ID: 1175816951

View in Genome Browser
Species Human (GRCh38)
Location 20:61888156-61888178
Sequence GCGGCGGCTCTGCAGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175816951_1175816962 26 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816951_1175816958 -1 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816958 20:61888178-61888200 CCACTGCCGGTACACACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 87
1175816951_1175816961 6 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1175816951_1175816963 30 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816963 20:61888209-61888231 TGAAATGAGACTCCGCAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 97
1175816951_1175816959 0 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816959 20:61888179-61888201 CACTGCCGGTACACACAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175816951 Original CRISPR GCGGCGGCTCTGCAGGGATG TGG (reversed) Intronic
900319223 1:2074305-2074327 GCGGTGGCTGTGGAGGGCTGGGG + Intronic
902326350 1:15703250-15703272 GCGGTGGCTGAGCAGGGATGGGG + Intronic
903788243 1:25875403-25875425 GCGGCGGGGCTGCGGGGCTGCGG - Intergenic
904540406 1:31228947-31228969 CCAGAGGCTCTGCAGGGGTGGGG - Intronic
904724881 1:32539667-32539689 GCGGCGGCAGTGCTGGGATGCGG + Intronic
906236309 1:44213471-44213493 GCCGCGGCTTTGCGGGGACGGGG + Exonic
906639821 1:47435002-47435024 GCTTCTGCTCTGCAGGGTTGGGG - Intergenic
907936483 1:59046639-59046661 GCAGGGTCTCTGCAGGGATCAGG + Intergenic
911165925 1:94724196-94724218 GTGCCGACTCTGCAGGGATGAGG - Intergenic
912698928 1:111861702-111861724 GGGAGGGCTCTGCAGGGAAGAGG + Intronic
913969643 1:143405055-143405077 GGGGTGGCTCTGCTGGGATGTGG - Intergenic
914064017 1:144230648-144230670 GGGGTGGCTCTGCTGGGATGTGG - Intergenic
914115133 1:144735706-144735728 GGGGTGGCTCTGCTGGGATGTGG + Intergenic
915917472 1:159949739-159949761 GAGGCACCACTGCAGGGATGGGG - Intergenic
916179721 1:162072790-162072812 GACACTGCTCTGCAGGGATGTGG - Intronic
918812774 1:189141493-189141515 GCAGTTTCTCTGCAGGGATGAGG - Intergenic
919892122 1:201983045-201983067 TCGGCGGCGCGGCAGGGCTGCGG - Exonic
920173824 1:204087934-204087956 GCTGTGGATCTGCAGGGATGAGG + Intronic
920682365 1:208082906-208082928 GAGGCAGATCTGCAGGGTTGTGG - Intronic
922422969 1:225471760-225471782 GCGGCGGCAGTGCAGGGCGGGGG - Intergenic
922618308 1:226976267-226976289 GCTGCGGGGCTGCAGGGCTGCGG + Intronic
923086000 1:230703977-230703999 GAGGAGGCACAGCAGGGATGGGG + Intronic
1064849781 10:19697703-19697725 GAGGTGGCTCTGCTGGGCTGTGG - Intronic
1067292084 10:44950786-44950808 GCTGGGACTCTGCAGGGTTGTGG + Intergenic
1068879612 10:62034843-62034865 TAGGCAGCTCTGCAGAGATGGGG + Intronic
1070593406 10:77816465-77816487 GCCTGGGCTCTGCAGGGAAGGGG - Intronic
1070800764 10:79243294-79243316 GCGACAGCTCTCCAGGGACGGGG - Intronic
1075069138 10:119309085-119309107 GCACCAGCCCTGCAGGGATGTGG - Intronic
1075271882 10:121059498-121059520 AGGGAGACTCTGCAGGGATGGGG + Intergenic
1075847519 10:125556620-125556642 CTGGCCGCTCTGCAGGGAGGCGG + Intergenic
1076850070 10:133088328-133088350 GCGCCTGCTCTGCCTGGATGTGG - Intronic
1077191303 11:1256932-1256954 GTGGGGGCTCTGCAGGGTTCAGG - Intronic
1077204783 11:1336999-1337021 GCGGGGACCCTGCAGGGCTGTGG + Intergenic
1077547699 11:3182723-3182745 ACAGTGGCTCTGCAGGGCTGTGG + Intergenic
1083640920 11:64144884-64144906 GCAGGGGCCCCGCAGGGATGCGG - Intronic
1084365273 11:68693498-68693520 GCGGCCTCTGTGCAGGGGTGCGG + Intergenic
1085507157 11:77067080-77067102 GCGGCGGCTCGGCCGGTAGGAGG + Exonic
1085784435 11:79438320-79438342 GCTGCGGCGCTGGAGGGAAGCGG + Intronic
1089330699 11:117687026-117687048 TCTGCAGCTCTGCAGAGATGGGG - Intronic
1089632525 11:119792583-119792605 GGGGCTGCGGTGCAGGGATGGGG + Intergenic
1090636375 11:128692880-128692902 GCGGCGGCCCAGGAGGGAGGCGG + Intronic
1092205655 12:6613148-6613170 CCAGCAGCTCTGCAGGGAGGGGG - Intergenic
1095349044 12:41188337-41188359 GCGGCGGCAGTGGAGGGAGGTGG - Intergenic
1097276273 12:57815553-57815575 GAGGGGGCACTGCAGAGATGAGG - Intronic
1099054267 12:77818551-77818573 GCAGTGTCTTTGCAGGGATGAGG + Intergenic
1100098835 12:91077440-91077462 GAGGAGGTTCTGCAGGGATGAGG + Intergenic
1103162366 12:118740110-118740132 GAGGCCTCTCTGCAGGCATGTGG + Intergenic
1103348165 12:120265115-120265137 GGGGCGGCCCTGGAGGGACGGGG + Intronic
1103941337 12:124502923-124502945 GCGGCAGGCCTGCAGGAATGAGG + Intronic
1104679528 12:130739858-130739880 GGGGCCCCTCTGCGGGGATGGGG - Intergenic
1107058506 13:36131204-36131226 GCTGCGGGGCTGCAGGGCTGGGG + Exonic
1113588353 13:111480943-111480965 GGGGGGGCTCTCCTGGGATGAGG + Intergenic
1113887792 13:113670113-113670135 GCGGGGCCTCTGCAGGGCTGAGG + Intronic
1113895241 13:113759970-113759992 TCGGGGGCTCTGCCGGGAAGTGG + Intronic
1119410271 14:74426038-74426060 GCGGCGGCTGCTCAGGGACGCGG - Exonic
1121648145 14:95535114-95535136 GCGGCGGCTCTGCTCCGCTGGGG + Exonic
1122183572 14:99972183-99972205 GCGGGGGCTCTGCAGAGATTCGG + Intronic
1122595325 14:102886329-102886351 GCTTCGGCTATGCAGGGAAGGGG - Intronic
1122855026 14:104555982-104556004 GCGGCTGCTCTGCAGAGCTGGGG + Intronic
1124468720 15:29964063-29964085 GCTGCTGTTCTGCAGGTATGAGG - Intronic
1125657126 15:41367209-41367231 GGGGCTTCTCTGCAGGGGTGAGG + Intronic
1125689628 15:41585544-41585566 GCGGGGCCCCTGCAGGGACGGGG + Intergenic
1126796594 15:52264859-52264881 GAGGCAGCTTTGCAGGGAAGGGG - Intronic
1128766368 15:70253483-70253505 GAGGCTGTTCTGCAGAGATGAGG + Intergenic
1131446463 15:92502042-92502064 GCTGAGGTTCTGCAGGGAGGAGG - Intergenic
1132399554 15:101496975-101496997 GCGGCGGCTCTGGGGAGCTGGGG - Intronic
1132581157 16:685217-685239 GGGGCGGCGCTGCAGGGGGGAGG + Intronic
1132598906 16:765269-765291 AGGGCGGCTCTGCAGGGCGGGGG + Exonic
1132737549 16:1394387-1394409 GGGTCGGCTCTGCAGAGAGGAGG - Intronic
1133271238 16:4611772-4611794 GCTGAGGCCCTGCAGGGGTGGGG + Intronic
1137440674 16:48496640-48496662 GCCGCAGCTCTGCCGGGATCAGG + Intergenic
1137669822 16:50272490-50272512 GCAGCTGCTCTGCACAGATGGGG + Intronic
1138656195 16:58492910-58492932 GTGGTGGCTCTGCAGGGAGGAGG - Intronic
1140070881 16:71648844-71648866 GAGGAGGCTGTGCAGGGTTGGGG - Exonic
1140832532 16:78765096-78765118 GTGGCGGCTGTGCGGGGATGTGG + Intronic
1141700706 16:85640807-85640829 GCGGCGGCTCTGCAGGCGTCTGG + Intronic
1142228402 16:88888448-88888470 GCTGCGGCCCTGCAGGGGTGTGG + Intronic
1142306703 16:89290147-89290169 GCGTCTGCTCTGCAGGGCTCGGG - Intronic
1142486618 17:251677-251699 GCAGCAGCTCTTCAGAGATGGGG - Intronic
1142876128 17:2853157-2853179 GCGCCGACTCTGCGGGGAGGCGG + Intronic
1143200760 17:5111711-5111733 GCGGCGGCTCTGCAGTGAGCAGG - Intronic
1143319566 17:6059399-6059421 GAGCTGGCTCTGCATGGATGCGG - Intronic
1143322710 17:6078536-6078558 CCGGTGGCTCTGCTGGAATGTGG + Intronic
1144327122 17:14193205-14193227 CCGGCGGCGCTGCCTGGATGGGG + Intronic
1144476009 17:15590068-15590090 CCGGCGGCGCTGCCTGGATGGGG + Intronic
1144695873 17:17303577-17303599 GCGGCGGCTCTGCAGCGCGGCGG + Exonic
1145242050 17:21245809-21245831 GGGGCGGGGCTGCAGGCATGAGG - Intronic
1145789953 17:27620296-27620318 GCGGCAGGTGTGCAGGCATGCGG - Intronic
1147931354 17:43983545-43983567 CAGGGGGCACTGCAGGGATGAGG + Intronic
1148106330 17:45120820-45120842 GTGGGGGCTCTCCAAGGATGGGG + Intronic
1149978036 17:61286231-61286253 GCGGAGGGTCTGCGGGGGTGGGG + Intronic
1151419740 17:73989276-73989298 ACGGAGGCTCTGCTGGGGTGGGG + Intergenic
1151779874 17:76238950-76238972 GCAGACACTCTGCAGGGATGCGG + Intronic
1151876318 17:76869713-76869735 GGGGCGGCGCTGCAGGGCTACGG + Intronic
1152049229 17:77959224-77959246 GCGGCGGCTCCGCGGGGCTCCGG - Intergenic
1152068685 17:78124838-78124860 GGGGCGGCTGGGCAGGGCTGGGG - Intronic
1152224638 17:79087057-79087079 GCGGCGTCTCTTCCGGGCTGTGG + Intronic
1152341677 17:79729182-79729204 GTGCCTGCTCTGCAGGGCTGGGG - Intergenic
1152447388 17:80353760-80353782 GCCGCCGCTGTGCAGGGGTGAGG + Intronic
1152668061 17:81582968-81582990 GGGGCGGCGCCGCAGGGAGGAGG - Intronic
1152772502 17:82178973-82178995 TCGGCGTCTCTGCAGAGGTGGGG - Intronic
1155224618 18:23718601-23718623 GCCCCTGCTCTGCAGGGCTGCGG + Intronic
1156406432 18:36786975-36786997 GCTGTGTCTCTGCAGGCATGGGG - Exonic
1157426832 18:47591489-47591511 CCGTGGGCTCTGCATGGATGTGG - Intergenic
1157439655 18:47700887-47700909 GCGGGGGCAATGCAGGGAAGCGG + Intergenic
1157596121 18:48864896-48864918 GCTGCGGAACTGCAGGAATGAGG - Intergenic
1157596146 18:48865061-48865083 CCTGGGGCGCTGCAGGGATGAGG - Intergenic
1160738949 19:677202-677224 GGGGTGGGGCTGCAGGGATGGGG - Intronic
1161040890 19:2110261-2110283 GCGGGGGCTCAGCATGGGTGGGG + Intronic
1161490494 19:4558361-4558383 GCGGCGGCTCCTCAGGAAAGAGG + Exonic
1161871946 19:6877013-6877035 GCAGCGGCCCTGCAGAGTTGCGG - Intergenic
1162534491 19:11254735-11254757 GAGGGGACTCTGCAGGAATGTGG + Intronic
1163674154 19:18646979-18647001 GGCGCGTCTCAGCAGGGATGGGG + Intronic
1165135916 19:33668535-33668557 GCAGCAGCTCTCCAGGGAGGTGG + Intronic
1165824962 19:38700520-38700542 GCTGCGGCCCTGCAGGTGTGTGG + Intronic
1165924989 19:39321059-39321081 GCGGCGGCTCGGCAGTGGAGAGG - Intergenic
1166060085 19:40320651-40320673 GCAGGGCCTCTCCAGGGATGGGG - Exonic
1166366546 19:42281056-42281078 GGCGCGGCTCGGCAAGGATGGGG - Intronic
1166894686 19:46016152-46016174 GCGGCCGCTCTCCCGGGATGAGG - Exonic
1167411590 19:49347303-49347325 GCGGCGGCGCTCCGGGGCTGGGG + Exonic
1167631204 19:50627290-50627312 GAGGAGCCTCTGCAGGGCTGTGG - Intronic
925032418 2:661139-661161 GCAGGAGCTCTGCAGGGAGGGGG - Intergenic
926101650 2:10122244-10122266 GCGGCGGCCCGGCTGGGAGGAGG + Intergenic
931557299 2:63519246-63519268 GCAGTGGCTCTGCAGGGCAGAGG - Intronic
931688322 2:64813803-64813825 TCTGCGGCTCTCCAGGGCTGGGG + Intergenic
932314153 2:70768381-70768403 GCGGGGGCGCTGCGGGGAGGAGG - Intergenic
932892516 2:75609201-75609223 TCGGCGGCTGTGCGGGGATACGG + Intergenic
934174336 2:89565966-89565988 GGGGTGGCTCTGCTGGGATGTGG - Intergenic
934284651 2:91640316-91640338 GGGGTGGCTCTGCTGGGATGTGG - Intergenic
938236298 2:129709487-129709509 GCAGCTGCTCTGGGGGGATGGGG - Intergenic
944080607 2:195784006-195784028 GGGGAGGCTGTGCAGGTATGGGG - Intronic
945153864 2:206817015-206817037 GTGGTGGCTCTCCAGGTATGGGG - Intergenic
947518812 2:230828685-230828707 GCGGCGGCGCCCCAGGGCTGGGG + Intergenic
948795637 2:240400815-240400837 GCGGGCTCTCTGCTGGGATGGGG + Intergenic
948811487 2:240480674-240480696 GTTCCAGCTCTGCAGGGATGGGG + Intronic
948845559 2:240681330-240681352 GCGGGAGCTCTGCAGGGACACGG - Intronic
948848294 2:240693400-240693422 GCGGGAGCTCTGCAGGGACACGG + Intronic
949032535 2:241803869-241803891 GCGGCGGCTGCGCGGGGAGGTGG + Exonic
949040072 2:241844018-241844040 GGGGCGGCGCTGCAGGGTCGGGG + Intergenic
1170639396 20:18138206-18138228 GCGGCCGCTCTGCTGGGCTCCGG + Intronic
1171125505 20:22598574-22598596 GCTGAAGCTCTGCATGGATGAGG - Intergenic
1172012130 20:31851630-31851652 GCTGGTGCTCTGGAGGGATGAGG + Intronic
1175423033 20:58847663-58847685 TCTGCGGCTTTGCAGGGAGGAGG - Intronic
1175782412 20:61690930-61690952 GCGGGGGGTCTGCAAGGCTGTGG - Intronic
1175816951 20:61888156-61888178 GCGGCGGCTCTGCAGGGATGTGG - Intronic
1176181326 20:63751229-63751251 CCGGCGGCTCCGCGTGGATGTGG + Intronic
1176411891 21:6453660-6453682 GCGGTGGCTCTGCATTGACGGGG - Intergenic
1179476686 21:41651085-41651107 TCTGGGGCTCTGCAGGGCTGAGG + Intergenic
1179603907 21:42499647-42499669 AGTGCGGCTCTGCAGGGAGGAGG + Intronic
1179687385 21:43061982-43062004 GCGGTGGCTCTGCATTGACGGGG - Intronic
1179901295 21:44396007-44396029 GTGGAGGCTCTGGAGGGGTGTGG + Intronic
1179901445 21:44396475-44396497 GTGGAGGCTGTGGAGGGATGTGG + Intronic
1180891363 22:19291500-19291522 GCAGCGGCTCAGCGGGGCTGGGG + Intronic
1180991845 22:19941769-19941791 GCGGTGGCGCTGCGGGGATTAGG - Exonic
1181139850 22:20796369-20796391 GGGACGGCACTGCAGGGGTGAGG + Intronic
1181299337 22:21868025-21868047 GCTGCGGCGCTGCCGGGATATGG - Intergenic
1181347418 22:22230048-22230070 ACAGCAGATCTGCAGGGATGGGG - Intergenic
1181438121 22:22922094-22922116 GAGGGGTCTCTGCAGGGAGGTGG + Intergenic
1181472453 22:23149181-23149203 GCTGTGGCTGTGCAGGGGTGGGG + Intronic
1181670832 22:24424779-24424801 GTGGCGGCTCTCGAGGGATTTGG + Intronic
1182918693 22:34059639-34059661 GCTGCTGCTCAGCAGGGGTGAGG + Intergenic
1184095213 22:42312697-42312719 CCTGAGGCTCAGCAGGGATGGGG - Intronic
1184337447 22:43862156-43862178 GCGGCCGCGCTGCAGGGCTGGGG + Intronic
1184807222 22:46802944-46802966 GCCTGGGGTCTGCAGGGATGGGG + Intronic
1185070642 22:48654003-48654025 ACGGCGGCTCTGGAGGGAAGGGG + Intronic
1185070665 22:48654110-48654132 GCCGCGGCTCTGGAGGGAAGAGG + Intronic
1185205727 22:49536982-49537004 GCGGGGACTCTGCAGTGAAGAGG - Intronic
1185221863 22:49633128-49633150 CCAGTGGCTTTGCAGGGATGGGG - Intronic
1185285523 22:49998110-49998132 GTGCCTGCTCAGCAGGGATGGGG - Intronic
1185290779 22:50026281-50026303 GTGGCGGCTGTGCAGGGTGGCGG - Intronic
953561220 3:43995276-43995298 GCCGCGGCGCTGCAGGAAGGAGG - Intergenic
953773025 3:45793141-45793163 GCAAGGGCTTTGCAGGGATGTGG + Intronic
954374373 3:50186271-50186293 CCGGCGGCTCCGCCTGGATGAGG - Exonic
954699742 3:52445052-52445074 AGGGCGGCTCTGCAGGCAGGCGG - Intronic
961786001 3:129347337-129347359 GCAGTGGCTCTGAAGGGCTGAGG + Intergenic
961816378 3:129552803-129552825 ACAGAGTCTCTGCAGGGATGTGG + Intergenic
962413404 3:135161329-135161351 GGGGCTGCTCTGCAGGGAGAAGG + Intronic
967007687 3:185399830-185399852 GCGGAGGAGCTGCAGGGAGGAGG - Intronic
968446388 4:654315-654337 GCTGCTGCACTCCAGGGATGGGG + Intronic
968485545 4:859293-859315 GCGGGGTCTCTGCATGGAAGTGG - Intronic
968789361 4:2648835-2648857 GCAGAGGCTCTTCAGGGCTGTGG + Intronic
970194953 4:13543922-13543944 GCTGCGGCTTCGCGGGGATGGGG - Intronic
970607563 4:17694849-17694871 GAGGGGGCTCTGCAGTGTTGGGG + Intronic
982317718 4:154048215-154048237 GTTGCTGCTCTGCAGGGGTGGGG + Intergenic
982370331 4:154626914-154626936 GCGGCGGCTGGGCTGGGCTGGGG - Intergenic
985791724 5:1931696-1931718 TCGCGGGCTCTGCAGGGCTGGGG - Intergenic
986776983 5:11024902-11024924 GAGGCTGCTCTGCAGGGGTTGGG - Intronic
986977380 5:13409941-13409963 GCAGCTGCTCTGCAGGTACGAGG - Intergenic
988949355 5:36241719-36241741 GCGGCGGCGCTGCGGGGACCGGG - Exonic
992649183 5:78840763-78840785 GCGGCAGCACTGCAGGGGTGGGG + Intronic
995808937 5:116083986-116084008 GCGGTGGGTCTGCAGAGATGTGG - Intergenic
997309373 5:132866855-132866877 GCGGCGGCCCTGCAGGACCGAGG - Exonic
998406690 5:141878287-141878309 GCTGCGGCTCCGCACGGCTGGGG + Exonic
998641337 5:144014697-144014719 GCAGCTGCTCTAGAGGGATGTGG - Intergenic
999758555 5:154682955-154682977 GCGGCGGAGCTGGAGGGAGGCGG - Intergenic
1000341530 5:160280685-160280707 CCGGCGGCTCTTCAGGAGTGGGG + Exonic
1001127863 5:169036670-169036692 GCGGCGTCTGTGCAGAGATGTGG + Intronic
1001261550 5:170233525-170233547 ACGATGGCTCTGCAGGGCTGCGG + Exonic
1002434111 5:179220835-179220857 GCGTGGGCCCTGCAGGGGTGAGG + Intronic
1002887825 6:1312042-1312064 GCGGCGGCTCCGCGGGGGCGGGG - Intergenic
1003173632 6:3738881-3738903 CCGTCGGCTTTGCAGGGATGGGG + Intronic
1004688741 6:17973797-17973819 TCGGAGCCTCTGCATGGATGTGG + Intronic
1008506656 6:52237261-52237283 GAGGCAGTTCTGCAGGGCTGTGG + Intronic
1012450643 6:99349781-99349803 GGGCCGGATCTGCAGGGCTGAGG + Intronic
1013689032 6:112617903-112617925 GCGGCGGCTCAGGAGAAATGAGG - Intergenic
1014753717 6:125280625-125280647 ACGGCGGCTTTGCAGCGATGTGG - Intronic
1016422834 6:143902568-143902590 GCTGCTGCTCTGCAGGGAGGGGG + Intronic
1017842339 6:158232174-158232196 GCGGCGGCGGTGAAGGGAGGCGG + Intergenic
1017997389 6:159544043-159544065 GGGGAGGCTGTGCAGGGGTGCGG + Intergenic
1019398608 7:837178-837200 GCGGAGGCTCTGAAGTGCTGGGG + Intronic
1019512739 7:1426117-1426139 GCCGGGGCTCTGCAGGGACGTGG - Intergenic
1019669516 7:2269945-2269967 GGGGCGGCTCTGCAGAGAAACGG + Intronic
1019919911 7:4156996-4157018 GCAGCGGCTCTTCATAGATGAGG - Intronic
1020114940 7:5470960-5470982 GCCTCTGCTCTGCACGGATGAGG - Intronic
1023663353 7:42493657-42493679 GCGGTTGCTCTGCCGGGCTGCGG + Intergenic
1026858238 7:73768944-73768966 GGGGGAGCTCTGCAGGGAGGTGG + Intergenic
1028953845 7:96666829-96666851 GTGGGTGCTCTGCAGGGATCCGG - Intronic
1029194546 7:98796006-98796028 GCGGCGGGTCTTCAGGAAGGAGG + Intergenic
1031080363 7:117251763-117251785 TCAGCAGCTCAGCAGGGATGGGG - Intergenic
1032525593 7:132576756-132576778 GCGGCGGCTCTCGGGGGCTGCGG + Exonic
1034268089 7:149790805-149790827 GCAGAGGCTCTGCGGGGATGAGG + Intergenic
1034938151 7:155212863-155212885 GCCACGGCTCTGCAGGCATCTGG - Intergenic
1034994730 7:155570681-155570703 GCGGCGGCACAGCTGGCATGGGG - Intergenic
1035479394 7:159169886-159169908 GCGGGGTGACTGCAGGGATGAGG - Intergenic
1035754941 8:2023903-2023925 ATGGAGGCTCTGCAGGGAGGAGG + Intergenic
1035931332 8:3783475-3783497 GAGGCGGCCCTGCAGTGCTGAGG + Intronic
1036683990 8:10896416-10896438 GCGGGGGCTCTGGAGTGGTGGGG - Intronic
1037273677 8:17156360-17156382 GGGCGGGCTCTGCGGGGATGCGG - Exonic
1037521055 8:19681177-19681199 GTGGGGGCTCTGCAGGGAGGTGG - Intronic
1037812445 8:22095080-22095102 GTGGCTGCTCTGCAGTCATGAGG + Intronic
1040458412 8:47622662-47622684 GCATCGGCCCTGCATGGATGAGG + Intronic
1040560971 8:48523314-48523336 GTGGTGGCCCTGCAGGGCTGAGG + Intergenic
1042560488 8:70069876-70069898 TCGGCGGCTCTGCAGAAAAGCGG + Exonic
1044722815 8:95167446-95167468 AATGCGGCTCTGCAGGGAAGGGG - Intergenic
1045611367 8:103846856-103846878 GCTCAGACTCTGCAGGGATGAGG - Intronic
1046131523 8:109973890-109973912 GCGGCGGCTGGGCGGGGAGGCGG - Intronic
1049269547 8:141687038-141687060 GCAGCGGTTCCGGAGGGATGGGG + Intergenic
1049343458 8:142126264-142126286 GAGGCGGCTCCGCAGAGACGTGG - Intergenic
1049446184 8:142632596-142632618 CGGGGGGCACTGCAGGGATGTGG + Intergenic
1049476329 8:142798599-142798621 GCAGCGGCGCTGCACGGCTGAGG + Intergenic
1049766278 8:144356705-144356727 GCAGCTGCCCTGCAGAGATGGGG + Exonic
1052772722 9:32704497-32704519 GCAGCTGCCCTGCTGGGATGAGG - Intergenic
1052793604 9:32901993-32902015 GCTGCGGCTTTCCAGGCATGGGG - Intergenic
1053207382 9:36198286-36198308 GCGGTGGCTCTGGCGGGGTGCGG - Intronic
1057173010 9:92975152-92975174 GCCCCGGCTCTGCGGGGGTGCGG - Intronic
1057936510 9:99244016-99244038 GCAGCCACTCTGCAGGTATGAGG - Intergenic
1059021317 9:110579579-110579601 GCGGCGGCTCGGGCGGGAAGAGG + Exonic
1060299908 9:122369117-122369139 GAGGCAGCCCTCCAGGGATGAGG - Intergenic
1060936584 9:127519645-127519667 GCAGCTGCGCTGTAGGGATGAGG - Intronic
1061257540 9:129461122-129461144 GCGGGGGCGGTGCTGGGATGCGG - Intergenic
1061393397 9:130330234-130330256 GGGGCAGCTCAGCAGGGAAGAGG - Intronic
1061593402 9:131613398-131613420 GCCCTGGTTCTGCAGGGATGTGG + Intronic
1061821527 9:133229593-133229615 GCTTCTGCTCTGCAGTGATGTGG - Intergenic
1062004579 9:134232835-134232857 GAGGAGGCTCTGCGGGGTTGAGG + Intergenic
1062337847 9:136080238-136080260 GCGGGGGCCCTGCTGGGATGAGG - Intronic
1062496492 9:136833875-136833897 GGGACGGCTCTGCAGGAAGGAGG - Intronic
1186788665 X:12975802-12975824 GCGGCCTCTCCGCAAGGATGCGG - Exonic
1187097975 X:16167145-16167167 GCAGCGGCGGTGCAGGGAAGGGG - Intergenic
1187561332 X:20406360-20406382 GAGGCAGCCCTGCAGGGATGGGG - Intergenic
1192227299 X:69238213-69238235 GCGGCTTCCCTGCAGGGCTGAGG - Intergenic
1194095361 X:89632461-89632483 GCAGCTGGTGTGCAGGGATGAGG + Intergenic
1199679677 X:150216027-150216049 CAGGCTGCTCTGCAGGGCTGGGG - Intergenic
1199695554 X:150341022-150341044 CAGGCTGCTCTGCAGGGCTGGGG + Intergenic
1200161362 X:154011546-154011568 GGGGCTGCTGTGCAGGGGTGTGG - Exonic
1201273924 Y:12281586-12281608 GGGGAGGCTGTGCAGGTATGGGG + Intergenic