ID: 1175814892

View in Genome Browser
Species Human (GRCh38)
Location 20:61878209-61878231
Sequence CAGGGGGAACAGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 667}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175814892_1175814905 15 Left 1175814892 20:61878209-61878231 CCTCCCACCTTCTGTTCCCCCTG 0: 1
1: 0
2: 5
3: 56
4: 667
Right 1175814905 20:61878247-61878269 GCCCAAGCCTAGGAACATCCAGG 0: 1
1: 0
2: 3
3: 9
4: 111
1175814892_1175814903 5 Left 1175814892 20:61878209-61878231 CCTCCCACCTTCTGTTCCCCCTG 0: 1
1: 0
2: 5
3: 56
4: 667
Right 1175814903 20:61878237-61878259 TTCAAACCGAGCCCAAGCCTAGG 0: 1
1: 0
2: 2
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175814892 Original CRISPR CAGGGGGAACAGAAGGTGGG AGG (reversed) Intronic
900001497 1:17225-17247 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900021216 1:187747-187769 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900584473 1:3425812-3425834 GAGGGGGAACAGCAGGGGAGTGG + Intronic
901019470 1:6248575-6248597 CAGGGGGCACTGAGAGTGGGAGG + Exonic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901622285 1:10598211-10598233 GAGTGGGAAAAGCAGGTGGGAGG - Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901775949 1:11560540-11560562 CAGGTGGGGCAGAGGGTGGGGGG + Intergenic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902185150 1:14719462-14719484 CAGGAGGAAAAGAAGATGGGAGG + Intronic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902561941 1:17283088-17283110 CAGGGGGACAGGATGGTGGGTGG - Exonic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903066691 1:20703609-20703631 TAGGTGGAAGAAAAGGTGGGTGG + Intronic
903221897 1:21873896-21873918 CAGGGGGTGGAGAGGGTGGGGGG - Intronic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904320514 1:29695116-29695138 AAGTGGGAACAGCAAGTGGGAGG - Intergenic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
904699696 1:32351215-32351237 CAGGGGGCGCTGTAGGTGGGCGG - Intergenic
904718135 1:32484738-32484760 CAGGGGGAAGAGAAAGAAGGGGG - Intronic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
905199119 1:36304641-36304663 AAAGGGGAACACAAGGTGGTCGG - Exonic
905890707 1:41516750-41516772 CAGAGGGAGCAGCAGGTGTGGGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906135254 1:43495268-43495290 CACTGGGAACAGCAGGAGGGAGG + Intergenic
906376535 1:45301157-45301179 CAGGTGGTACAGAAGGTGGTGGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
906955397 1:50369866-50369888 CAGAGCGAAGAGCAGGTGGGAGG + Intergenic
907301724 1:53490991-53491013 CAGGGAGGATAGAAGGTGAGTGG - Intergenic
907306250 1:53514651-53514673 CAGAGGGGACAGATGGTGGTGGG + Exonic
907323497 1:53620357-53620379 CAGGGTGAACAGAAAATGGGCGG + Intronic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
910146615 1:84086810-84086832 CAGGGGGCACAGAAAATGAGTGG + Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
911130961 1:94387828-94387850 CAGGAGGAATAAAAGTTGGGAGG - Intergenic
912389881 1:109295623-109295645 CAGTGGGAACAGAATATGGATGG - Intronic
913174993 1:116265294-116265316 TGGAGGGAACAGAAAGTGGGGGG + Intergenic
914719937 1:150281656-150281678 CACGGGGAACAGAATGGGGTAGG - Intergenic
915076339 1:153310913-153310935 CCAGGGCAACAGGAGGTGGGTGG - Intergenic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
915486171 1:156222253-156222275 CAGTGGGAAGACAAGGTGGCAGG - Intronic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915919296 1:159962185-159962207 CAAGGGGAACAGAGGATGGGAGG + Intergenic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
920071633 1:203306585-203306607 CAGAGGGAACACAGGGTGGGAGG + Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920232689 1:204481053-204481075 CAGGGGGAAAAGTATGTGGAGGG - Intronic
920511547 1:206555951-206555973 CTGGGGAAACATAAGCTGGGTGG - Intronic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
921315763 1:213888596-213888618 GAGGGGAGAGAGAAGGTGGGAGG + Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922187935 1:223292971-223292993 AGGAGGGAACAGTAGGTGGGAGG + Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922973318 1:229761343-229761365 CAGAGGGAACAGAAACTGGAAGG - Intergenic
923412794 1:233726310-233726332 CAGGGGGCCTAGTAGGTGGGAGG + Intergenic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
923774445 1:236965960-236965982 CAGGTGGATGAGAGGGTGGGAGG + Intergenic
923845546 1:237727535-237727557 CATGGGGCAGAGAAGTTGGGAGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924858522 1:247898046-247898068 AAGGGCGAACACAAGGTGAGAGG + Intergenic
1063663293 10:8048225-8048247 CAGGGGGCTCAGGAGCTGGGTGG + Intergenic
1064005181 10:11693680-11693702 CAGGAGGAACAGCTGGTGTGAGG - Intergenic
1065971847 10:30812012-30812034 ACCGGGGAGCAGAAGGTGGGGGG - Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1068022340 10:51601001-51601023 GAGGGGGAAAAGAAGAAGGGAGG + Intronic
1070352963 10:75611087-75611109 CAGGGGGAGCACAGGGTGAGAGG + Intronic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1070911569 10:80123434-80123456 CTGGGGGAAGAGAGTGTGGGAGG + Intergenic
1070953376 10:80448555-80448577 GAGTGGGAAGGGAAGGTGGGAGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072069149 10:91899794-91899816 CAGGGGGAAATGAATGTAGGGGG - Intergenic
1072069278 10:91900811-91900833 AAGGGGAAACAGAAGGTCGGAGG + Intergenic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1072803892 10:98412083-98412105 CATGGGGAACAGAGGGTGCCAGG + Intronic
1073257117 10:102159912-102159934 GTGGGGGAGCAGAAGGCGGGGGG - Exonic
1073912597 10:108363782-108363804 CAGCAGGAACAGCAGCTGGGGGG + Intergenic
1074189305 10:111122321-111122343 AAAGGAGATCAGAAGGTGGGAGG - Intergenic
1074423257 10:113328057-113328079 AAGGGGGAGAGGAAGGTGGGAGG - Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075714429 10:124547960-124547982 CAGGGGCATCAGGCGGTGGGCGG - Intronic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1076178777 10:128389420-128389442 CAGAGGGAAGAGAAGGTGCGAGG + Intergenic
1076209785 10:128631167-128631189 CACGGGGTATAGGAGGTGGGTGG - Intergenic
1076526709 10:131116735-131116757 CCGGGGGAACAGCAGCTGAGTGG - Intronic
1076744809 10:132507533-132507555 CAGGTGGGTCAGCAGGTGGGAGG - Intergenic
1076751741 10:132546776-132546798 CAGGGAGAACAGTGGCTGGGCGG - Intronic
1076778112 10:132709316-132709338 GAGGGGGAAAAGAAGGAGGTGGG + Intronic
1077211264 11:1371914-1371936 CAAGGGGAAGGGATGGTGGGGGG + Intergenic
1077226272 11:1440294-1440316 TGGGGGGAACAGGAGGTGTGAGG - Intronic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1077453552 11:2664761-2664783 CAGGGGGCAGAGTGGGTGGGAGG + Intronic
1077945210 11:6889880-6889902 GTGGGGGATCAGAAGGTGGGTGG + Intergenic
1079407545 11:20159306-20159328 GAGGGGGGACAGAAGGAGAGAGG + Intronic
1079459820 11:20669678-20669700 CAGGGGGCACCGAAGCTAGGTGG - Exonic
1079637474 11:22762010-22762032 CTGGGGGATAAAAAGGTGGGAGG - Intronic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1082097040 11:48139386-48139408 CCTGGGGATGAGAAGGTGGGTGG - Intronic
1082116761 11:48337447-48337469 CAGCTGGAACAGATGGTGGCTGG - Intergenic
1082257036 11:50042863-50042885 CAGCTGGAACAGATGGTGGCTGG + Intergenic
1083164206 11:60873582-60873604 CAGGAGGCAGAGCAGGTGGGGGG - Intronic
1083256466 11:61499044-61499066 CAGGGGCTACAGATGCTGGGAGG + Intergenic
1083939029 11:65885257-65885279 CAGGGGGGAAATAAGGTGGTGGG - Intronic
1084236044 11:67788528-67788550 CAGGGGGAACAGATGTGGGCAGG + Intergenic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1085464521 11:76714888-76714910 TAGAGGGCGCAGAAGGTGGGTGG - Intergenic
1085917179 11:80903604-80903626 GGGGAGGAACAGGAGGTGGGTGG - Intergenic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1089387844 11:118079680-118079702 CACGGAAAACAGGAGGTGGGAGG - Intronic
1089526839 11:119102510-119102532 CAGCTGGGGCAGAAGGTGGGTGG - Intronic
1090082408 11:123622859-123622881 GGTGGGGAACAGAGGGTGGGAGG - Intronic
1090407080 11:126482794-126482816 CAGTTGGCACAGAATGTGGGGGG - Intronic
1090834719 11:130446013-130446035 CAGGGGGAGCACTAAGTGGGAGG + Intergenic
1090923059 11:131224154-131224176 CAGGGGCAGCTGAAGCTGGGAGG + Intergenic
1091011527 11:132005754-132005776 CAGGTGAAACAGAAAATGGGAGG - Intronic
1091374582 12:17340-17362 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091777619 12:3194858-3194880 CAGGGGGCCCACATGGTGGGGGG - Intronic
1091949596 12:4581766-4581788 GAGGAGGAAAAGAAGGTGAGAGG - Intronic
1091988769 12:4937456-4937478 CAGTGGGAACAGCATGTGGTGGG + Intergenic
1092888848 12:12950181-12950203 CAGGAGGAAGAGGAGCTGGGTGG + Exonic
1093061641 12:14613573-14613595 GAAGGGGAAAAGAAGCTGGGAGG + Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1096072351 12:48782412-48782434 GAGGAGGAGCAGGAGGTGGGAGG - Intronic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096833246 12:54330955-54330977 CAGGAGGGACAGAATGTGAGAGG - Intronic
1096910273 12:54976539-54976561 AAGGAGGAAAAGAAGGAGGGAGG + Intronic
1097246424 12:57610160-57610182 GAGGGGGCACTGAAGCTGGGGGG - Exonic
1097264852 12:57738821-57738843 AAGAGGGAACGGGAGGTGGGTGG + Intronic
1097861379 12:64521894-64521916 CAGAGGGTTCTGAAGGTGGGAGG - Intergenic
1097960138 12:65524244-65524266 CAGAGGGAACAGCAGGGGTGAGG + Intergenic
1098270014 12:68761044-68761066 CAGAGGCAACAGCAGGTGCGAGG + Intronic
1098435239 12:70461512-70461534 CAGGGGGAAGAGAGGGAGTGGGG - Intergenic
1100177453 12:92047262-92047284 CAGTAGGAACAGAAGGTTGCTGG - Intronic
1100334649 12:93618106-93618128 CAGGCGGAAGAGAGAGTGGGAGG - Intergenic
1100369704 12:93956734-93956756 CAGGAGGAAGAGAGAGTGGGAGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101076959 12:101140301-101140323 CAGGGGGAAGGAAAGGTGGGTGG - Intergenic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102504498 12:113375028-113375050 CTGGGGGATGAGCAGGTGGGTGG + Intronic
1102583205 12:113905059-113905081 CAGGGGGACTAGCAGGTGTGAGG - Intronic
1103405961 12:120675451-120675473 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1103901736 12:124306997-124307019 CACGGGGGACAGCAGGTGGTGGG - Intronic
1103952829 12:124560730-124560752 CTCGGGGAACAGAAACTGGGAGG + Intronic
1104655375 12:130570533-130570555 CAGGAGCAACAGAAGGTGACAGG + Intronic
1105294384 13:19075300-19075322 CAGAGGGAACAGAAGTTAGCTGG + Intergenic
1105476786 13:20735077-20735099 CAAGCGGAACAGCAGATGGGTGG + Intronic
1105777887 13:23679999-23680021 GAGGGGGCACAGAAGCTGGGAGG + Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106032817 13:26018048-26018070 CAGGAGGAAGAGACAGTGGGCGG - Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107574462 13:41702825-41702847 CAGCAGGAACAGAAGTTGAGGGG - Intronic
1107986397 13:45780228-45780250 CAGGGGGCCCAGGAAGTGGGTGG - Exonic
1108298003 13:49044442-49044464 CAGGTGGATCACAAGGTGAGGGG + Intronic
1108436575 13:50406776-50406798 GAGGGGGGAAAGAAGGAGGGAGG - Intronic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1109247080 13:59967864-59967886 CAGGGGGAACACAAAGAGTGGGG - Intronic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1110441369 13:75529572-75529594 AAGGAGGAATAAAAGGTGGGGGG - Intronic
1110737234 13:78951372-78951394 GAGGGTGAGCAGAAGTTGGGTGG - Intergenic
1112205161 13:97317074-97317096 CAGTGGGAACGGAAGGTGGCAGG + Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1113245233 13:108388010-108388032 CAAGGGGAACGGAAGGTTGATGG - Intergenic
1113339633 13:109409483-109409505 CAGGAGAAAAAGAAGGTTGGTGG + Intergenic
1113414465 13:110117562-110117584 CAGGAGGTTCAGAAGGCGGGAGG + Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114532042 14:23402456-23402478 CAGACGGCACCGAAGGTGGGAGG - Exonic
1114537078 14:23429767-23429789 CAGACGGCACTGAAGGTGGGAGG - Exonic
1114643411 14:24240056-24240078 CAGGGGGAAGGAAAGGTGAGTGG - Exonic
1114684277 14:24513401-24513423 CAGGGGGGAAAAAAGGTTGGGGG - Intergenic
1114842059 14:26275840-26275862 CAACAGGAACAGAAGGAGGGAGG + Intergenic
1115308659 14:31957537-31957559 CAAGGGGCACCGAAGGTGAGTGG - Intergenic
1115313850 14:32006244-32006266 CATGGGGAAAGAAAGGTGGGAGG - Intergenic
1115359894 14:32488807-32488829 CAAGGGGAGCAGAAGCAGGGTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116970365 14:51058555-51058577 CAGTGGGAACAGATGACGGGAGG - Intronic
1117778235 14:59204359-59204381 CATGTGGAACAGAATGTGGGTGG - Intronic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119329617 14:73784391-73784413 CATTGGGAACTGAAGGTGAGGGG + Intronic
1121439891 14:93941973-93941995 GAGGTTGGACAGAAGGTGGGTGG + Intronic
1121701397 14:95957033-95957055 CAGGGAGCACAAAAGGTGTGGGG - Intergenic
1122322229 14:100862004-100862026 GAGGAAGAAGAGAAGGTGGGAGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1123018053 14:105384853-105384875 CAGGGGGAGGAGGCGGTGGGGGG - Intronic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123161542 14:106282949-106282971 GAGGGGGCACAGAAGAGGGGAGG - Intergenic
1124240604 15:28024753-28024775 CAGGGGGAACCTGAGGTGTGGGG - Intronic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1124827524 15:33113663-33113685 GAGAAGTAACAGAAGGTGGGTGG - Intronic
1124871875 15:33551915-33551937 GAGTGGGAGCTGAAGGTGGGCGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1127029567 15:54846991-54847013 CAGGTGGATCAGAAGGTCAGGGG - Intergenic
1127559786 15:60124596-60124618 CAGTGGGGACAGCAGGTTGGTGG + Intergenic
1127767730 15:62203898-62203920 AAGGGGGAAGAGAAGGAGAGGGG - Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128072916 15:64808359-64808381 CAAGGCTCACAGAAGGTGGGTGG - Intergenic
1128567346 15:68710240-68710262 CAGGGGGAACTGCATCTGGGAGG - Intronic
1129684026 15:77674606-77674628 CAGAGGGAACAGCAGGTCTGAGG - Intronic
1130062481 15:80579853-80579875 GAAGGTGAACTGAAGGTGGGAGG + Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131622036 15:94078573-94078595 CAGGAGCAAGAGAACGTGGGGGG - Intergenic
1132452013 15:101973713-101973735 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1132454882 16:16908-16930 CAGCTGGAACAGCAGGTGGGAGG - Exonic
1132539888 16:503891-503913 AAGGGGTCACAGAAGGTGAGGGG - Intronic
1132539947 16:504088-504110 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132539985 16:504203-504225 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132540036 16:504358-504380 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132540065 16:504453-504475 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132540101 16:504568-504590 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132540177 16:504803-504825 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132540194 16:504856-504878 GAGGGGGTACAGGAGGTGAGGGG - Intronic
1132574622 16:658738-658760 CAGGGAGAGCAGAAGGTGAGGGG + Intronic
1133357418 16:5146910-5146932 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1133712229 16:8412319-8412341 TAGGGGGAAGAGTAGGAGGGAGG + Intergenic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134202510 16:12210618-12210640 CAGGGGGACCAGAAAGGTGGTGG - Intronic
1134609079 16:15593411-15593433 CAATGGGGACAGCAGGTGGGTGG + Intronic
1134629271 16:15745244-15745266 AGGGGGGAAGAGAAGGTGCGGGG + Intronic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135113989 16:19710665-19710687 CTGGGGGAACGGAACGTGGGAGG + Intronic
1135637934 16:24094938-24094960 AAGGAGGGACAGAAGGAGGGAGG + Intronic
1136247182 16:28982834-28982856 CTGGGGGAAGAGAGGGTCGGGGG - Intronic
1136249326 16:28993580-28993602 CAGGTGGAGAAGATGGTGGGAGG + Intergenic
1136399508 16:30010046-30010068 CAGGGGGACCAGATGGGCGGGGG + Exonic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1137672371 16:50286542-50286564 CAATGGGAAGGGAAGGTGGGGGG - Intronic
1137850788 16:51740337-51740359 CAAGGGGAACACAAAGTGGAAGG - Intergenic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140228712 16:73099764-73099786 CAGGAGGAACAGACGTGGGGTGG + Intergenic
1140914711 16:79483189-79483211 AAGGAGGGACAGAAGGAGGGAGG - Intergenic
1141032198 16:80598787-80598809 CAGGGGGAGCATGAGGTTGGTGG + Exonic
1141517184 16:84553352-84553374 CTGGGGCAACAGAAGATTGGGGG - Intronic
1142184390 16:88687447-88687469 CCGGGGGTGGAGAAGGTGGGGGG + Intergenic
1142246547 16:88972802-88972824 AAGGGGGGACAGGAGGCGGGAGG + Intronic
1142320885 16:89382159-89382181 CAGGGGAAAGAGGAGATGGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143593998 17:7903246-7903268 CAGGGGCAAGAGAAAGTGGCGGG - Intronic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1145840431 17:27989697-27989719 CAGGGAGAACAGAAGGCAAGTGG - Intergenic
1146546675 17:33745165-33745187 CAGGCGGAACTGGGGGTGGGAGG - Intronic
1146547025 17:33748661-33748683 CATGTGGCCCAGAAGGTGGGAGG - Intronic
1146565896 17:33912550-33912572 CAAGGGGAAAAGATGGTAGGGGG - Intronic
1147121755 17:38339204-38339226 CAGGAGGAATAGGGGGTGGGGGG + Intronic
1147742410 17:42676649-42676671 CAGGGGAAAGATGAGGTGGGAGG + Exonic
1149187478 17:54016580-54016602 CAGGGAGAACTGGTGGTGGGCGG + Intergenic
1149305555 17:55343431-55343453 CAGGGCTAATAGAAGGTGTGGGG + Intergenic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1150639376 17:66939261-66939283 CTGGGGGAGCACAAGTTGGGGGG + Intergenic
1150884543 17:69070438-69070460 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1151144337 17:72026966-72026988 AAGGGGAAAAAGAGGGTGGGGGG + Intergenic
1151185464 17:72360861-72360883 AGGGGGGAACAGAAGCTCGGGGG - Intergenic
1151378313 17:73707147-73707169 CTGGGGGAGGAGAAGGTTGGCGG - Intergenic
1152229088 17:79105791-79105813 CAGGCGGAAGAGAAGTTTGGAGG + Intronic
1152361592 17:79835497-79835519 CATGGGGGGCAGGAGGTGGGAGG + Intronic
1152641667 17:81451960-81451982 CAGGGGGCACACCTGGTGGGGGG - Exonic
1152865022 17:82717145-82717167 CACGGAGAACAGGAGGTGTGGGG - Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1153942781 18:9991827-9991849 CAGGGGGAGCCGCAGGTGTGCGG - Intergenic
1154412209 18:14147520-14147542 AAGGAGGAACGGAAGGAGGGAGG + Intergenic
1155232231 18:23784677-23784699 AAGGGGGGATGGAAGGTGGGAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156582282 18:38392416-38392438 GAGGGTGAGCAGAAGCTGGGTGG + Intergenic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1157718727 18:49907159-49907181 CTGGGGGAACTGAAGGTGATTGG + Intronic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158585341 18:58728358-58728380 CAGTGGGAAGCTAAGGTGGGAGG + Intronic
1159129987 18:64270495-64270517 GTTTGGGAACAGAAGGTGGGAGG - Intergenic
1159218648 18:65429657-65429679 CAGGGGGAAGAGAGAGTGAGGGG - Intergenic
1159333383 18:67030844-67030866 CAGGAGCAACAGAAAGTGGGAGG - Intergenic
1160318199 18:77867313-77867335 CAGGTGGAGAGGAAGGTGGGTGG - Intergenic
1160348457 18:78153693-78153715 CAAGGGGAAAAGCAGCTGGGAGG - Intergenic
1160424258 18:78769464-78769486 CAGGGGGACCTGGATGTGGGTGG - Intergenic
1160570972 18:79817714-79817736 GAGGGGCAGCTGAAGGTGGGAGG - Intergenic
1160709575 19:544849-544871 AAGGGGGAACGAAAGGAGGGAGG - Intronic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1160777104 19:861442-861464 CAGGGGGAGCGGGGGGTGGGGGG - Intronic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161273145 19:3401308-3401330 CAGGGAGGACAGACTGTGGGGGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161541016 19:4851640-4851662 AAGGGGGAAGAGGAGGAGGGCGG + Intronic
1161688008 19:5713126-5713148 CATGGGACACAGAAGGTGGGTGG - Exonic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1162082237 19:8225104-8225126 CAGGGAGAGCAGATGGTGTGAGG + Intronic
1162133798 19:8543434-8543456 AATTGGGATCAGAAGGTGGGGGG + Intronic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1162932453 19:13963746-13963768 CCTGGGGCACAGAGGGTGGGCGG + Exonic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1163760541 19:19133996-19134018 CTGGGGGAAGCCAAGGTGGGAGG - Intronic
1164587067 19:29482614-29482636 CAGGGGGAAAAGAAGGGAGTTGG - Intergenic
1164827767 19:31297015-31297037 CAGTGGGAGCGGGAGGTGGGAGG + Intronic
1164843587 19:31413080-31413102 CATGGAGAGCAGTAGGTGGGTGG - Intergenic
1165194990 19:34095135-34095157 CAGGAGGTCCAGACGGTGGGGGG - Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1165639173 19:37369873-37369895 CAGTGGGAACAGAAGGGGACTGG - Intergenic
1165914339 19:39248398-39248420 CAGGGGGCACAGGGGCTGGGCGG + Intergenic
1166155432 19:40908349-40908371 CAGGGGGAAAGGAAGGGGCGAGG - Intergenic
1166190900 19:41175925-41175947 CAGGGGGAGTAGAAGAGGGGTGG - Intergenic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166830894 19:45639179-45639201 CTGGGGGAACTGCGGGTGGGGGG - Intronic
1167112035 19:47468260-47468282 AAGGGGGAACAGCAGGTGCCAGG - Intronic
1167161666 19:47771742-47771764 GAGGGGGCACAGAATGTTGGGGG + Intergenic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
924998496 2:385445-385467 CAGGGGGGACGGAGGGTGGTAGG - Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925121294 2:1420729-1420751 CAGGAGGGACAGAAGGATGGTGG + Intronic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
925484581 2:4313653-4313675 TAGGGGGAGCAGAAGCAGGGTGG - Intergenic
925534336 2:4900501-4900523 CAGGGGCAGCAGAAGCTGGTGGG - Intergenic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
925718495 2:6806740-6806762 CAGTGGGGACAGAGGATGGGAGG + Intergenic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
928063538 2:28139198-28139220 CAGGGGGATCACTAGCTGGGAGG + Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928331978 2:30364629-30364651 TAGGGGGAAGAGAAGAGGGGAGG + Intergenic
928410251 2:31048949-31048971 GAGGTGGAACTGAAGGTTGGAGG - Intronic
929005678 2:37390656-37390678 CAGGGGAAACTCCAGGTGGGAGG + Intergenic
929309046 2:40400668-40400690 CAGAGGGAAAATGAGGTGGGAGG + Intronic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929615242 2:43301554-43301576 TAGGTGGAACAGAAGGTTGGAGG + Intronic
930820524 2:55642065-55642087 CAGGTGGATCAGGAAGTGGGGGG - Intronic
931651626 2:64473674-64473696 CAGGGGGATGAGGAGGTTGGTGG - Intergenic
931683075 2:64768718-64768740 AAGGAGGAAAAGAAGGAGGGAGG - Intergenic
932570957 2:72938187-72938209 CAGGGGGAAGAGAGGCTTGGAGG - Intergenic
932764875 2:74463163-74463185 CTGGGGGAAAAGAATGTTGGGGG - Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933601346 2:84334555-84334577 CAGGGGAAAGAGTTGGTGGGGGG + Intergenic
933897129 2:86821831-86821853 CAGGGGGAAGAGAAGGGTGGAGG - Intronic
933946395 2:87289592-87289614 CACGTGGAACAGCAGGTGGAGGG - Intergenic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
936076523 2:109405007-109405029 GTAGGGGAAGAGAAGGTGGGGGG - Intronic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936333800 2:111571949-111571971 CACGTGGAACAGCAGGTGGAGGG + Intergenic
936568228 2:113596189-113596211 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937027450 2:118711265-118711287 CAGGGAGAAGAGGAGGTTGGTGG - Intergenic
937243227 2:120475861-120475883 CGTGGGGAACAGAAAGAGGGAGG + Intergenic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938502240 2:131836159-131836181 CAGGGGGCACAGAGGATGGTGGG + Intergenic
940287291 2:152044949-152044971 GATGGGGAAGAGACGGTGGGGGG + Intronic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941873539 2:170410336-170410358 CAGGCGGATCACAAGGTGGGTGG + Intronic
942534121 2:176945531-176945553 AAGGGGGAACAGCCTGTGGGTGG - Intergenic
943470719 2:188291679-188291701 CACGCGGAACCGGAGGTGGGTGG - Intronic
943665838 2:190607301-190607323 CAGGGGCAACAGCAAGTGGGTGG + Intergenic
944375963 2:199042421-199042443 CAGGGAGAACCGAAGGTGTGGGG - Intergenic
944828576 2:203509860-203509882 CAGGGGCAAGAGTAGGGGGGAGG - Intronic
946061122 2:216942417-216942439 CAGGGGCAGCAGAAGGCCGGGGG - Intergenic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946537650 2:220648642-220648664 CAGGTGGAATAGATGGTGAGAGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947752787 2:232541450-232541472 CAGGCGGAACGGAAGATGGCAGG - Exonic
1169346830 20:4835455-4835477 TGGGTGGAACAGAAGGTGGGAGG + Intergenic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1171878971 20:30602730-30602752 CAGAGGGAACAGAAGCTAGCTGG + Intergenic
1172034656 20:32002376-32002398 GAGGGGGTACAGAAGGTGCCAGG + Exonic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172973117 20:38887981-38888003 CAGGGGAAAAAGAAGCTGGTAGG - Intronic
1173066097 20:39713600-39713622 CTGGTGGAACAGAAGGTTAGTGG + Intergenic
1173328885 20:42057820-42057842 CAGGGGGAGGCCAAGGTGGGAGG - Intergenic
1173338538 20:42133761-42133783 TAGGGGAAACAGTATGTGGGTGG + Intronic
1173617660 20:44413596-44413618 GAGTGGGAGCAGGAGGTGGGGGG - Intronic
1173681452 20:44885459-44885481 GAGCGGGAAAAGGAGGTGGGAGG - Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174251872 20:49225982-49226004 CAGAGGGAACAGAAAGTGCAAGG - Intronic
1175120122 20:56710701-56710723 AAGGGGGAAGAGAAGCCGGGAGG - Intergenic
1175531105 20:59674707-59674729 GAGGGGGAACAGGAGAAGGGGGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175937840 20:62523111-62523133 CAGGGGGCATAGACGGTGTGGGG - Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1178221688 21:30668068-30668090 CATGGGGAAAAGCCGGTGGGAGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179249983 21:39664445-39664467 CAGAGGGGACAGCAGGTGGTAGG - Exonic
1179921618 21:44510555-44510577 CAGGGGGACCAGAAGATGCCTGG - Intronic
1179932453 21:44579525-44579547 CATGGGGCAGAGAAGCTGGGAGG + Exonic
1179933878 21:44590660-44590682 CAGGGGTAACAGGAGGGGTGAGG + Intronic
1179941017 21:44638880-44638902 CAGGGGTAACAGGAGGGGTGAGG - Intronic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180916859 22:19494817-19494839 CAGGGGGAACATCAGCTGGATGG - Intronic
1180970002 22:19810368-19810390 CAGGGGCAAAAGATGGGGGGAGG + Intronic
1181031468 22:20150406-20150428 CAGGGGTACCAGGCGGTGGGTGG + Intronic
1181052984 22:20246443-20246465 CGGGGGGAGGAGGAGGTGGGAGG + Intronic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1182396622 22:30040892-30040914 TGGGGGGCGCAGAAGGTGGGAGG - Intergenic
1182810945 22:33116185-33116207 CTGCGGGAAAAGAAGGTGGATGG - Intergenic
1183069106 22:35383962-35383984 CAGGTTGAACAGAGGGTGTGGGG + Intronic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183579390 22:38714653-38714675 CAGGGGCAAGGGAAGGGGGGTGG + Intronic
1183617481 22:38954422-38954444 CGGGGGGGACAAAGGGTGGGGGG - Intronic
1183848473 22:40562738-40562760 AAGGGGGAACGGACGGAGGGGGG + Intronic
1184075310 22:42173363-42173385 CAGGGTCAACATCAGGTGGGGGG + Intronic
1184102668 22:42348993-42349015 GTGGGGGAACTGGAGGTGGGAGG + Intergenic
1184254079 22:43277110-43277132 CTGGGGGATCAGGAGGTGTGCGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184543750 22:45150856-45150878 CAGCGGGCATAGAAGGTGTGAGG + Intergenic
1184879812 22:47297625-47297647 CAGAGGGAACAGACAGTGTGGGG + Intergenic
1185264881 22:49896030-49896052 CACTGGGAAGAGATGGTGGGCGG - Intergenic
949496519 3:4637410-4637432 TAGGGAGAACAAGAGGTGGGAGG + Intronic
949507166 3:4738934-4738956 CAGGGGTCACAGAAGCGGGGAGG - Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951026975 3:17840851-17840873 CAGGTGGAGCAGAGGGTGTGAGG + Intronic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
951790991 3:26484649-26484671 CAGTGGGAACCAAAGGTAGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952089251 3:29864860-29864882 GAAGGGGAAGAGAAGGAGGGAGG + Intronic
953069125 3:39502411-39502433 CAGGGAGACTGGAAGGTGGGTGG + Intronic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
953717066 3:45324646-45324668 CATGAGGCACAGAGGGTGGGTGG - Intergenic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954401482 3:50321802-50321824 CAGGGGGACGGGAAGGGGGGGGG + Exonic
954798206 3:53172210-53172232 CAAGAGGAACAGGAGGTGGGAGG - Intronic
956355635 3:68389707-68389729 GAGGGTGAGCAGAAGCTGGGTGG + Intronic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956781306 3:72605524-72605546 GAGGTGGAACAGAAGGGGAGTGG + Intergenic
957061988 3:75489739-75489761 CAGAGGGAACAGCATGTGTGAGG - Intergenic
957212086 3:77272399-77272421 CAGGAGGAAGAGAAGGGCGGGGG + Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
959539628 3:107524043-107524065 GAGGGGGAAGAGGAGGAGGGAGG + Intronic
959934107 3:112012093-112012115 CAGGAGAAACAGAACCTGGGTGG - Intronic
960626253 3:119685121-119685143 GATGGGGATCAGAAGCTGGGAGG - Intergenic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
960955475 3:123027771-123027793 CCGCGGGAGCAGAAGGAGGGAGG + Intronic
961291415 3:125849662-125849684 CAGAGGGAACAGCATGTGTGAGG + Intergenic
961352935 3:126315553-126315575 CAGGGGGGACAGGAGGAGAGCGG + Intergenic
961366221 3:126401672-126401694 GAGAGGGAGCAGCAGGTGGGAGG + Intronic
961508290 3:127385964-127385986 CAGGGAGCACAGCAGATGGGCGG + Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962174434 3:133138203-133138225 AAAGAGGAACAGAAAGTGGGAGG + Intronic
962366726 3:134791679-134791701 CAGCAGGAAAAGAAGGAGGGAGG - Intronic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
966650172 3:182291798-182291820 CAGTGGGAAGAGAAAGTGGCAGG - Intergenic
967246985 3:187497833-187497855 CAGAGGGAACAGAAAGGGGTAGG - Intergenic
967472509 3:189878852-189878874 CAGGGGGATCACAAGGTCAGGGG - Intronic
967512108 3:190323738-190323760 CAGGTGGAAATGAAGGTGGTGGG - Intronic
967876213 3:194270037-194270059 CTGGGGGAACTGGATGTGGGAGG - Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
969005882 4:4019830-4019852 CAGAGGGAACAGCATGTGTGAGG - Intergenic
969086000 4:4656901-4656923 CAGGAGGAACGGCAAGTGGGAGG - Intergenic
969296478 4:6273132-6273154 CAGAGAGAACAGAATGGGGGTGG + Intronic
969486949 4:7477650-7477672 GAGGGGGCACAGAAGGCGGGAGG + Intronic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
969807067 4:9617460-9617482 CAGAGGGAACAGCATGTGTGAGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970029374 4:11658188-11658210 AAGGAGGAACGGAAGGTGGAAGG + Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
971035875 4:22692428-22692450 AAGGTGGAAGAGAAGGAGGGAGG + Intergenic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973551063 4:52036747-52036769 CAGGGGGAAAAGAAAATGTGGGG + Intronic
973697723 4:53507216-53507238 GAGGGGTCACAGAAGGTGGAAGG + Intronic
973899841 4:55457644-55457666 GAGGGGGAAGAGATAGTGGGAGG - Intronic
974474416 4:62361424-62361446 GGGGAGGAACAGATGGTGGGTGG + Intergenic
975292153 4:72689406-72689428 CAGTGGGAAAAGAAGGGGGCAGG + Intergenic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
975574561 4:75849790-75849812 GAGGGGAAACAGAATGTGAGAGG + Intergenic
976080708 4:81351750-81351772 CTGGGGCTACAGCAGGTGGGAGG - Intergenic
976669173 4:87632936-87632958 GAAGGGGAACAGGTGGTGGGGGG + Intergenic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
978127109 4:105147495-105147517 AAGGGGGATAAGAAGGTAGGAGG - Intronic
978327418 4:107575166-107575188 ATGGGGGACCAGAAGGTGTGTGG - Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978965391 4:114734729-114734751 CAGTGGGAACAGATGGTGGGAGG + Intergenic
981080430 4:140634462-140634484 AAGGGGGAAGAGAATGTGGTGGG - Intronic
981884316 4:149654440-149654462 CAGGGGCAACAGAGAGTGGTGGG - Intergenic
982205853 4:152996604-152996626 CTGTGGGAACAGAAATTGGGGGG + Intergenic
982298262 4:153852417-153852439 AAGGGGTGACAGCAGGTGGGAGG + Intergenic
983195059 4:164797888-164797910 TAGGGACAACAAAAGGTGGGAGG - Intergenic
986202996 5:5596251-5596273 CAGGAGGAAGAGAGGGTGAGGGG - Intergenic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
988547847 5:32174516-32174538 AACGGGGAACGGAAGGAGGGAGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
991952901 5:71964046-71964068 CAGGGGTTACAGATGATGGGGGG + Intergenic
992218642 5:74549745-74549767 CAGGTGGGACAGAAAGGGGGCGG - Intergenic
992295589 5:75323466-75323488 CAGGGGGAGGCCAAGGTGGGAGG + Intergenic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
994051488 5:95367156-95367178 GGTGGGGGACAGAAGGTGGGTGG - Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996747578 5:126858388-126858410 CGGGGGCTACAGAAGGTGCGGGG + Intergenic
997896795 5:137726021-137726043 AGTGGGGAACAGCAGGTGGGAGG - Intronic
999090446 5:148931658-148931680 AAGGAGGAAGAGAAGGAGGGAGG - Intronic
999297147 5:150466841-150466863 CAGGAGGAAAAGAAGGCAGGAGG - Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1001230084 5:169979148-169979170 CATGGGGAACAGAGGGGTGGAGG - Intronic
1002025738 5:176395188-176395210 GGGTGGGAAGAGAAGGTGGGAGG - Intronic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002401150 5:178992165-178992187 GACGGGGCACAGAAGGTGTGTGG + Intronic
1003567596 6:7233808-7233830 GAGGTGGAACAGCAGGAGGGAGG + Intronic
1004135725 6:12964439-12964461 AATGGGGAACAGAAAGAGGGAGG + Intronic
1004554193 6:16679444-16679466 AAGGGGGGACAGAAGTAGGGAGG + Intronic
1004657628 6:17679656-17679678 GAGAGAGAACAGGAGGTGGGAGG + Intronic
1005189988 6:23210448-23210470 CAGGGGGAAAGGTAGGTGGGAGG - Intergenic
1005218885 6:23563437-23563459 CACAGGGAACAGAAGGTAAGAGG - Intergenic
1005845443 6:29773377-29773399 GAAGGGGAAGAGAAGGAGGGAGG - Intergenic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1006338154 6:33431686-33431708 CAGGGGTTCCAGGAGGTGGGGGG + Intronic
1006338934 6:33435341-33435363 CAGGGGTGATGGAAGGTGGGGGG + Intronic
1006597113 6:35201607-35201629 CAGGGGGAAGTGAAGATAGGGGG + Intergenic
1006822306 6:36907045-36907067 AAGGAGGAAAAGAAGGAGGGAGG - Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007202293 6:40120040-40120062 CAAGAGGAACAAAAGTTGGGTGG - Intergenic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1007350810 6:41272275-41272297 CAGTGGGGACATCAGGTGGGTGG - Intronic
1007559022 6:42790528-42790550 AAAGGGGAAAAGAAGGTGGGGGG - Intronic
1008246316 6:49178344-49178366 CAGGAGGAAGAGAGGGTGAGGGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009885078 6:69616059-69616081 CTTGGGAAACAGAAGCTGGGAGG - Intergenic
1010116365 6:72316788-72316810 CACTGGGGACAGTAGGTGGGTGG + Intronic
1010179799 6:73073112-73073134 GAGGAGGAACAGAAAGGGGGAGG - Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1011494443 6:87924778-87924800 CTGGGAGAATAAAAGGTGGGTGG + Intergenic
1012213215 6:96550329-96550351 GAGGAGGTAGAGAAGGTGGGAGG - Intronic
1012225105 6:96694524-96694546 GGGGAGGAACAGATGGTGGGTGG - Intergenic
1012867983 6:104641023-104641045 CAGGAGCAAGAGAGGGTGGGAGG - Intergenic
1012935498 6:105363587-105363609 CAGGAGGGACTGAATGTGGGAGG + Intronic
1013178120 6:107694515-107694537 CAGGAGCAAGAGAGGGTGGGAGG + Intergenic
1013821366 6:114157082-114157104 CAGAAGGAAGAGAAGGTGAGGGG - Intronic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1016372673 6:143391300-143391322 CAGGGGGAACATGAGCTGGTGGG - Intergenic
1016387647 6:143544042-143544064 AAAGGGGAACAGAAGATAGGAGG - Intronic
1016429569 6:143968694-143968716 GAGGGGGAAAATAAGGTTGGGGG - Intronic
1016848001 6:148588030-148588052 AAGGGGGAACAGCAGATTGGTGG - Intergenic
1016896017 6:149053981-149054003 CAGGGGTGACAGATGGTGGCAGG - Intronic
1018180434 6:161218228-161218250 CAGGGGAGGCAGTAGGTGGGAGG + Intronic
1018211971 6:161490893-161490915 CAGGGGGAAGAGAGAGAGGGAGG - Intronic
1018368322 6:163144948-163144970 GATGGGGAAAAGAGGGTGGGAGG - Intronic
1018484611 6:164228192-164228214 CATGGGAACCGGAAGGTGGGAGG + Intergenic
1018630793 6:165820596-165820618 CAGGAGGACCAGACGCTGGGGGG - Intronic
1018805715 6:167258152-167258174 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1018859748 6:167703022-167703044 CAGTGGGACCAGATGTTGGGGGG - Intergenic
1019420056 7:946563-946585 CAGGAGGGAGAGAGGGTGGGAGG - Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019517498 7:1446370-1446392 GAGGAGGAAGAGAAGGGGGGAGG + Intronic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019905278 7:4057556-4057578 CAGGGGGCCAAGCAGGTGGGTGG - Intronic
1021028173 7:15695319-15695341 CAGGGGGAAAAAGAGGTGGAGGG + Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1021936545 7:25637239-25637261 GGGGTGGAAGAGAAGGTGGGTGG + Intergenic
1022094682 7:27131080-27131102 CAGCGGGAACCAAAGCTGGGGGG - Intronic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1022466102 7:30654049-30654071 CAGGAGGTAGAGAAGGTGGAGGG - Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1024290955 7:47803639-47803661 CAGGGAGAACAGACGTGGGGTGG - Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026057276 7:66995613-66995635 CAGGTGGAGCAGAAGCCGGGAGG + Intronic
1026720838 7:72829438-72829460 CAGGTGGAGCAGAAGCCGGGAGG - Intergenic
1026742941 7:72990331-72990353 CTGGGAGCCCAGAAGGTGGGGGG + Intergenic
1027100794 7:75374747-75374769 CTGGGAGCCCAGAAGGTGGGGGG - Intergenic
1027267480 7:76502410-76502432 CAGGAGGCACAGCAGGTGGAAGG - Exonic
1027319295 7:77002275-77002297 CAGGAGGCACAGCAGGTGGAAGG - Intergenic
1028752228 7:94394408-94394430 GAGGGGGCAGAGAAGGAGGGAGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029450111 7:100636749-100636771 GAGAGGGAAGAGAAAGTGGGGGG - Intronic
1029645858 7:101855335-101855357 CAGGGGGACCATGAGGTGAGGGG + Intronic
1029714578 7:102318938-102318960 ATGGGGGAACAAAGGGTGGGTGG + Intronic
1030593447 7:111508544-111508566 GAGAGGGCACAGAGGGTGGGAGG + Intronic
1030680735 7:112431012-112431034 CATGAAGAAAAGAAGGTGGGAGG - Intronic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031517403 7:122718323-122718345 AAGGGGGAAGAGGATGTGGGAGG + Intronic
1032168602 7:129565562-129565584 CAGGGGGATCACAAGGTCAGGGG - Intergenic
1032509378 7:132459924-132459946 CATGGGGAAGAGAAGGGGCGGGG - Intronic
1032517941 7:132520799-132520821 CTGTGGGGCCAGAAGGTGGGTGG - Intronic
1033128615 7:138726377-138726399 AAGGGGAAACAGAACGTGGGGGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034982901 7:155489945-155489967 CAGGTGGAAGGGCAGGTGGGAGG + Intronic
1035601143 8:897628-897650 CAGAGGGAACAGAAGATGCAGGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1037421811 8:18710388-18710410 CAGGGGGAACAGAACCAGGTTGG + Intronic
1037519542 8:19666587-19666609 CAGGAGGGAGAGGAGGTGGGCGG + Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038356269 8:26832045-26832067 GAGGGGGAAGAGAAGGCTGGTGG - Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039446638 8:37638412-37638434 GGGGGGGAAAAGAAGGTAGGGGG + Intergenic
1039461449 8:37748845-37748867 CAGCTGGAAAGGAAGGTGGGGGG + Intronic
1039501240 8:38019168-38019190 AAAGGGGAAAAGCAGGTGGGTGG - Intergenic
1039826207 8:41175933-41175955 CATGGGGGAAACAAGGTGGGAGG + Intergenic
1040892752 8:52334903-52334925 CGGTGGTGACAGAAGGTGGGTGG - Intronic
1041748491 8:61234200-61234222 CAGGGGGTAGAGAATGAGGGTGG + Intronic
1041962039 8:63629148-63629170 CATGGAGAACAGAAAGCGGGGGG + Intergenic
1042054883 8:64754132-64754154 CAGAGGGGACAGAGGGTGTGAGG + Intronic
1043372888 8:79613161-79613183 CATAGAGAACAGAGGGTGGGCGG - Intronic
1045016971 8:98008688-98008710 CAGGGGGTGCAGAAAGAGGGTGG + Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045886857 8:107108519-107108541 CAGGAGTAACAGAAATTGGGAGG + Intergenic
1046094404 8:109540052-109540074 AAGGGCGAAAGGAAGGTGGGAGG - Intronic
1047208939 8:122825258-122825280 AATGGGGCACAGAAGGTGTGGGG - Intronic
1047219680 8:122909607-122909629 CAGGAGGAACAGGTTGTGGGGGG - Intronic
1048335664 8:133500318-133500340 CACGGGGGCCAGAAGGAGGGAGG + Intronic
1048384370 8:133897899-133897921 CAGGAGAAACAGAATGTGTGAGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048988340 8:139747469-139747491 CAGGGGTCAGAGCAGGTGGGAGG + Intronic
1048993711 8:139776000-139776022 CAGAAGCAACAGAAGCTGGGAGG - Intronic
1049108772 8:140629876-140629898 CAGGGGGAAGAGGAGGGGAGGGG + Intronic
1049241422 8:141539267-141539289 CAGCGGGAGCTGAAGGTGGCGGG + Intergenic
1049343915 8:142128456-142128478 CAGAGGCCACAGAAGCTGGGTGG + Intergenic
1049530450 8:143151920-143151942 CAGGGTGGACGGAAGGTGGCGGG - Intergenic
1049791442 8:144474428-144474450 CACTGGGGACAGGAGGTGGGTGG + Exonic
1049884303 9:17336-17358 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051741002 9:20252079-20252101 CAGTTGGAACAGATGTTGGGAGG + Intergenic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1052366967 9:27622913-27622935 CAGGGTGAAGAGAATGGGGGAGG + Intergenic
1052502808 9:29314111-29314133 CGGGAGGAAGAGAAGGAGGGAGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053275536 9:36780572-36780594 CAGGGGGAAAAGCAAGGGGGAGG - Intergenic
1053441613 9:38120939-38120961 GAGGAGGAGGAGAAGGTGGGAGG + Intergenic
1053615514 9:39761633-39761655 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1053873679 9:42520896-42520918 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1054238006 9:62580758-62580780 CAGTGGGAAAAGAAAGTTGGAGG - Intergenic
1054262578 9:62882567-62882589 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1054268653 9:62945860-62945882 CAGTGGGAAAAGAAAGTTGGAGG - Intergenic
1054552137 9:66615268-66615290 CAGTGGGAAAAGAAAGTTGGAGG - Intergenic
1054889045 9:70232355-70232377 TTGGGGGAACAGAAGCAGGGTGG + Intergenic
1055048284 9:71953634-71953656 CAGTGGGAACAAAAGTTGAGAGG - Intronic
1056040322 9:82658998-82659020 CACTGGGAACCCAAGGTGGGTGG - Intergenic
1056485706 9:87055072-87055094 CAGAGAGAAAAGGAGGTGGGAGG + Intergenic
1056740987 9:89255278-89255300 CTGGGGGAATTGGAGGTGGGAGG - Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057265457 9:93614409-93614431 CAGAGGGAACAGAAGCTAGCTGG - Intronic
1057662728 9:97017703-97017725 CACAGGGAACAGTAGATGGGTGG - Intergenic
1057695202 9:97318271-97318293 AAGGAGGGACAGAGGGTGGGTGG - Intronic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1058427533 9:104887968-104887990 CAGTGGGAAGTCAAGGTGGGTGG - Intronic
1058965741 9:110036809-110036831 CATAGGGAACAGCAGGTGTGGGG - Intronic
1059091249 9:111360963-111360985 CATGGGCAACAGAAGGAAGGAGG + Exonic
1059352550 9:113675999-113676021 TTGGGGCAATAGAAGGTGGGAGG - Intergenic
1059553708 9:115256547-115256569 CAGGAGGAAGAGAAGCAGGGAGG + Intronic
1060319804 9:122547527-122547549 CAGGAGGATGGGAAGGTGGGAGG - Intergenic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG + Intergenic
1061373238 9:130209627-130209649 GTTGGGGAAGAGAAGGTGGGAGG + Intronic
1061798174 9:133100560-133100582 CATGGGGAACAGAAGGACGGAGG - Intronic
1062275507 9:135728546-135728568 CCGGGGGAACAGGAAGTGGGAGG + Intronic
1062465406 9:136678599-136678621 CTGGGGGATCAAATGGTGGGGGG - Intronic
1062478170 9:136739795-136739817 CAGGGGCGGCAGGAGGTGGGAGG + Intronic
1062497201 9:136837520-136837542 CAGGGGGCACAGAGGATGGTGGG - Exonic
1062596173 9:137300780-137300802 GAGGGGGAACAGAACGGGGTGGG + Exonic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1187087991 X:16061751-16061773 CAGGGGGAACAGCAGGTACCAGG - Intergenic
1187497973 X:19812729-19812751 CATTGGGAAGACAAGGTGGGCGG + Intronic
1187723669 X:22179347-22179369 TTGGGGGAACAGATGGTGGTTGG + Intronic
1187952431 X:24484255-24484277 CAGTGGGAAGCCAAGGTGGGAGG - Intronic
1188260660 X:28019190-28019212 CAGGAGGAAGAGAAAGAGGGTGG + Intergenic
1189185056 X:39047635-39047657 CAGGGAGGAGAGAAGGTGGTGGG - Intergenic
1189188037 X:39070780-39070802 CAGGAGGAAAAGAAGGTTGGGGG - Intergenic
1189233188 X:39468131-39468153 TATGGGAAACAGAGGGTGGGAGG + Intergenic
1189251794 X:39606073-39606095 CAGGGAGAACAGAACTTGGCTGG + Intergenic
1189276670 X:39791244-39791266 CACGGGGGACAGAATGAGGGTGG + Intergenic
1192177225 X:68893552-68893574 CATGGGGAAAAGGAGGTGGGAGG + Intergenic
1192316561 X:70056292-70056314 AATGGGGAACAGGAGTTGGGAGG + Intergenic
1192985970 X:76398686-76398708 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193086718 X:77453605-77453627 CAGGGGGAACAAACAGTGAGTGG + Intronic
1193750758 X:85340264-85340286 CTAGGGGCACAGAAGGTGGATGG + Intronic
1195675997 X:107507398-107507420 GAGGGGAATCAGAAGCTGGGAGG + Intergenic
1195738988 X:108043069-108043091 CAGGGGGCCGTGAAGGTGGGAGG + Intergenic
1195826146 X:109003513-109003535 GAGGGTGAGCAGAAGCTGGGTGG + Intergenic
1196706831 X:118724275-118724297 CATGGGGGACAGTGGGTGGGTGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197169381 X:123414197-123414219 CAGCAGGATCAAAAGGTGGGAGG + Intronic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1198764359 X:140065571-140065593 TAGGGGGAAGAAGAGGTGGGGGG - Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199880876 X:151973741-151973763 CAGGGCGAGGAGAAGGTGTGAGG + Intronic
1200401502 X:156022820-156022842 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1201438471 Y:13985084-13985106 AGGGAGGAACAGAAGGTGGGTGG - Intergenic
1201446102 Y:14057624-14057646 AGGGAGGAACAGAAGGTGGGTGG + Intergenic