ID: 1175814640

View in Genome Browser
Species Human (GRCh38)
Location 20:61877135-61877157
Sequence GGGACAGTGCCCAGCCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175814630_1175814640 19 Left 1175814630 20:61877093-61877115 CCTGGGCCAGGCATTCCTGTGGG No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814634_1175814640 4 Left 1175814634 20:61877108-61877130 CCTGTGGGCATGTCAAGGCCCGT No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814626_1175814640 28 Left 1175814626 20:61877084-61877106 CCTGGCCTCCCTGGGCCAGGCAT No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814624_1175814640 30 Left 1175814624 20:61877082-61877104 CCCCTGGCCTCCCTGGGCCAGGC No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814628_1175814640 20 Left 1175814628 20:61877092-61877114 CCCTGGGCCAGGCATTCCTGTGG No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814632_1175814640 13 Left 1175814632 20:61877099-61877121 CCAGGCATTCCTGTGGGCATGTC No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814627_1175814640 23 Left 1175814627 20:61877089-61877111 CCTCCCTGGGCCAGGCATTCCTG No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data
1175814625_1175814640 29 Left 1175814625 20:61877083-61877105 CCCTGGCCTCCCTGGGCCAGGCA No data
Right 1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175814640 Original CRISPR GGGACAGTGCCCAGCCTCCT GGG Intronic