ID: 1175816952

View in Genome Browser
Species Human (GRCh38)
Location 20:61888162-61888184
Sequence GCAGTGGCGGCGGCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175816952_1175816959 -6 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816959 20:61888179-61888201 CACTGCCGGTACACACAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1175816952_1175816958 -7 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816958 20:61888178-61888200 CCACTGCCGGTACACACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 87
1175816952_1175816963 24 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816963 20:61888209-61888231 TGAAATGAGACTCCGCAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 97
1175816952_1175816961 0 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1175816952_1175816962 20 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175816952 Original CRISPR GCAGTGGCGGCGGCTCTGCA GGG (reversed) Intronic
900088677 1:909977-909999 GCAGGGGCGGCGGCGCGGCCGGG + Intergenic
900341197 1:2190151-2190173 GCAGCCGCGGCGGCTCTCCCTGG - Intronic
900379166 1:2375329-2375351 GCAGCGGTGGCAGGTCTGCAGGG + Intronic
900746815 1:4366285-4366307 GCAGCGGGGGTGGCTCTGCCTGG - Intergenic
901173241 1:7279499-7279521 AAGGTGGCTGCGGCTCTGCAAGG - Intronic
901198816 1:7455209-7455231 GCAGGAGCCGCGGCTCGGCATGG + Intronic
902219961 1:14958572-14958594 GCAGTGTCCGAGGCTCAGCAGGG + Intronic
902678949 1:18029645-18029667 TCAGTGGCTGGTGCTCTGCAGGG + Intergenic
905201701 1:36320807-36320829 GCAGTGGCGGGGGTTGTGGAAGG + Intronic
912212556 1:107570909-107570931 GCACCTGCGGCGGCTCTGCCCGG + Intergenic
913703293 1:121395927-121395949 GCCGTGGCGGCGGCGGTGGAGGG - Intergenic
915109355 1:153553245-153553267 GCGGGGGAGGCGGCTCTGGAAGG - Intergenic
915348652 1:155211301-155211323 GCAGTGGCCTCGGCTCTGCCAGG - Intronic
919640239 1:200039283-200039305 GCAGTGGCAGCGGCACAGCCGGG + Intronic
922784321 1:228275632-228275654 GCGGTGCCGGCAGCTCTGCCTGG + Intronic
1064271579 10:13870725-13870747 GCAGTGGCGGCAACCCAGCACGG - Intronic
1065854362 10:29817442-29817464 GCAGTGGCTGCAGATCTGCAGGG - Intergenic
1066171806 10:32856626-32856648 GCAGTGGCGCAGGCTCTGTGAGG - Intronic
1067205292 10:44207402-44207424 CCACTAGCGCCGGCTCTGCAGGG + Intergenic
1070768312 10:79068819-79068841 GCAGCGGCGGCGGCGCGGCGCGG + Intergenic
1075645178 10:124092366-124092388 GCGGTGGCGGCGTCTCTGGCCGG - Intronic
1076878912 10:133230620-133230642 GTAGCGGCGGCGGCACTGCGCGG - Exonic
1078246011 11:9573804-9573826 GCAGCCGCGGCGTCTCTGCGCGG - Exonic
1078329546 11:10408275-10408297 GCAGTGGCGGGGGCAGTGCAAGG + Intronic
1079302461 11:19290378-19290400 GAAGTGTTGGTGGCTCTGCAGGG + Intergenic
1080302707 11:30801933-30801955 GCAGTGGTGGCGTCTTTGCCTGG + Intergenic
1081585344 11:44380262-44380284 GCAGTGACTGCGGCTTTGGAGGG + Intergenic
1083258150 11:61508965-61508987 GCAGTGGCGGCGGCCCCGGCCGG + Exonic
1083538126 11:63490646-63490668 GCAGTGGTGGCAGCTCCGGAGGG - Intronic
1083936457 11:65872428-65872450 GCAGTGGCGGGGGCTGGGCTCGG - Intronic
1085746329 11:79117650-79117672 ACAGTGGCTGCTGCTCTCCAGGG - Intronic
1088928484 11:114325681-114325703 GCAGTGGCAGAGGCACTGCAGGG + Intergenic
1090077851 11:123590725-123590747 CCAGTGGTGGCTGCTCTGCCTGG + Intronic
1090351892 11:126113216-126113238 GCAGTGCCGGTGCCTCTGCTGGG + Intergenic
1095933176 12:47649614-47649636 GCAGTAGTGGAAGCTCTGCATGG - Intergenic
1103041191 12:117696818-117696840 GCAGAGGCTGAGGCTCTCCAAGG - Intronic
1104765817 12:131329622-131329644 GCAGTGGACGCCGCTCAGCAGGG + Intergenic
1104813449 12:131632240-131632262 GCAGTGGACGCCGCTCAGCAGGG - Intergenic
1104963334 12:132498338-132498360 GCTGCTGCGGCGCCTCTGCAAGG - Intronic
1105014480 12:132777761-132777783 GAAGTGGCGGCGGTTATGCCCGG + Exonic
1106054687 13:26227385-26227407 GCAGAGGTGGAGGCTATGCATGG - Intergenic
1106304096 13:28495046-28495068 GCAGCGGCGGCGGCTCGGAGCGG - Exonic
1107409675 13:40147007-40147029 GCTGTGGCGGGCGCTATGCAGGG - Intergenic
1112505112 13:99970699-99970721 GCAGCGGCGGCCGCCCTGCACGG - Exonic
1113201047 13:107867555-107867577 GCAGTGGCGCCGGCTCGGCCCGG + Intergenic
1113933600 13:113981598-113981620 GCAGTGGGGGTGGGGCTGCAGGG - Intronic
1115328159 14:32165519-32165541 GCAGTGGCGGAGGCTATATACGG + Intergenic
1115793663 14:36908290-36908312 ACAGTGGGGGCATCTCTGCATGG + Intronic
1116928615 14:50668071-50668093 GCGGAGGCGGCGGCTCGGGAGGG - Exonic
1118782221 14:69016167-69016189 GCAGGGCTGGGGGCTCTGCATGG + Intergenic
1119475208 14:74923027-74923049 GCGGGGCCGGCGGCTCTGCCCGG - Intronic
1119702548 14:76765165-76765187 GGAGTGGTGGCAGTTCTGCAGGG - Intronic
1122284024 14:100640229-100640251 GCAGTGGAAGGGGCTCTGCAGGG - Intergenic
1122558457 14:102593537-102593559 GCAGCGGCGCCGGCCCTGCTGGG - Intronic
1123025863 14:105423622-105423644 GCAGAGCCCGCGGCCCTGCAGGG - Intronic
1202880351 14_KI270722v1_random:52844-52866 GCAGTGCTGGAGGCTGTGCAGGG + Intergenic
1124881676 15:33648746-33648768 GCAGTGGCAGCTGCTCAGAATGG - Intronic
1125685597 15:41561482-41561504 GCAAGGGCGGCAGCTCTGCTGGG - Intronic
1126115359 15:45202758-45202780 GCAGTGGGGGCTGGTCTTCAGGG - Intergenic
1127118151 15:55747492-55747514 GCAGTGATGGAGGCTATGCATGG + Intergenic
1129856939 15:78831243-78831265 CCAGTGGCGGCGCCACTGCTGGG - Intronic
1132365125 15:101251563-101251585 GCGGCGGCGGCGGCGCTGCCCGG - Exonic
1132598901 16:765263-765285 GCAGCCAGGGCGGCTCTGCAGGG + Exonic
1133464871 16:6019545-6019567 GCAGAGGCGGCGGCACTGGCTGG + Intronic
1134282961 16:12834171-12834193 GCAGGGGCGGTGGCACTCCAGGG - Intergenic
1135167874 16:20156627-20156649 GAAGTGGAGGTGGATCTGCAAGG - Intergenic
1135565841 16:23510377-23510399 GCGGTGGCGGCGGCTGTGGCGGG - Exonic
1136071590 16:27790947-27790969 GCAGTGGCGCAGGCACTGCAGGG - Exonic
1136145833 16:28316134-28316156 GCAGTGGGGGAGGCACTGCCAGG + Intronic
1138590698 16:57998175-57998197 GGGCTGGCGGTGGCTCTGCATGG + Exonic
1141089692 16:81121670-81121692 GTACAGGCGGAGGCTCTGCAGGG + Intergenic
1141137916 16:81478637-81478659 GGGGTGGCTGCGGCTCTGCAGGG - Intronic
1142192639 16:88725021-88725043 GCAGTGGTGGCGGCCCTGGCTGG - Exonic
1142228400 16:88888442-88888464 GAAGGGGCTGCGGCCCTGCAGGG + Intronic
1144021218 17:11241252-11241274 GCAGTGGCGGCGGCGGCGCGCGG - Exonic
1144673497 17:17146284-17146306 GCAGTGGGGGGTGCTCTGGAGGG + Intronic
1147137656 17:38443547-38443569 GCAGGGACAGTGGCTCTGCAGGG - Intronic
1147970938 17:44218966-44218988 GCGGTGGCGGCGCCTCTGGCCGG - Intronic
1150388702 17:64779042-64779064 GCAATGGCGGCGGATGTGGAGGG - Intergenic
1150473587 17:65457832-65457854 GCTGGGGCGGCAGCTCTTCAGGG - Intergenic
1152049230 17:77959230-77959252 GCGGCGGCGGCGGCTCCGCGGGG - Intergenic
1152538093 17:80961788-80961810 GCAGGGGCGGCGCGTCTGCCAGG + Intronic
1152664413 17:81559068-81559090 GCCGTGGCGCCCGCTCTCCAGGG + Exonic
1153794628 18:8610206-8610228 CCTGTGGGGGCGGCTCTCCACGG + Intronic
1153862094 18:9222282-9222304 GCAGTGGTGGTAGCTCTGCATGG - Intronic
1156472000 18:37383241-37383263 CCAGTGGCCGCTGCTCTGCCTGG - Intronic
1158566344 18:58557148-58557170 GCAGTGGGGGCTGCCCAGCAGGG + Intronic
1158601937 18:58863496-58863518 GCGGCGGCGGCGGCTCGGCCCGG - Intronic
1160023939 18:75204124-75204146 GCAGTAGCCGCTCCTCTGCAGGG + Intronic
1160752533 19:741307-741329 GCAGGGGCTGCGGCTCTGCCAGG - Intronic
1160826561 19:1082966-1082988 GCAGTGGCGGTGGCCCTGGCAGG + Exonic
1161066697 19:2242127-2242149 ACAGTGGCGGCAGGTGTGCAGGG - Intronic
1161153549 19:2721318-2721340 GCAGCGGCCGCGGCGCCGCAGGG - Exonic
1161453837 19:4360683-4360705 GAAGTGGCAGCGGCTCAGCAAGG + Exonic
1161906103 19:7157714-7157736 GCAGGGGAGGTGGCTCTCCAGGG - Intronic
1164639154 19:29812072-29812094 GCAGTGGCGGCGGCGGCGCCGGG - Exonic
1164945702 19:32291499-32291521 GCAGTGGAGGAGGGTCAGCAGGG + Intergenic
1166293877 19:41879527-41879549 GCCTGGGGGGCGGCTCTGCAAGG - Exonic
1167101593 19:47407249-47407271 GCAGGGGCAGTGGCTCTGCGGGG + Intronic
1167368887 19:49069063-49069085 GCAGTGGCGAGGGCTCTGGGAGG - Exonic
1202655960 1_KI270708v1_random:21941-21963 GCAGTGCTGGAGGCTGTGCAGGG + Intergenic
925091202 2:1157191-1157213 GCACTGGTGGCCACTCTGCAGGG - Intronic
925150195 2:1610346-1610368 TCAGTGGCGGCTGCACTGCAGGG - Intergenic
926111962 2:10189244-10189266 GCAGTGGCCCCTGCTCTTCAGGG + Intronic
932113887 2:69027166-69027188 GCAGTGGCAGCTGCTCTGTGGGG + Intronic
932207235 2:69893992-69894014 GCAGTCGCAGCCGCTCTCCACGG + Exonic
936016218 2:108961126-108961148 GCAGCGGGGGCCACTCTGCAGGG - Intronic
936463030 2:112725596-112725618 GCAGTGCTGGGGCCTCTGCATGG - Intronic
938229996 2:129649990-129650012 GCGGTGGCGGCGGGTGTGCAGGG + Intergenic
941014350 2:160337733-160337755 GTAGAGGCTGCGGATCTGCAGGG - Intronic
941979017 2:171434498-171434520 GCAGCGGCGGCTGCCCAGCACGG + Exonic
944146625 2:196513947-196513969 GCAGTGGGGGAGGCGCTGCTGGG + Intronic
944661295 2:201923931-201923953 GCAGTGACAGCCGCTCTGCTGGG - Intergenic
947312946 2:228823965-228823987 GCAGTGGGGAGGGGTCTGCATGG + Intergenic
948609639 2:239158701-239158723 GCGGTGGGGCGGGCTCTGCATGG - Intronic
948874642 2:240820132-240820154 TCACTGGCGGCGGCCCCGCATGG + Exonic
949040069 2:241844012-241844034 GGGGTGGGGGCGGCGCTGCAGGG + Intergenic
1172015503 20:31870477-31870499 GCGGTGGCGGTGGCTGGGCAGGG - Exonic
1172126599 20:32628215-32628237 GCAGTGGCCGGGGGTCAGCAGGG + Intergenic
1172269954 20:33649306-33649328 GCTGTGCCAGCGGCTCCGCAGGG + Exonic
1174106116 20:48163588-48163610 GCATAGGCTGCGGCTGTGCATGG - Intergenic
1175816952 20:61888162-61888184 GCAGTGGCGGCGGCTCTGCAGGG - Intronic
1176213165 20:63935418-63935440 GCATTGGCCTCTGCTCTGCAGGG + Exonic
1177730822 21:25025103-25025125 GCAGTGGCAGTGACTATGCATGG + Intergenic
1180991846 22:19941775-19941797 GCAATGGCGGTGGCGCTGCGGGG - Exonic
1181024040 22:20117618-20117640 GCGGCGGCGGCGGCTCGGCTGGG - Exonic
1183736321 22:39646795-39646817 GGCCTGGCGCCGGCTCTGCAGGG - Exonic
1183832077 22:40423616-40423638 GCAGAGGAGGCTGCTCTGCCAGG + Exonic
950282229 3:11718754-11718776 GAAGTGGAGGCGGTTCTGCTGGG - Intronic
953881941 3:46695178-46695200 GCTGGGGCGGTGGCTCTGCCAGG - Intergenic
954212591 3:49106458-49106480 GCAGTGGCAGGCACTCTGCATGG - Intergenic
956201854 3:66714590-66714612 GCGGTGGCGGAGGCTGTGCATGG + Intergenic
956673137 3:71710014-71710036 GCAGTGGCGCCTTCCCTGCAGGG - Intronic
965226642 3:165999927-165999949 GCAGGGATGGAGGCTCTGCATGG - Intergenic
965366983 3:167813289-167813311 GCTGTGGCAGCTGCTGTGCAGGG - Intronic
968426937 4:530221-530243 CCTGTGGCGGCGGCTCCTCAGGG + Intronic
969135979 4:5029183-5029205 TCAGTGGAGGGGGTTCTGCAAGG - Intergenic
971749789 4:30632226-30632248 GCACTGCCGTGGGCTCTGCATGG + Intergenic
972960470 4:44447501-44447523 AAACTGGCGGCGGCTCAGCAGGG + Intronic
975622355 4:76307308-76307330 GCAGTGGCGGCGCCCCTTCCCGG + Intronic
978072628 4:104491567-104491589 GCGGCGGCGGCGGCGCTGCTGGG + Exonic
978596233 4:110379940-110379962 GCAGTGGTGGCAGCACAGCATGG - Intronic
979708493 4:123749568-123749590 GCAGGGGCTGCTGCTCTGCCTGG + Intergenic
981081700 4:140643903-140643925 CCAGAGGCGGCAGCTCTGCGGGG + Intronic
981366674 4:143912169-143912191 GCGGAGGCGGCGGCTCCGGAGGG - Intergenic
983222835 4:165059151-165059173 GCAGTGGCAGCAGCTCTGACCGG + Intergenic
983904322 4:173168786-173168808 GCGGTGGCGGCGGCTGCGCCGGG + Exonic
985654404 5:1122347-1122369 GCAGTGGCGGGGGCTGTGCTGGG - Intergenic
986142264 5:5041665-5041687 GCAGTGGCCGGTGCTCAGCAAGG + Intergenic
988952440 5:36277063-36277085 GCAGTGCCTGCCCCTCTGCAGGG - Intronic
989099104 5:37808307-37808329 GCAGAGGCGGTGGGTCTGAAAGG + Intergenic
991234272 5:64376019-64376041 GCAGGGACGGAGGCTATGCATGG + Intergenic
993703433 5:91144052-91144074 GCAGTGGGAGCGGGCCTGCAGGG + Intronic
997322246 5:132988081-132988103 GCAGTCGCAGCGGCTCCCCACGG - Intergenic
997335664 5:133107410-133107432 GCAGTGGGAGCTGCTTTGCAGGG + Intergenic
997907145 5:137829409-137829431 GCAGTGGCAGTGGCTATTCATGG - Intergenic
998382333 5:141734811-141734833 GCAGAGGCTGCAGCTCTGTAGGG + Intergenic
999315174 5:150579042-150579064 GCAGTGGGGGAGGCACTGCCAGG + Intergenic
999717414 5:154372611-154372633 GCACTGCGGGCGGCTATGCATGG + Intronic
999731720 5:154480173-154480195 GCTGCTGCGGCGGCTCTGCGGGG + Intergenic
1002318378 5:178360378-178360400 AAAGTGGCGGCAGCCCTGCAAGG + Intronic
1002521659 5:179795937-179795959 GCAGGGGCGGCGGCCCTGTGCGG + Exonic
1004043939 6:12009131-12009153 GCGGCGGCGGCGGCGCTGCCGGG + Intronic
1004044713 6:12012530-12012552 GCAGCGGCAGCGGCTCCGCCGGG + Exonic
1006864953 6:37201842-37201864 GCAGTGGCAGCAGCTCTCCTGGG - Intergenic
1006950812 6:37819890-37819912 GCGGTGGCGGCGGCTGGGCCCGG - Exonic
1007312544 6:40958072-40958094 GCAGTGGCTGCGGCTCAGGCAGG + Intergenic
1007683223 6:43648793-43648815 GCAGTAGCTGGGGCTCTGGAAGG + Intronic
1010519578 6:76817419-76817441 GCAGTGGGGGAGGCTCTGCCTGG + Intergenic
1017587817 6:155946818-155946840 GCAGTGGGGGAGGCACTGCCAGG + Intergenic
1018465416 6:164039982-164040004 CCAGTGGCAGAGGCTTTGCAAGG + Intergenic
1018922006 6:168181827-168181849 GCAGTGGGGGAGGCTTTCCAAGG - Intergenic
1019111971 6:169724104-169724126 GCGGTGGCGGCGGCGCTGGCGGG - Intronic
1019356814 7:584484-584506 TCAGTGGCTGCGCCCCTGCACGG - Intronic
1019788331 7:2993803-2993825 GCAGGGGCGGGAGCTTTGCAGGG - Intronic
1019828313 7:3301568-3301590 GGGGTGGCGGCTGCTCGGCATGG + Exonic
1019924304 7:4182202-4182224 GCAGTGGCAGCCGCTCCTCAGGG - Intronic
1020125435 7:5530433-5530455 GCCCAGACGGCGGCTCTGCACGG + Intronic
1028527526 7:91801884-91801906 GCAGTGTGGGAGGCTCTGCTGGG - Intronic
1029640506 7:101816663-101816685 GCAGTGGCGGCGGCTCCTCCTGG - Intronic
1029896464 7:103989612-103989634 GCAGAGGCGGCGGCGGCGCACGG - Intergenic
1031963553 7:128010868-128010890 GCAGTGTTGGCGGCTCCACAGGG - Intronic
1032488928 7:132309376-132309398 GCAGAGTCAGTGGCTCTGCATGG + Intronic
1032525592 7:132576750-132576772 GCAGCGGCGGCGGCTCTCGGGGG + Exonic
1032947393 7:136869608-136869630 GCAGTGATGGCGGGTCTGAAAGG + Intronic
1033568434 7:142602348-142602370 ACAGTAGCGGTGGCACTGCATGG + Intergenic
1035754939 8:2023897-2023919 GCAGGGATGGAGGCTCTGCAGGG + Intergenic
1035777965 8:2203897-2203919 GCAGGGGAGGCGCCACTGCAGGG + Intergenic
1037582324 8:20253021-20253043 GGAGCGGCCGCGGCGCTGCAGGG - Exonic
1040981728 8:53251633-53251655 CTACTGGCGGCGGCTCTGCGGGG + Exonic
1045782712 8:105886543-105886565 GCAGTGGTACCGTCTCTGCAAGG + Intergenic
1049172752 8:141172088-141172110 GCAGTGGTGGTGGGTGTGCACGG + Intronic
1049717426 8:144099534-144099556 GCAGTGGGGGTGGACCTGCAGGG + Exonic
1049727048 8:144151888-144151910 GCACTGCCGTCGGCTCTGGAAGG + Intronic
1051170562 9:14315345-14315367 GCGGCGGCGGCGGCTCGGCCCGG - Intronic
1056054615 9:82808014-82808036 GTAGTGGCTGTGGCTCCGCATGG + Intergenic
1057146919 9:92764793-92764815 GCAGCGGCGGCGGCTGAGGAGGG - Exonic
1057193226 9:93098779-93098801 GCAGCAGCGGAGGCTCTGCCTGG + Intronic
1057218252 9:93241591-93241613 GGAGGGGCGGCTGCTCTGGAAGG + Intronic
1059769841 9:117414845-117414867 GCAGTGGCGGCGGCCCCGGGTGG + Exonic
1059868692 9:118546292-118546314 GCAGTGGCAGAGGCAATGCAGGG - Intergenic
1060206289 9:121684659-121684681 GCAGCGGGGCCGGCTCTGCAGGG - Intronic
1060396823 9:123322093-123322115 GCAGGGGCGGCAGAACTGCAAGG + Intergenic
1061388563 9:130304722-130304744 GCTGCGGCGGGGGGTCTGCAGGG - Intronic
1061395895 9:130343179-130343201 GCAGTGGCGGGGGCTGAGGAGGG - Intronic
1062004578 9:134232829-134232851 GCAGGGGAGGAGGCTCTGCGGGG + Intergenic
1062046076 9:134425146-134425168 GCAGTGGCCACAGCCCTGCAGGG + Intronic
1062409219 9:136413909-136413931 GCTGTTGCGTCTGCTCTGCATGG + Intronic
1062497779 9:136839747-136839769 GGGGTGGGGGCGGCTCGGCAGGG - Exonic
1062621469 9:137424106-137424128 GCAGCGGCCGAGGCCCTGCACGG + Intronic
1062688569 9:137828843-137828865 ACAGAGGCGGCAGCTCTCCAAGG - Intronic
1185898511 X:3877357-3877379 CCAGTGGCGCGGGCTCTGCAAGG - Intergenic
1185903626 X:3915786-3915808 CCAGTGGCGCGGGCTCTGCAAGG - Intergenic
1188064859 X:25646337-25646359 GCGGGGGCGGCGGCTCAGCTGGG + Intergenic
1193439368 X:81519688-81519710 GCAGTGGCGCCATCTCGGCAAGG + Intergenic
1195205865 X:102599727-102599749 GCAATGGCGGCGGCTGTGTATGG - Exonic
1199989218 X:152975683-152975705 GCAGTGACCGCAGCTGTGCAGGG - Intergenic
1200238081 X:154478761-154478783 GCAGACGCGGCGTCTCTGCCCGG + Exonic