ID: 1175816953

View in Genome Browser
Species Human (GRCh38)
Location 20:61888163-61888185
Sequence GGCAGTGGCGGCGGCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 441}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175816953_1175816958 -8 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816958 20:61888178-61888200 CCACTGCCGGTACACACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 87
1175816953_1175816962 19 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816953_1175816959 -7 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816959 20:61888179-61888201 CACTGCCGGTACACACAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1175816953_1175816964 30 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816964 20:61888216-61888238 AGACTCCGCAGGCAGGATCCCGG 0: 1
1: 0
2: 0
3: 7
4: 136
1175816953_1175816963 23 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816963 20:61888209-61888231 TGAAATGAGACTCCGCAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 97
1175816953_1175816961 -1 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175816953 Original CRISPR GGCAGTGGCGGCGGCTCTGC AGG (reversed) Intronic
900088676 1:909976-909998 GGCAGGGGCGGCGGCGCGGCCGG + Intergenic
900095693 1:939268-939290 GGCAGCAGCAGCGCCTCTGCTGG - Exonic
900120494 1:1046714-1046736 GCCAGTGGGGGTGGCTCTGGGGG + Exonic
900379165 1:2375328-2375350 GGCAGCGGTGGCAGGTCTGCAGG + Intronic
900525284 1:3125493-3125515 GGCAGAGTCGCCGGCTCAGCGGG + Intronic
900642311 1:3693656-3693678 GGCTGAGGCGGCAGCTCTCCAGG - Intronic
900949030 1:5847250-5847272 GGCAGTGGCGGCTGTGCTGTGGG - Intergenic
901150602 1:7098732-7098754 GGCCGTGGCGGGGGCACTGATGG + Intronic
902350101 1:15847926-15847948 GGCAGCGGCGGCGGCTCCTCCGG - Exonic
902503396 1:16924931-16924953 GGCAGTGGCGGCAGGTCTTGTGG - Intronic
902689130 1:18098775-18098797 GGCAGTGGGTACAGCTCTGCTGG + Intergenic
902823225 1:18956191-18956213 GCCGGTGACGGCGGCGCTGCGGG - Exonic
902886752 1:19410577-19410599 GGGAGCGGCGGCTCCTCTGCTGG + Intronic
903504717 1:23825318-23825340 CGCCGAGGCGGCGGCCCTGCAGG - Intronic
904029021 1:27522499-27522521 GGCGGTGGCGGCGGCGGTGGTGG + Intergenic
904424342 1:30413944-30413966 GGCAGTGAGGGGGTCTCTGCAGG - Intergenic
904676811 1:32203913-32203935 GGAGGTGGAAGCGGCTCTGCAGG + Exonic
904716407 1:32471068-32471090 GGCAGCAGCGGCGGCTCATCAGG + Exonic
905212773 1:36385853-36385875 GGCGGCGGCGGCGGCTCGGGTGG - Exonic
905651754 1:39661439-39661461 GGCAGTAGCAGTGGCTCTGAAGG + Intronic
906296997 1:44654993-44655015 GGCAGAAGCGACGGGTCTGCAGG + Exonic
907297484 1:53464679-53464701 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
911664730 1:100539679-100539701 GGCGGCGGCGGCGGCGCAGCCGG - Exonic
912685089 1:111755960-111755982 AGCAGTGGCGACTGCTATGCCGG + Exonic
912716925 1:111989727-111989749 GGCAGTGGCGGCGGCAGTGGCGG - Intergenic
912716928 1:111989739-111989761 GGCAGTGGCGGCGGCAGTGGCGG - Intergenic
914348279 1:146818277-146818299 GGCAGTGGGGGAAGCTCTCCTGG - Intergenic
915070496 1:153261700-153261722 GGCTGCGGCGGCGGCTCCTCCGG + Exonic
916313537 1:163423146-163423168 GGAAATGGCGGCGGCTGTGCCGG - Intergenic
917339772 1:173964098-173964120 GGCATTGGAGGCAGATCTGCTGG + Exonic
919640238 1:200039282-200039304 AGCAGTGGCAGCGGCACAGCCGG + Intronic
920215287 1:204358507-204358529 GGCAGGTGCGGGGGCACTGCGGG - Intronic
920528507 1:206685323-206685345 GGCGGCGGCGGCGGCTGCGCCGG - Exonic
922616119 1:226962141-226962163 GGCCTTGGCGGAGGCTCAGCAGG - Intronic
922785150 1:228278961-228278983 GGCAGGGAGGGCAGCTCTGCAGG + Intronic
922792050 1:228316186-228316208 GGCAGAGGGGGCGGGGCTGCGGG + Intronic
923085606 1:230701545-230701567 GGCAGTGGCGGCAGCTGCCCTGG - Intergenic
924230480 1:241958234-241958256 GGACGAGGCGGCGGCGCTGCGGG + Intergenic
1063269010 10:4486186-4486208 GGCAGTGGCGGCAGATATGGAGG - Intergenic
1065854363 10:29817443-29817465 TGCAGTGGCTGCAGATCTGCAGG - Intergenic
1065993071 10:31031746-31031768 GGCGGTGGTGGTGGCTCTGGGGG - Intronic
1067830971 10:49610797-49610819 GGCTGTGGGCGCGGCGCTGCAGG + Exonic
1071532553 10:86400907-86400929 CGCAGTGCCGGCGCCTCTGGAGG + Intergenic
1071997517 10:91162873-91162895 GGCGGCGGCGGCGGCGCTGGCGG - Intergenic
1072054494 10:91740769-91740791 ATCAGTGGGGGCTGCTCTGCTGG + Intergenic
1073099247 10:100998346-100998368 GCCAGAGGAGGGGGCTCTGCTGG + Intronic
1073135388 10:101217460-101217482 AGCTGTGGCAGCGGCTCCGCCGG - Intergenic
1075399195 10:122149448-122149470 GGCTGTGGCGTTGGCTCTTCAGG + Intronic
1075697478 10:124447610-124447632 GGCGGCGGCGGCGGCTCGGGGGG - Exonic
1076849963 10:133087923-133087945 CGCAGAGGCGGCGGCGCTGCTGG + Exonic
1077262444 11:1629979-1630001 GGCTGTGGCTCCGGCTGTGCGGG + Exonic
1077923103 11:6655882-6655904 GGCGGGGGCGGGGGCTCCGCGGG - Intergenic
1078066330 11:8081473-8081495 GGCGGTGGCTGCGGCTCTGGAGG - Intronic
1078190835 11:9091568-9091590 GGCGGTGGCGGCGGCGGCGCGGG + Exonic
1079428218 11:20363838-20363860 GGCGGCGGCGGCTGCTCTGGCGG + Exonic
1080628518 11:34052166-34052188 GGCCGAGCCGGCGGCTCCGCGGG + Intronic
1081585343 11:44380261-44380283 GGCAGTGACTGCGGCTTTGGAGG + Intergenic
1082003623 11:47408303-47408325 GACGGAAGCGGCGGCTCTGCGGG - Intronic
1083033470 11:59615454-59615476 GGGAGTGGCGGCGGCTGGCCCGG - Exonic
1083193849 11:61071401-61071423 GGTGGTGGTGGCGGCTCTGAGGG + Intergenic
1083538127 11:63490647-63490669 GGCAGTGGTGGCAGCTCCGGAGG - Intronic
1083883038 11:65557887-65557909 GGCGGGGGCGGCGGGGCTGCTGG - Exonic
1084174326 11:67415739-67415761 GGCGGCGGCAGCGGCTCGGCGGG - Intronic
1084175684 11:67421078-67421100 GGCGGTGGCGGCGCCGCTGGTGG + Exonic
1084287617 11:68142199-68142221 GGCAGTGGTGGCGTCTCTCATGG + Intergenic
1084946640 11:72642279-72642301 GGCGGCGGCGGCGGCTCGTCCGG + Exonic
1085746330 11:79117651-79117673 GACAGTGGCTGCTGCTCTCCAGG - Intronic
1087059242 11:93962244-93962266 GGCAGTGGAGGGGGCCCTGCAGG + Intergenic
1088928483 11:114325680-114325702 GGCAGTGGCAGAGGCACTGCAGG + Intergenic
1089494801 11:118902609-118902631 GGCAGGGCCGGGGGCACTGCTGG + Exonic
1089754702 11:120678116-120678138 GGCAGTGCCTGTGGCTCTGGAGG + Intronic
1090068769 11:123525966-123525988 GGCAGTGGCAGCAGTTCTTCTGG + Exonic
1090351891 11:126113215-126113237 GGCAGTGCCGGTGCCTCTGCTGG + Intergenic
1090699202 11:129279300-129279322 GGCAGCCGCGGGGGCTCGGCCGG + Intronic
1091571521 12:1691090-1691112 GGCAGCGGCGGCGGCTACACCGG + Exonic
1091603569 12:1932331-1932353 GGGAGTGGCGGGGCCTCTGCGGG + Intergenic
1091759460 12:3077391-3077413 GGCGGCGGCGGCGGCGGTGCCGG + Exonic
1093829535 12:23738471-23738493 GGCTGTGGAGGCAGCACTGCAGG + Intronic
1093958783 12:25250868-25250890 GGCAGTGGCGGCGGCGAAGGTGG - Intronic
1094041115 12:26122631-26122653 GGCAGCGGCGGCGGCCCGGGGGG - Exonic
1094375372 12:29783652-29783674 GGCCGGGGCCGCGGCGCTGCTGG - Exonic
1096100246 12:48966436-48966458 GGCAGTGGGGGCGGCGTTGAGGG - Exonic
1096309129 12:50505008-50505030 GGCGGCGGCGGCGGCGGTGCTGG + Intronic
1096482414 12:51951585-51951607 GGCCGCGGCGCCGGCTCCGCCGG + Intergenic
1096569740 12:52515186-52515208 GGCAGTGGCAGTGGCTATGGCGG - Exonic
1096593078 12:52675326-52675348 GGCGGCGGCGGCAGCTCTGGCGG - Exonic
1096593128 12:52675542-52675564 GGCGGTGGCTACGGCTCTGGAGG - Exonic
1096695130 12:53344314-53344336 GGCAGAGGCGGGGGTTCTTCTGG - Intronic
1097057429 12:56258307-56258329 GGCGGCGGCGGCGGCTCCACCGG + Exonic
1097793934 12:63843563-63843585 GGCTCTGGCGGGGGCTCTGGTGG - Intergenic
1099925273 12:89009286-89009308 TGCAGTGGCGTTGGCTCTACAGG - Intergenic
1102537425 12:113591707-113591729 GGCACTGGCGGCGGCTGCGCGGG + Intergenic
1103386282 12:120534825-120534847 GGCGGTGGCGGCGGCGTTGGGGG - Exonic
1103807477 12:123584577-123584599 GGCGGCGGCGGCGGCTGTGGAGG + Exonic
1104836736 12:131796505-131796527 GGCAGTGGAGCCTGCTCTGTGGG - Intronic
1104975388 12:132549821-132549843 GGCAGGGGCCGCATCTCTGCAGG - Intronic
1105031547 12:132887571-132887593 GACAGCGGCGGCGGCGCAGCCGG - Exonic
1107409676 13:40147008-40147030 GGCTGTGGCGGGCGCTATGCAGG - Intergenic
1110756922 13:79185741-79185763 GGCAGTGGTGCCTGCTCTGGCGG - Intergenic
1112504969 13:99970090-99970112 GGCGGCGGCGGCGGCGCGGCCGG + Intronic
1113803147 13:113096727-113096749 GGCTTCGGCGTCGGCTCTGCCGG - Intronic
1113834893 13:113322277-113322299 GGCAGTGGAGGAGTGTCTGCTGG + Exonic
1113861671 13:113491001-113491023 GGCAGTGACTGCGGCTGGGCGGG + Exonic
1114073428 14:19132838-19132860 GGCGGAGGTGGCGGCCCTGCGGG + Intergenic
1114088837 14:19267145-19267167 GGCGGAGGTGGCGGCCCTGCGGG - Intergenic
1114502811 14:23183694-23183716 GGCAGGGGCGGAGCCTCGGCGGG - Intergenic
1115851786 14:37595145-37595167 GGCGGCGGCGGCGGCGCGGCGGG + Intronic
1116243539 14:42379060-42379082 GGCAGTGGGGGCTACCCTGCTGG - Intergenic
1116928616 14:50668072-50668094 GGCGGAGGCGGCGGCTCGGGAGG - Exonic
1116973879 14:51095029-51095051 GCCAGCGGCGGCGGCTGTGGTGG + Exonic
1118293038 14:64542710-64542732 GGCAGCGGCGGCGGCGGTTCAGG + Exonic
1118769093 14:68929676-68929698 GGCCGTTGCCGCTGCTCTGCGGG - Intronic
1121074972 14:91060397-91060419 GGCAGCAGCGGCGGCGCCGCGGG - Exonic
1122284025 14:100640230-100640252 GGCAGTGGAAGGGGCTCTGCAGG - Intergenic
1122315929 14:100826160-100826182 GGCCTTGGCGGCGGCTCCTCAGG + Intergenic
1122545007 14:102517236-102517258 CGCAGTGGCGGCGGCGCGGATGG - Intergenic
1122558458 14:102593538-102593560 GGCAGCGGCGCCGGCCCTGCTGG - Intronic
1122693830 14:103543430-103543452 GGCTGTGGCCGCTGCCCTGCTGG - Intergenic
1123025864 14:105423623-105423645 GGCAGAGCCCGCGGCCCTGCAGG - Intronic
1124136996 15:27043595-27043617 AGCAGAGGAGGGGGCTCTGCGGG - Intronic
1124176873 15:27434671-27434693 GCCAGTGGCACCGGCTCTGATGG - Intronic
1125416267 15:39456725-39456747 GGCAGTGGCGGTGGCCATGGTGG + Intergenic
1125516461 15:40323835-40323857 GGCGGCGGCGGCGGCGCTGGCGG + Intergenic
1125685598 15:41561483-41561505 GGCAAGGGCGGCAGCTCTGCTGG - Intronic
1126115360 15:45202759-45202781 GGCAGTGGGGGCTGGTCTTCAGG - Intergenic
1127606580 15:60592707-60592729 AGTAGCAGCGGCGGCTCTGCTGG + Intronic
1127665371 15:61140773-61140795 GGCAGTGGCGGGGGGTCAGGGGG + Intronic
1128322517 15:66703334-66703356 GGCAGCGGCGGCGGCGGTGGCGG + Exonic
1129298253 15:74611476-74611498 GGCAGTGCCGGAGGCCCTGTCGG - Intronic
1129513913 15:76144839-76144861 GGCATTGTGGGCGGCTCAGCTGG - Intronic
1129856941 15:78831244-78831266 GCCAGTGGCGGCGCCACTGCTGG - Intronic
1130046725 15:80451457-80451479 GGCATTGTCTGCTGCTCTGCTGG + Intronic
1130348053 15:83067066-83067088 GGCGGCGGCGGCGGCCCCGCGGG + Exonic
1131108751 15:89751232-89751254 GGCAGCGGCGGCGCGTCTGGGGG + Exonic
1131215113 15:90529931-90529953 GGCCGCGGCGGCTCCTCTGCCGG + Intronic
1131343704 15:91626973-91626995 GGAAGTGTTGACGGCTCTGCAGG + Intergenic
1131466092 15:92655794-92655816 GGCGGTGGCGCGGGCTCTTCCGG - Exonic
1132560189 16:590036-590058 GCCAATGGCGGCGGCGCGGCCGG + Intronic
1132583779 16:697119-697141 GCCAGCGGCGGCCGCTCCGCTGG + Exonic
1132598900 16:765262-765284 GGCAGCCAGGGCGGCTCTGCAGG + Exonic
1132821178 16:1872024-1872046 GGCCGCGGCGGCAGCTGTGCAGG - Exonic
1133079297 16:3305729-3305751 GGCGGTGGCCGCGGCGCTTCCGG + Intronic
1134163987 16:11915689-11915711 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
1135326141 16:21526959-21526981 GCCAATGTCTGCGGCTCTGCGGG - Intergenic
1135565842 16:23510378-23510400 CGCGGTGGCGGCGGCTGTGGCGG - Exonic
1136071591 16:27790948-27790970 GGCAGTGGCGCAGGCACTGCAGG - Exonic
1136237774 16:28925145-28925167 GGCAATGGCGGCAGCTGCGCCGG - Exonic
1136419534 16:30123185-30123207 GGCGGCGGCGGCGGCTCAGGGGG - Exonic
1137289676 16:47043399-47043421 GGCAGCCGCGGCATCTCTGCTGG + Intergenic
1137584783 16:49657874-49657896 GGCTGTGGAGGAGGCTATGCAGG - Intronic
1137594807 16:49716423-49716445 GGCAGGCGAGGTGGCTCTGCAGG - Intronic
1137655260 16:50153561-50153583 GGCGGCGGCGGCGGCCCTGCGGG + Intronic
1137695787 16:50461147-50461169 GGCAGTGGCGTCTGCCCTGCGGG - Intergenic
1138693619 16:58791048-58791070 GGCAGGGCCGGCTGCGCTGCCGG + Intergenic
1139415107 16:66801639-66801661 TGCAGGGGCGGCGGGGCTGCCGG - Intergenic
1139615369 16:68085394-68085416 GGCGGTGGCGGCGACTGTGGGGG + Intronic
1139664892 16:68448452-68448474 CGCAGCGGCGGCGGCTCTCGCGG + Exonic
1139985758 16:70897268-70897290 GGCAGTGGGGGAAGCTCTCCTGG + Intronic
1140187418 16:72787720-72787742 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
1141089691 16:81121669-81121691 GGTACAGGCGGAGGCTCTGCAGG + Intergenic
1141137917 16:81478638-81478660 TGGGGTGGCTGCGGCTCTGCAGG - Intronic
1141688731 16:85584816-85584838 GGGTGTGGGGGTGGCTCTGCAGG + Intergenic
1141700705 16:85640800-85640822 TGCGGCGGCGGCGGCTCTGCAGG + Intronic
1141989630 16:87602638-87602660 GGCACGGGCGGCGGCGCTGGCGG - Intronic
1142039180 16:87881684-87881706 GCCGGTGTCTGCGGCTCTGCGGG - Exonic
1142262118 16:89047962-89047984 GGCAGTGGCCTCGGGTCTGAGGG + Intergenic
1143030450 17:3964429-3964451 GGCAGTGGCGGCGGCGGCCCCGG + Intronic
1143527256 17:7479683-7479705 GGCGGCGGCGGCGGCGCTGGGGG - Intronic
1143732338 17:8888271-8888293 GGAAGGGGCGGCGGCGCTGGGGG + Exonic
1143762540 17:9115746-9115768 GGCCGTGGCGGAGTCTCTGGAGG + Intronic
1144269238 17:13601275-13601297 GGCAGCGGCCGGGGCTCCGCGGG + Exonic
1144655424 17:17032280-17032302 GGGAGAGGCGGCAGCTCTTCCGG - Intergenic
1144777751 17:17793330-17793352 GGTAGTGGCTGCGGCTGTGGGGG - Exonic
1144971286 17:19111264-19111286 GGCGGTGGCGGCGGCTCCGCGGG + Intergenic
1144991591 17:19237435-19237457 GGCGGTGGCGGCGGCTCCGCGGG + Exonic
1145209862 17:21004824-21004846 GTCAGTGGCGGGGGATCCGCTGG + Intronic
1145815698 17:27793629-27793651 GGCTGTGCAGGCTGCTCTGCAGG - Intronic
1146183018 17:30709288-30709310 GGCAGCGGGGGCGCCCCTGCAGG - Intergenic
1146656484 17:34637960-34637982 GGCAGGGGCGACGGCTCCTCGGG + Exonic
1146716201 17:35089075-35089097 GGCGGCGGCGGCGGCGCTGGGGG - Intronic
1146803309 17:35844671-35844693 GACAGAGGCGGCGGCTATGGTGG + Exonic
1147137657 17:38443548-38443570 GGCAGGGACAGTGGCTCTGCAGG - Intronic
1147155447 17:38542463-38542485 GTCAGTGTCAGCTGCTCTGCTGG + Intronic
1147620787 17:41865337-41865359 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
1147994634 17:44354058-44354080 GGCGGCGGCGGCGGCGCGGCAGG + Exonic
1148203555 17:45765706-45765728 GGCTGGGGCGAAGGCTCTGCAGG - Intergenic
1148495013 17:48048388-48048410 GGCGGTGGCGGCGGCGAGGCCGG + Exonic
1148550027 17:48544652-48544674 GGGAGTGGCGGCGGCGGTGGCGG + Exonic
1148550029 17:48544664-48544686 GGCGGTGGCGGCGGCAGAGCAGG + Exonic
1148616421 17:49003993-49004015 GAAAGTGGCGGCGGCGCTGCAGG + Intronic
1150259146 17:63774217-63774239 GGCGGTGGCGGCGGCGGTGGTGG + Exonic
1150473588 17:65457833-65457855 GGCTGGGGCGGCAGCTCTTCAGG - Intergenic
1150533805 17:66014228-66014250 GTCAGTGGGGGCCACTCTGCTGG + Intronic
1150549015 17:66192035-66192057 GGCGGTGGCGGCGGCGTTGGCGG - Intronic
1151679110 17:75614576-75614598 GGGAATGGCCTCGGCTCTGCAGG - Intergenic
1151755323 17:76072409-76072431 GGCAGTGGCGGCGGCGGTAGCGG - Exonic
1151817555 17:76478769-76478791 GGCAGAGGTGGGGGCCCTGCAGG + Intronic
1152049231 17:77959231-77959253 GGCGGCGGCGGCGGCTCCGCGGG - Intergenic
1152295249 17:79463614-79463636 GGCAGTGGCGGTGGCGATGGCGG - Intronic
1152321418 17:79610466-79610488 GGCAGTGGCGGTGGCGGTGGCGG - Intergenic
1152579380 17:81159372-81159394 GGCAGTGGCGGGGACTCTCGGGG + Intronic
1152676815 17:81645447-81645469 GGCCGTGGCGGGGGCCCTGGTGG + Exonic
1152721885 17:81927478-81927500 GGCGGTGGGGGCGGCGCGGCGGG - Intronic
1152770210 17:82162949-82162971 GGCAGTGGAGGCAGCACTGGCGG - Intronic
1155054514 18:22171850-22171872 GGCAGCGGAGGCGGCGCGGCTGG + Exonic
1155258000 18:24014934-24014956 GGCGGCGGCGGCGCCCCTGCAGG + Exonic
1157136677 18:45063477-45063499 GGCAGGGGCGGCGGCGGTGGCGG - Exonic
1158088524 18:53682818-53682840 GGCAGTGTGGGTGGCTCTGATGG + Intergenic
1158566343 18:58557147-58557169 GGCAGTGGGGGCTGCCCAGCAGG + Intronic
1158976513 18:62715788-62715810 GGCGGCCGCGGCGGCTCTGGCGG + Exonic
1159395139 18:67846589-67846611 GGCAGAGGGGGCCTCTCTGCTGG - Intergenic
1160023938 18:75204123-75204145 GGCAGTAGCCGCTCCTCTGCAGG + Intronic
1160429950 18:78804349-78804371 GGCAGTGGCTGCGGCTCAGCTGG - Intergenic
1160576457 18:79857053-79857075 GGCTGTGGGGGCGGCTGTGGGGG - Intergenic
1160576462 18:79857065-79857087 GGCTGTGGGGGCGGCTGTGGGGG - Intergenic
1160953958 19:1681130-1681152 GGCAGTGGCCGTGGCCCTGCCGG + Intergenic
1160991654 19:1862803-1862825 GGCAGTGGCGGGGGCTCCGGGGG - Intronic
1161084535 19:2328715-2328737 GGCAGCGGTGGCGGCTGCGCTGG + Exonic
1161628759 19:5340873-5340895 GGCGGCGGCGGCGGCGCTGGCGG - Intergenic
1161849414 19:6730947-6730969 GGCAGGGCCGGCGGCTCTGGGGG - Intronic
1162030899 19:7916858-7916880 GGCGGCGGCAGCGGCTCAGCTGG - Exonic
1162133950 19:8544022-8544044 GGCGGTGGCGGTGGCGGTGCTGG + Intronic
1162812527 19:13172824-13172846 GGCCCTGGCGCCGGCTCGGCGGG + Intergenic
1162935330 19:13978997-13979019 GGCCGGGGCGGCGGCTCCGGCGG + Intronic
1163243149 19:16076519-16076541 GGCAGCGGCGGACGCTCGGCTGG - Intronic
1163441293 19:17323806-17323828 GGCATTGGCGGCGGCGGCGCGGG + Exonic
1163490795 19:17616284-17616306 GGCCTGGGCGGCGGCCCTGCAGG + Intronic
1163581983 19:18144618-18144640 GGCAGTGGTGGCGGCAGTGGGGG + Exonic
1164639155 19:29812073-29812095 GGCAGTGGCGGCGGCGGCGCCGG - Exonic
1165064788 19:33222722-33222744 GGCTGGGGCAGGGGCTCTGCAGG - Intronic
1165221449 19:34320036-34320058 GGCAGTGGCGGCGGCTTATCTGG + Exonic
1165935476 19:39386095-39386117 GGCTGTGGCTCCGGCTCCGCTGG + Exonic
1166702712 19:44891446-44891468 GGCGGCGGTGGCGGCCCTGCGGG - Exonic
1166735050 19:45079170-45079192 GGCAGTGGCGGCGGCGCGGGCGG + Intergenic
1167019093 19:46861086-46861108 GGCGGCGGCGGCGGCTCCGGCGG - Intergenic
1167056133 19:47112529-47112551 GGCGGCGGCGGCGACTCTGATGG + Exonic
1167101592 19:47407248-47407270 AGCAGGGGCAGTGGCTCTGCGGG + Intronic
1167338434 19:48900687-48900709 GGAAGTGGGGGCGGCGCTGGGGG + Intronic
1167366408 19:49057069-49057091 GGCCATGGCGGGGGCTGTGCAGG + Intronic
925052579 2:828753-828775 GGCAGTGGTGGTGGTTCTGTGGG - Intergenic
925082106 2:1078520-1078542 GGCAGGCACGGCGGCGCTGCAGG + Intronic
925150196 2:1610347-1610369 CTCAGTGGCGGCTGCACTGCAGG - Intergenic
925877563 2:8326098-8326120 GGAAGTGGCTGCGGCATTGCAGG + Intergenic
926111961 2:10189243-10189265 GGCAGTGGCCCCTGCTCTTCAGG + Intronic
928270426 2:29850307-29850329 GGCAGAGGCGGGGGCACTTCCGG + Intronic
932113886 2:69027165-69027187 TGCAGTGGCAGCTGCTCTGTGGG + Intronic
934770318 2:96903593-96903615 GGCTGTAGTGGCGGCCCTGCTGG - Intronic
934847216 2:97669597-97669619 GACAGTGACGGGGGCTATGCTGG - Intergenic
935046752 2:99489878-99489900 GGCACTGGCGGCGGCGGGGCCGG - Exonic
936407254 2:112216516-112216538 GGGAGTAAGGGCGGCTCTGCTGG - Intronic
937044981 2:118846525-118846547 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
937221812 2:120346294-120346316 GGGGGTGGCGGCGGCGCGGCAGG - Exonic
937287311 2:120761651-120761673 GGCAGGGGAGGTGGCTCTCCCGG - Intronic
938229995 2:129649989-129650011 GGCGGTGGCGGCGGGTGTGCAGG + Intergenic
938487364 2:131724227-131724249 GGCGGCGGTGGCGGCCCTGCGGG + Intronic
939900501 2:147844589-147844611 GGCAGCGGCGGCGGCGGTGCAGG - Exonic
941580695 2:167293120-167293142 GGCAGCGCCGGCGGCGCGGCGGG - Intergenic
942046189 2:172100742-172100764 GGCAGTGGCGGCAGCGGCGCCGG - Exonic
942446155 2:176080276-176080298 GGCGGTGGCGGCGGCGGTGGTGG - Exonic
944146624 2:196513946-196513968 GGCAGTGGGGGAGGCGCTGCTGG + Intronic
944273084 2:197804950-197804972 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
944661296 2:201923932-201923954 AGCAGTGACAGCCGCTCTGCTGG - Intergenic
946219860 2:218217200-218217222 GGCAGTGGCGGCGGCGGCGGCGG + Exonic
946219862 2:218217209-218217231 GGCGGCGGCGGCGGCTCGGCAGG + Exonic
946248565 2:218400227-218400249 GGCGGCGGCGGCGGCTCCCCTGG - Intronic
946394254 2:219435252-219435274 GCCTGTGGCTGCGGCGCTGCGGG + Exonic
946412498 2:219522358-219522380 GGGAGGGGAGGCGGCTCGGCGGG + Intronic
947668856 2:231924447-231924469 GGCAGTGGCAGCTGCTGAGCTGG + Intronic
948425846 2:237886175-237886197 GGCAGTGGCTGGGGATATGCCGG + Intronic
948461309 2:238131176-238131198 GGCAGCTGCGGCGGCTGAGCCGG + Exonic
948487249 2:238288748-238288770 GGCGGAGGCGGCGGCGCTGAGGG - Intronic
948600284 2:239103952-239103974 GGCAGGGACGGATGCTCTGCGGG + Intronic
948661381 2:239508760-239508782 GGGAGTGGAGGAGGCTCTGCTGG - Intergenic
948843750 2:240673049-240673071 GGCAGTGGCGGCGGGTGGCCTGG - Intergenic
948897439 2:240933987-240934009 GGCAGGGGCGGGGGCTCTCCAGG + Intronic
948922488 2:241072274-241072296 GACAGTGGCGGAGGATTTGCCGG - Intronic
1169201515 20:3712483-3712505 GGAAGTGGCTGCGGCGGTGCTGG + Intergenic
1169214602 20:3785972-3785994 GGCAGTGGCGGGAGCACTACTGG - Exonic
1169734501 20:8823418-8823440 GGCAGGGGTGGTGGCTCTGGCGG - Intronic
1169914921 20:10674528-10674550 GGCAGAGGCGGCGGCGAGGCTGG + Intergenic
1170327717 20:15175735-15175757 GGCAGTGGCGGCCCATCTGGAGG + Intronic
1172015504 20:31870478-31870500 GGCGGTGGCGGTGGCTGGGCAGG - Exonic
1172079710 20:32330230-32330252 TGCATTGGATGCGGCTCTGCAGG + Exonic
1172269953 20:33649305-33649327 GGCTGTGCCAGCGGCTCCGCAGG + Exonic
1173666472 20:44766747-44766769 GGCAGTGTAGCAGGCTCTGCTGG + Intronic
1173672941 20:44810511-44810533 GGCGGTGGCGGCGGCGGTGGCGG + Intergenic
1174053940 20:47785529-47785551 GGCGGTGGCGGCGGCGTTGGGGG - Intronic
1175816953 20:61888163-61888185 GGCAGTGGCGGCGGCTCTGCAGG - Intronic
1175891209 20:62316833-62316855 GGCAGTGGGGGCGCTCCTGCTGG + Intronic
1175945028 20:62554684-62554706 AGTGGTGGCGGCGGCTCTGGGGG + Intronic
1176005631 20:62861066-62861088 GGCGCGGGCGGCGGCTCGGCGGG + Exonic
1176061615 20:63175184-63175206 GGTGGGGGCGGCGGCGCTGCCGG - Intergenic
1176808723 21:13516245-13516267 GGCAGAGACGGCAGCTCGGCTGG + Intergenic
1179563943 21:42234857-42234879 GGCGGTGGCGGCGGATGGGCGGG - Intronic
1180095940 21:45555333-45555355 GGCGGGGGCGGCAGCGCTGCAGG + Intergenic
1180105823 21:45617445-45617467 GGCAGAGGCGGTGCTTCTGCAGG + Intergenic
1180246832 21:46554219-46554241 GAGAGTGGCCGCGGCTCTGATGG + Exonic
1180491871 22:15855191-15855213 GGCGGAGGTGGCGGCCCTGCGGG + Intergenic
1180842335 22:18965173-18965195 GGCAGGGGCGCAGGCTCTGCTGG + Intergenic
1180843565 22:18970228-18970250 TGAAGAGGCGGCGGCCCTGCAGG - Intergenic
1180991847 22:19941776-19941798 GGCAATGGCGGTGGCGCTGCGGG - Exonic
1181024041 22:20117619-20117641 GGCGGCGGCGGCGGCTCGGCTGG - Exonic
1181035737 22:20168985-20169007 GGCAGTGGCAGAGGCTTTGTGGG + Intergenic
1181059160 22:20273714-20273736 GGCAGGGGCACAGGCTCTGCTGG - Intronic
1181138136 22:20783846-20783868 GACTGTGGGGTCGGCTCTGCAGG + Intronic
1182236949 22:28883643-28883665 GGCGGCGGCGGCGGCTTTGTGGG - Exonic
1182676432 22:32043055-32043077 GGCTGGGGCGGCGGCCCGGCAGG - Exonic
1183099617 22:35575749-35575771 GGCATTGGAGGCTTCTCTGCAGG - Intergenic
1183524928 22:38317275-38317297 GGCGGCGGCGGCGGCTGGGCCGG - Exonic
1183736322 22:39646796-39646818 GGGCCTGGCGCCGGCTCTGCAGG - Exonic
1184038910 22:41932114-41932136 AGCAGTGGAGATGGCTCTGCTGG + Intergenic
1184465899 22:44668776-44668798 GGCAGCGGCGGCGGCGGCGCGGG + Intronic
1184487117 22:44786473-44786495 GGCGGCGGCGGCTGCTGTGCTGG + Exonic
1184508066 22:44916352-44916374 GGCCATGGCGGCGGCATTGCTGG + Exonic
1184508316 22:44917419-44917441 GTCAGTGGTGGTGGCTCTGATGG - Intronic
1184523802 22:45009868-45009890 GGCGGCGGCGGCGGCTGGGCGGG - Intronic
950282230 3:11718755-11718777 GGAAGTGGAGGCGGTTCTGCTGG - Intronic
950745502 3:15084795-15084817 GGCAGTGGTGGCGGCGGTTCCGG + Exonic
951898379 3:27632877-27632899 GGCAGCGGCGGACGCTCGGCTGG - Intergenic
953705147 3:45225518-45225540 GGCGGTGGCGGCGGCGGCGCTGG + Exonic
954437419 3:50503459-50503481 GGCAGTGGCGGCGGCGGCGGCGG + Intronic
954468980 3:50675320-50675342 GGCCGTGGCGGGGGTTCTGGGGG + Intronic
954509114 3:51106342-51106364 GTCAGTGGGGGCTGCTATGCTGG - Intronic
954673497 3:52303204-52303226 GGCAGAGGCGGTGGCTTGGCTGG + Intergenic
954743170 3:52770838-52770860 GGCAGTGGGGGCGGCTGTTGAGG + Exonic
955228421 3:57079283-57079305 GGCTGCGGCGGCGGCTCCCCTGG + Exonic
956673138 3:71710015-71710037 GGCAGTGGCGCCTTCCCTGCAGG - Intronic
956761194 3:72446871-72446893 GGCGGTGGCGGCGGCGCCCCGGG + Exonic
957792486 3:84959056-84959078 GGCAGCGGCGGCGGCAGTGGCGG - Intronic
958915772 3:100048337-100048359 GGCAGTGCCGAAGGCTCTGAAGG - Intronic
959169852 3:102831117-102831139 GGCAGTGGAGGGGACTCTGCGGG - Intergenic
960811934 3:121634226-121634248 GGCAGTGGGGCCGGTACTGCTGG + Exonic
961820996 3:129575597-129575619 GGCAATGCCTGGGGCTCTGCTGG + Intronic
961887179 3:130103968-130103990 GGCAGTGGCGCCGGCCTTACAGG - Intronic
963503912 3:146161265-146161287 CGCAGCGGCGGCGGGTCAGCCGG - Intronic
966860630 3:184229555-184229577 GGCAGGGGCGCGGGCCCTGCCGG - Intronic
966872356 3:184299251-184299273 GGCAGTGGCGGCGGAGATGGAGG + Exonic
967093162 3:186152589-186152611 GGCAGTGGAGATGGCTCTGTTGG + Intronic
968148348 3:196318281-196318303 GGCAGGGAGGGCGGCTGTGCGGG - Exonic
968426935 4:530220-530242 GCCTGTGGCGGCGGCTCCTCAGG + Intronic
968437570 4:602083-602105 GGCACTGGCAGCCGCCCTGCTGG + Intergenic
968471951 4:786459-786481 GGGAGGGGCGGGGGCTCCGCGGG + Exonic
968775437 4:2536967-2536989 GGCGGCGGCGGCGGCTCGGGCGG + Intronic
968965366 4:3766618-3766640 GGCGCTGGCGGCGGCGCTGGCGG + Exonic
969413336 4:7043415-7043437 GGCTCTGGCGGCGGCTGGGCTGG + Exonic
971019049 4:22516047-22516069 GGCAGTGGCGGCGGCGGCGGCGG - Exonic
975403619 4:73965237-73965259 GGCTGTAGGGGCTGCTCTGCTGG + Intergenic
975582767 4:75921659-75921681 GGCAGTGGAGGAGGTACTGCTGG + Intronic
975778987 4:77819682-77819704 GGCGGTGGCGGCGGGGCTGAGGG + Intergenic
975779024 4:77819797-77819819 GGCAGAGGCGGCGGCGCGGAAGG + Intergenic
975870833 4:78776580-78776602 GGCAGCGGCGGCGGAGCGGCGGG + Exonic
976398600 4:84583269-84583291 GTTAGTGGCTGCGGCTCCGCGGG + Exonic
978072627 4:104491566-104491588 CGCGGCGGCGGCGGCGCTGCTGG + Exonic
979970739 4:127131575-127131597 GGCAGAGGCGGCTGCTTAGCTGG - Intergenic
980053867 4:128061790-128061812 GGCGGGGGCGGCTGCTCGGCCGG - Intronic
981081698 4:140643902-140643924 TCCAGAGGCGGCAGCTCTGCGGG + Intronic
981366675 4:143912170-143912192 GGCGGAGGCGGCGGCTCCGGAGG - Intergenic
982522016 4:156429830-156429852 GGCAGTGGCGGAGGCTCAAAAGG + Intergenic
983904321 4:173168785-173168807 AGCGGTGGCGGCGGCTGCGCCGG + Exonic
985011487 4:185587465-185587487 AGCAGCGGCGGCTACTCTGCTGG + Exonic
985654405 5:1122348-1122370 CGCAGTGGCGGGGGCTGTGCTGG - Intergenic
985888671 5:2699489-2699511 GGCAGGGGTGGGGGCGCTGCAGG + Intergenic
986402794 5:7396059-7396081 GGCGGTGGCGGCGGCGGCGCCGG + Intergenic
986977381 5:13409948-13409970 GGTAGTAGCAGCTGCTCTGCAGG - Intergenic
987294920 5:16541452-16541474 GGCAGAGGCGGCGGATCTCAAGG + Intronic
988682988 5:33502102-33502124 GGTGGTGGCGGCGGCCCTGCAGG - Intergenic
988723281 5:33900508-33900530 GCCAATGGCCGGGGCTCTGCTGG + Intergenic
988952441 5:36277064-36277086 GGCAGTGCCTGCCCCTCTGCAGG - Intronic
990638975 5:57761502-57761524 GGCAGTGGCTGCTGCCATGCTGG + Intergenic
991174189 5:63667769-63667791 GGCAGTGGTGGTGGCACAGCAGG - Intergenic
993703432 5:91144051-91144073 GGCAGTGGGAGCGGGCCTGCAGG + Intronic
994075684 5:95646902-95646924 GGCTGTGGCCGCGCCGCTGCGGG + Exonic
995728073 5:115203203-115203225 GGCAGTGGCTGCTGCTGGGCTGG - Intergenic
997282144 5:132656126-132656148 GGCAGGGGCTGCCGCTCGGCCGG + Intergenic
997335663 5:133107409-133107431 GGCAGTGGGAGCTGCTTTGCAGG + Intergenic
997367374 5:133334778-133334800 GGAAGTGGCGGCAGCTCATCTGG + Intronic
998174292 5:139892149-139892171 GGCAGTGGCAGCAGCTCAGGTGG + Intronic
998200486 5:140114305-140114327 GGCAGTGGCGGCGGCGGCGGCGG + Exonic
998382332 5:141734810-141734832 GGCAGAGGCTGCAGCTCTGTAGG + Intergenic
998903221 5:146877870-146877892 GGCTGGGGCGGGGGCTCGGCTGG - Intronic
999731719 5:154480172-154480194 CGCTGCTGCGGCGGCTCTGCGGG + Intergenic
1002541225 5:179907703-179907725 GGCAGGGGCGGCGGCCTTACGGG - Exonic
1002574058 5:180161595-180161617 GGCTGTGAGGGCGGCGCTGCAGG + Intronic
1002632628 5:180591338-180591360 GGCAGCGGCGGGGGCGCAGCGGG + Intronic
1003187173 6:3841996-3842018 GGCAGCAGCTGCTGCTCTGCTGG - Intergenic
1003212337 6:4079105-4079127 GGCCGGGGCTGCGGCTCCGCGGG + Exonic
1003570751 6:7254932-7254954 GGCAGTGGCTGAGTCTGTGCTGG - Intergenic
1004043938 6:12009130-12009152 GGCGGCGGCGGCGGCGCTGCCGG + Intronic
1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG + Exonic
1005267360 6:24126159-24126181 GGCGGCGGCGGCGGCTGCGCGGG + Intronic
1005327893 6:24720289-24720311 GGCGGCGGCGGGGGCGCTGCTGG + Exonic
1006558565 6:34889505-34889527 GGCGGCGGCGGTGGCTCTGGGGG + Exonic
1006864954 6:37201843-37201865 AGCAGTGGCAGCAGCTCTCCTGG - Intergenic
1007327400 6:41072984-41073006 GGCAGTGGCGGCGGCAGCGGCGG + Exonic
1007328479 6:41082926-41082948 GGCAGTGGCGGCGGTGGTGGTGG + Intronic
1007629119 6:43263075-43263097 GGCAGTGGCCGCAGCTCCTCGGG - Exonic
1007779760 6:44246218-44246240 GGCACCTGGGGCGGCTCTGCGGG - Intronic
1009310139 6:62139888-62139910 GGCATTGGCGGCGGGTGGGCGGG - Intronic
1010198499 6:73263191-73263213 GGAAGTGGCGGCGACCCCGCCGG + Exonic
1010386337 6:75284747-75284769 GGCTGTGGCGGTGGCGCTGGTGG - Exonic
1011290569 6:85772618-85772640 GGCTGCGGGGGCTGCTCTGCTGG + Intergenic
1013099481 6:106974873-106974895 GGCAGTGGCGGCGGCGGCGGGGG - Intronic
1014246895 6:119078798-119078820 GGCGGCGGCGGCGGCTGCGCGGG - Intronic
1014314258 6:119843490-119843512 GGCAGTAGCAGTGGCTCTGGGGG - Intergenic
1015061159 6:128968131-128968153 AGCAGTGGCTGTGGCTCTGCTGG + Intronic
1017672323 6:156778986-156779008 GGCGGCGGCGGCGGCTATGGGGG + Exonic
1017842353 6:158232221-158232243 GGCGGCGGCGGCGGCGATGCGGG + Intronic
1019111972 6:169724105-169724127 GGCGGTGGCGGCGGCGCTGGCGG - Intronic
1019350602 7:552326-552348 GGTGGTGGCAGTGGCTCTGCGGG - Intronic
1019355192 7:574961-574983 AGCAATGGCGGTGGCTCTCCCGG - Intronic
1019569772 7:1705485-1705507 GGCAGTGGCGGCTGCCACGCTGG - Intronic
1019613765 7:1949592-1949614 GAAAGTGGCTGCGGCTCTCCTGG - Intronic
1019788332 7:2993804-2993826 GGCAGGGGCGGGAGCTTTGCAGG - Intronic
1019924305 7:4182203-4182225 GGCAGTGGCAGCCGCTCCTCAGG - Intronic
1020607809 7:10360232-10360254 TTCAGTGGGGGCTGCTCTGCTGG + Intergenic
1021451049 7:20784417-20784439 GGCGGCGGCGGCGGCTCGGCGGG - Exonic
1021451284 7:20785436-20785458 GGCGGCGGCTGCGGCGCTGCTGG + Exonic
1021891342 7:25188805-25188827 GTCAGTGGCAGGAGCTCTGCTGG - Intergenic
1023405802 7:39833220-39833242 GGCGGCGGCGGCGGCGCTGGAGG + Intergenic
1023418144 7:39950832-39950854 GGCTGCGGCGGCGGCCGTGCCGG - Exonic
1024307382 7:47939900-47939922 GGGAGTGGGGGCTGCCCTGCAGG - Intronic
1024621217 7:51159092-51159114 GGCAGCGGGGGCGGCGTTGCAGG + Intronic
1025697971 7:63789869-63789891 GGCAGCGGCGGCGGCTGAGGCGG + Intergenic
1027059419 7:75073684-75073706 GGCTGGGGCGGCGGCTGAGCGGG - Exonic
1027202204 7:76071480-76071502 GGCAGTGGCTGGGACTCTTCAGG + Intergenic
1028476865 7:91263619-91263641 GGCAGTGGGGGCGCCTCTCTGGG - Intergenic
1028527527 7:91801885-91801907 TGCAGTGTGGGAGGCTCTGCTGG - Intronic
1028621484 7:92833555-92833577 GGCGGCGGCGGCGACTCTGCAGG - Exonic
1028988743 7:97027471-97027493 TGCACTGCCGGCTGCTCTGCGGG + Intergenic
1032525591 7:132576749-132576771 AGCAGCGGCGGCGGCTCTCGGGG + Exonic
1034224927 7:149474826-149474848 GGCAGTGGCGGCGGCGGTGGCGG - Exonic
1035169497 7:157009825-157009847 GGCGGCGGCGGCGGCTGCGCTGG - Exonic
1035290080 7:157832129-157832151 GGCTGTGGCAGCTGCTCAGCCGG + Intronic
1035305613 7:157929486-157929508 GGCTGCGGCGGAGGCTGTGCTGG - Intronic
1035754938 8:2023896-2023918 GGCAGGGATGGAGGCTCTGCAGG + Intergenic
1035777964 8:2203896-2203918 GGCAGGGGAGGCGCCACTGCAGG + Intergenic
1036789515 8:11708709-11708731 AGCAGTGGCGGCGGAGCGGCGGG + Exonic
1037529220 8:19757333-19757355 GGCGGCGGCGGCGGCTCGGGCGG + Intronic
1037876752 8:22552294-22552316 GAGAGGGGAGGCGGCTCTGCTGG - Intronic
1039638668 8:39194567-39194589 GTCTGTGGGGGCTGCTCTGCTGG + Intronic
1040600929 8:48883277-48883299 GGCAGAGGTGGAGGCTCTGCTGG + Intergenic
1040981727 8:53251632-53251654 ACTACTGGCGGCGGCTCTGCGGG + Exonic
1041167211 8:55102150-55102172 GGCGGCGGCGGCGGCTCGGGCGG + Intergenic
1045064790 8:98435594-98435616 GGACGGGGAGGCGGCTCTGCAGG + Intronic
1047024554 8:120811807-120811829 GGCGGCGGCGGCGGCTGGGCCGG - Exonic
1047393681 8:124474888-124474910 GGCGGCGGCGGCGGCTCCCCAGG - Exonic
1047862619 8:128984937-128984959 GGTAGTGGCAGCAGCTGTGCTGG + Intergenic
1049608499 8:143541157-143541179 GGGAGTGGTGCCGGCCCTGCTGG - Intronic
1049638956 8:143705687-143705709 GGAGGCGGCTGCGGCTCTGCGGG - Intronic
1049721031 8:144115647-144115669 TCCAGCGGCGGCGGCTCTCCGGG - Exonic
1049745862 8:144263033-144263055 GGCTGCGGCGACGGCTCAGCTGG + Exonic
1050744118 9:8857652-8857674 GGCGGTGGCGGCGGCTGCCCGGG - Intronic
1050874043 9:10613178-10613200 GGCGGCGGCGGCGGCGCTGCGGG + Intergenic
1051852753 9:21528285-21528307 GGCTGTGGGGGTTGCTCTGCTGG + Intergenic
1053064366 9:35057160-35057182 GGCAGTGGAGGCGGCACAGGTGG - Exonic
1053274367 9:36772090-36772112 GGCAGAGGCGGGGGCTCTTCTGG - Intergenic
1055513479 9:77016497-77016519 GGTTGTGGCGGCGGGTCTGCGGG + Intergenic
1055611775 9:78031581-78031603 GGCGGCGGCGGCGGCTCGGGGGG - Intergenic
1056071131 9:82988040-82988062 GGCAGTGGGGAAGGATCTGCAGG - Intronic
1056928417 9:90854260-90854282 AGCAGGGGCGGCTGCTCTGACGG + Intronic
1057146920 9:92764794-92764816 GGCAGCGGCGGCGGCTGAGGAGG - Exonic
1057173014 9:92975159-92975181 GCCAGAGGCCCCGGCTCTGCGGG - Intronic
1057257014 9:93557989-93558011 GGCAGGGGCAGAGGCTTTGCAGG + Exonic
1059868580 9:118545494-118545516 GCCAGTGGGGGCTGCTCTGATGG - Intergenic
1060206290 9:121684660-121684682 GGCAGCGGGGCCGGCTCTGCAGG - Intronic
1060468738 9:123930173-123930195 GGCAGCGGCGGCGGCAGCGCGGG - Intergenic
1061196300 9:129108947-129108969 GGCAGTGGCGATGGCTGTGGTGG + Intronic
1061223610 9:129267192-129267214 GGGAGTGGCCGCGGCCCTTCTGG + Intergenic
1061303817 9:129721428-129721450 GGCTGTGAGGGTGGCTCTGCTGG + Intronic
1061395896 9:130343180-130343202 GGCAGTGGCGGGGGCTGAGGAGG - Intronic
1062004577 9:134232828-134232850 GGCAGGGGAGGAGGCTCTGCGGG + Intergenic
1062334046 9:136057127-136057149 GCCCGTGGCGTTGGCTCTGCCGG + Intronic
1062378278 9:136274789-136274811 GGCAGTGGGGTGGGCACTGCGGG - Intergenic
1062497780 9:136839748-136839770 GGGGGTGGGGGCGGCTCGGCAGG - Exonic
1062651232 9:137578805-137578827 GGCAGTAGAGGCGGGTCGGCGGG + Exonic
1185736646 X:2500933-2500955 GGAAGCGGCGGCGGCGCGGCCGG - Exonic
1186846567 X:13536618-13536640 GGCAGTGGGGGATGTTCTGCTGG - Intergenic
1187226036 X:17375959-17375981 GGCAGTGGCGGCGGCGGCGGTGG - Exonic
1187505856 X:19877890-19877912 GGAAGTGGTGGGGGCACTGCTGG - Intronic
1187835764 X:23430435-23430457 GGCAGTGGTGGCTGTGCTGCAGG + Intergenic
1188064858 X:25646336-25646358 GGCGGGGGCGGCGGCTCAGCTGG + Intergenic
1188331878 X:28882637-28882659 TGCAGTGGCGGGGGCTCAGCTGG - Intronic
1190474410 X:50813155-50813177 GGCAGTGGCGGCGGCGGCGGCGG + Intronic
1192204757 X:69088482-69088504 GGCGGTGGCCACGGCTATGCAGG - Intergenic
1192504007 X:71670019-71670041 GGCTGTGGCTGCCGCACTGCTGG + Intergenic
1192509967 X:71715866-71715888 GGCTGTGGCTGCCGCACTGCTGG - Intronic
1192516730 X:71765687-71765709 GGCTGTGGCTGCCGCACTGCTGG + Intronic
1192529100 X:71870990-71871012 GGCTGTGGCTGCCGCGCTGCTGG - Intergenic
1192657049 X:73003225-73003247 GACAGTGGCGGCGGCGGTGGCGG + Intergenic
1192665071 X:73079776-73079798 GACAGTGGCGGCGGCGGTGGCGG - Intergenic
1193276148 X:79590325-79590347 TTCAGTGGGGGCCGCTCTGCTGG + Intergenic
1193515044 X:82452337-82452359 GTCAGTGGAGGCCACTCTGCTGG - Intergenic
1193953982 X:87835647-87835669 GGCAGTGGCAGCTGCGCTGCAGG + Intergenic
1195138177 X:101931788-101931810 GGCGGCGGCGGCGGCTTTGGCGG - Intronic
1196791591 X:119469128-119469150 GGCAGCGGCCGCGGCTGCGCGGG - Intronic
1196814281 X:119652823-119652845 GGCAGGGGCGGGGGCGCTGGGGG - Intronic
1198759009 X:140011790-140011812 GTCTGTGGAGGCTGCTCTGCTGG + Intergenic
1199978809 X:152909584-152909606 GGCAGTGGCGGTGGCACCCCTGG - Intergenic
1199989219 X:152975684-152975706 GGCAGTGACCGCAGCTGTGCAGG - Intergenic
1200107563 X:153723699-153723721 CGCAGAGGCGGGCGCTCTGCGGG + Exonic
1200358582 X:155578225-155578247 GGCAGTGGTGGCTGCACTGTGGG - Intronic