAGGACCCCCACAGG + Intergenic
988466274 5:31495683-31495705 GGTACCAGAGGGACACCCACTGG + Intronic
990990570 5:61679359-61679381 TGTCCCTGCAGGACAGACACTGG - Intronic
997454295 5:134005661-134005683 GGGTCCCGCAGGACACGCCCCGG - Intergenic
997512877 5:134465531-134465553 GGTACCACCAGGAGACCCACTGG + Intergenic
1002364791 5:178701459-178701481 GGTCCGCACAGGTCACACACTGG + Intergenic
1002833885 6:849117-849139 GGTGCCAGCAGGAGACCAACGGG + Intergenic
1002900804 6:1408202-1408224 GGTCCCCGAAGGACAGCCTTTGG - Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1011277431 6:85643730-85643752 GCTTCCCGGAGGGCACCCACCGG + Intronic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1018429113 6:163709635-163709657 GGTCTCCCCAGGACACCCTGAGG - Intergenic
1018940795 6:168308005-168308027 TGGCCCCGCAGGAGAGCCACCGG - Exonic
1019428413 7:987877-987899 GGACCCCTCAGGACACACAGGGG - Intronic
1019428459 7:987988-988010 GGACCCCCCAGGACACACAGAGG - Intronic
1020130147 7:5555158-5555180 GGTCCGCGCTGGACTCGCACGGG - Intronic
1022937731 7:35197417-35197439 GGTCCCAGCTGGCCACTCACAGG - Intergenic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1028372396 7:90108174-90108196 GGTCCCAGCTGGCCACTCACAGG + Intergenic
1029116663 7:98241173-98241195 GGTCCCTGCTGGACACCCCCGGG - Exonic
1029127882 7:98307649-98307671 GGTCCCCGCAGGGCACCAGACGG - Intronic
1029680452 7:102105096-102105118 TGTCCCCAGAGGACACACACTGG - Intronic
1035743731 8:1946835-1946857 TGTCCCCGCCGCACTCCCACTGG + Intronic
1045857655 8:106782577-106782599 GGTACCTGTAGGACATCCACGGG + Intergenic
1048068712 8:130999526-130999548 GGGCCCCTCAGGACACCCCAGGG - Intronic
1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG + Intergenic
1049431556 8:142567579-142567601 AGTTACCGCAGGACACCCATGGG - Intergenic
1056972349 9:91216805-91216827 GGTACCCCCAGGACACACAATGG + Intronic
1057112774 9:92489851-92489873 GGTCCCCGCTGGACCCCCACTGG + Intronic
1059374609 9:113872531-113872553 GGTCCGGGAGGGACACCCACAGG - Intergenic
1062123226 9:134845493-134845515 GGACCCTGCTGGAGACCCACTGG - Intergenic
1062430672 9:136525637-136525659 GCTTCCCACAGGACCCCCACCGG + Intronic
1062597846 9:137307110-137307132 GGTGTCCTCAGCACACCCACCGG + Exonic
1185608069 X:1378607-1378629 GGTCCCCCCAGGACGGCCCCCGG + Intronic
1186493471 X:9993107-9993129 TGTCCCGGCAGGAAACCCCCCGG - Intergenic
1188848422 X:35102742-35102764 GGTACCAGCAGGAGACCCAAAGG + Intergenic
1189021858 X:37349541-37349563 GGCCCTGGCCGGACACCCACAGG - Intronic
1200062270 X:153488890-153488912 GGGCCAGGCAGGCCACCCACAGG + Intronic
1200147567 X:153934650-153934672 GGTCCCCGGAGCCCACCCAACGG + Intronic