ID: 1175816955

View in Genome Browser
Species Human (GRCh38)
Location 20:61888172-61888194
Sequence GTGTGTACCGGCAGTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175816955_1175816962 10 Left 1175816955 20:61888172-61888194 CCGCCGCCACTGCCGGTACACAC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816955_1175816963 14 Left 1175816955 20:61888172-61888194 CCGCCGCCACTGCCGGTACACAC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1175816963 20:61888209-61888231 TGAAATGAGACTCCGCAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 97
1175816955_1175816961 -10 Left 1175816955 20:61888172-61888194 CCGCCGCCACTGCCGGTACACAC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1175816955_1175816964 21 Left 1175816955 20:61888172-61888194 CCGCCGCCACTGCCGGTACACAC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1175816964 20:61888216-61888238 AGACTCCGCAGGCAGGATCCCGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175816955 Original CRISPR GTGTGTACCGGCAGTGGCGG CGG (reversed) Intronic
900928141 1:5718935-5718957 GTGTGTTCACGCAGTGGTGGCGG - Intergenic
907431815 1:54416577-54416599 GTGAGTACAGGGAGTGGCAGTGG + Intergenic
907493441 1:54825820-54825842 GTGGGTGCCAGCAGTGGCAGTGG + Intronic
907665686 1:56432321-56432343 GTCTTTACCGCCAGTGGCTGAGG - Intergenic
912495497 1:110088891-110088913 GTGGGTGCTGGCAGTGGTGGCGG + Intergenic
914946455 1:152071115-152071137 GTTTGTACAGGCAGTGTGGGTGG - Intergenic
915165363 1:153945334-153945356 GTGTGTGGTGGCGGTGGCGGTGG + Intronic
915568209 1:156728586-156728608 GTGAGGAGCGGCAGTGGCGGCGG + Exonic
917329741 1:173868643-173868665 GTGTGTCCCGGCTGCGGTGGGGG - Intronic
919678400 1:200409650-200409672 GGAGGTACCGGCAGTAGCGGTGG - Exonic
920331547 1:205211670-205211692 GTTTGCAACGGCAGTGACGGAGG - Intergenic
1062801931 10:387473-387495 GTGTGGACAGGCAGTGCGGGCGG + Intronic
1063367639 10:5500778-5500800 CTGTGTACGGGCAGGGGCTGGGG - Intergenic
1069830212 10:71278451-71278473 GTGTGTACGGGCGGTGGGGGTGG - Intronic
1070751225 10:78965205-78965227 GTGTGTGCTGGCAGGGGAGGGGG - Intergenic
1077322811 11:1949864-1949886 GGGTGTGCCGGCAGTGGCAGGGG + Intronic
1082281840 11:50278907-50278929 GTGTGCACCTGCTGTAGCGGCGG + Intergenic
1085593777 11:77789982-77790004 GTGTGTACTGGTGTTGGCGGTGG - Intronic
1088815357 11:113416992-113417014 CTGTGTACCTGCAAGGGCGGGGG + Exonic
1089046329 11:115504340-115504362 GTGTGCGGCGGCAGCGGCGGCGG - Exonic
1091109059 11:132948409-132948431 CTGTGTTACGGCAGTGGGGGTGG + Intronic
1202805829 11_KI270721v1_random:5177-5199 GGGTGTGCCGGCAGTGGCAGGGG + Intergenic
1091666068 12:2419409-2419431 GGGTGTTCAGGCCGTGGCGGTGG - Intronic
1105299209 13:19117739-19117761 ATGTGTACTGTCGGTGGCGGGGG - Intergenic
1107936733 13:45351698-45351720 GTATGTGCTGGCAGTGGTGGGGG + Intergenic
1108578923 13:51812167-51812189 GAGTGGACCGGCAGGGGCCGTGG - Intergenic
1109134182 13:58625912-58625934 GTGTGTCCAGGCACTGGCAGTGG - Intergenic
1113133844 13:107067410-107067432 GGGTGTACTGGCACTGGCGGTGG + Intergenic
1116042516 14:39702867-39702889 CTGGGTACCAGCAGTGGTGGCGG + Intergenic
1119606330 14:76021119-76021141 GTGTGTGCTGGCAGTGGTGGTGG + Intronic
1120858464 14:89233601-89233623 GTGTTTACTGGGAGTGGAGGGGG - Intronic
1128310928 15:66631392-66631414 GTGTGTAGCGGCAGTGGTCAGGG + Intronic
1128979352 15:72175285-72175307 GTGTGTACCCGCACAGCCGGAGG - Intronic
1129743761 15:78003668-78003690 GTGTGTACCTGCAGTGCACGAGG - Intronic
1131520208 15:93108855-93108877 GGGTGAACCGGTAGTTGCGGGGG - Intergenic
1132641596 16:980851-980873 GGGTGGTCCGGCAGAGGCGGAGG - Intronic
1135037022 16:19086830-19086852 GTGTGCACGGCCAGAGGCGGAGG + Intergenic
1137466862 16:48717792-48717814 GTGTGTGGCAGCAATGGCGGAGG + Intergenic
1138223933 16:55276490-55276512 GTGTGGAGGGGCTGTGGCGGGGG + Intergenic
1139260663 16:65590436-65590458 ATGTGAACCGACAGTGGCTGGGG + Intergenic
1139580890 16:67873063-67873085 GTGGGTGCCGGAAGTGGAGGCGG + Exonic
1139953570 16:70683142-70683164 CTCTGTCCCGGCAGTGGCTGTGG + Intronic
1141144268 16:81518037-81518059 GTGTGTGCTGGAAGTGGAGGAGG + Intronic
1141388862 16:83647765-83647787 GTGGGTACCAGCAGTGGTGCTGG + Intronic
1146581108 17:34039884-34039906 GCGTGGAGCGGCAGCGGCGGCGG - Intronic
1148178078 17:45584877-45584899 GTGGGCAGCGGCAGCGGCGGCGG + Intergenic
1151203584 17:72488155-72488177 GTGTGGACTGGCGGTGGAGGTGG - Intergenic
1152567920 17:81108400-81108422 GTGTGTACAGGCAGCGGGTGGGG + Intronic
1153128914 18:1832002-1832024 GTGTGAAGCGTCAGTGCCGGAGG - Intergenic
1154013447 18:10595313-10595335 CCGTGTGCCAGCAGTGGCGGGGG + Intergenic
1154152671 18:11918908-11918930 CTGTGTGCCAACAGTGGCGGGGG + Intergenic
1155715116 18:28932796-28932818 GTGTGTGTTGGCAGTGGGGGAGG + Intergenic
1157417908 18:47521347-47521369 GTGGGCAGCGGCAGTGGCAGTGG + Intergenic
1160177950 18:76611555-76611577 GTGTGTGCCTGCGGTGGAGGGGG + Intergenic
1160177962 18:76611644-76611666 GTGTGTGCTTGCGGTGGCGGGGG + Intergenic
1160177973 18:76611723-76611745 GTGTGTGCCTGCGGTGGCGGGGG + Intergenic
1160177984 18:76611798-76611820 GTGTGTGCCTGCGGTGGAGGGGG + Intergenic
1160177993 18:76611861-76611883 GTGTGTGCCTGCGGTGGAGGGGG + Intergenic
1160178003 18:76611920-76611942 GTGTGTGCCTGCGGTGGAGGGGG + Intergenic
1160178013 18:76611985-76612007 GTGTGTGCCTGCGGTGGAGGGGG + Intergenic
1160178023 18:76612044-76612066 GTGTGTGCCTGCGGTGGCGGGGG + Intergenic
1162009539 19:7803994-7804016 GTAAGTACCGGCTGTGGCTGGGG + Intergenic
1162758339 19:12873809-12873831 GTGTGGCCCGGCAGTGGCGGCGG - Exonic
1164594644 19:29525401-29525423 GTGAGTGACGGCAGGGGCGGCGG - Intergenic
1167366406 19:49057060-49057082 GCGTGCACCGGCCATGGCGGGGG + Intronic
1167613481 19:50518307-50518329 GGGGGCACCGGCAGCGGCGGGGG - Exonic
1168476817 19:56681952-56681974 GTGAGAACAGGCAGTGGCAGAGG + Intergenic
1168543656 19:57232464-57232486 GTGTGACCAGGCAGTGACGGTGG + Intronic
1168679649 19:58305353-58305375 GTGCGTACCGGAAGTGCCGGCGG + Intronic
927219147 2:20690675-20690697 GTGTGTGGTGGCACTGGCGGGGG + Intronic
932014178 2:68007659-68007681 GTGTGTGGGGGCAGTGGGGGAGG + Intergenic
932332772 2:70907443-70907465 GTGTGAGCCGGCAGGGGCAGGGG - Intronic
937204590 2:120227284-120227306 GTGTGTGCTGGCAGTGGGGGGGG - Intergenic
942462007 2:176175121-176175143 GTGTGTACCGCCGGCGGTGGCGG - Intergenic
943117465 2:183691512-183691534 CTGTGTGCTGGCAGTGGTGGTGG - Intergenic
943725326 2:191246087-191246109 GTGTGCCCCGGCGGCGGCGGGGG + Intronic
945034062 2:205689005-205689027 GTGTGTACAGGGAGTGGAGAAGG + Intronic
945864561 2:215161829-215161851 GTGTGGAGAGGGAGTGGCGGTGG - Intergenic
946219857 2:218217191-218217213 CGGTGAAGCGGCAGTGGCGGCGG + Exonic
1168814551 20:728065-728087 GTGTGTCCCGGAGGCGGCGGTGG - Intergenic
1169598275 20:7226134-7226156 GTGGGTACCCACAGTGGTGGTGG + Intergenic
1173018711 20:39249266-39249288 GTGTGTAAAGGAAGTGGTGGTGG - Intergenic
1174863763 20:54116064-54116086 GTGTGTAGTGGGGGTGGCGGGGG - Intergenic
1175198144 20:57260315-57260337 GTGTGTAGAGGCAGTGACTGGGG - Intronic
1175816955 20:61888172-61888194 GTGTGTACCGGCAGTGGCGGCGG - Intronic
1176069495 20:63218726-63218748 GTGGGTCCGGGCAGTGGCTGTGG - Intergenic
1176256014 20:64153338-64153360 GTGTGTGCTGGCAGAGGAGGCGG + Intronic
1182520848 22:30883789-30883811 GGGTGTAAGGGCGGTGGCGGAGG - Intronic
952815357 3:37442679-37442701 GTCTGTGCCAGCAGTTGCGGAGG - Intergenic
954428684 3:50457654-50457676 GTGTGTTGAGGCAGTGGCAGAGG - Intronic
957586933 3:82144875-82144897 GTGTGTACACTCAGTGGAGGAGG - Intergenic
958645756 3:96871670-96871692 TTGTGTACTGGAAGTGGTGGTGG + Intronic
959038025 3:101387649-101387671 GAGTGCACAGGCAGTGGCTGTGG - Intronic
959043112 3:101441479-101441501 GTGTGTATGGGCTGTGGTGGTGG - Intronic
962919136 3:139935423-139935445 GTGGGGAGCGGCAGCGGCGGTGG + Exonic
968634591 4:1671447-1671469 GTGAGTCCCGGCTGTGGCTGTGG - Intronic
968634614 4:1671559-1671581 GTGAGTCCCGGCTGTGGCTGTGG - Intronic
971043346 4:22778784-22778806 GTGTGGACCGGCAGTGCTGGGGG + Intergenic
971403658 4:26300235-26300257 GTGTGTATGGGCAGGGGTGGGGG + Intronic
974054664 4:56973547-56973569 CTGTGTACATGGAGTGGCGGGGG + Intronic
975668101 4:76754027-76754049 GTGTGTACAGGATGTGGGGGCGG + Intronic
977381638 4:96281883-96281905 GTGTGTGTTGGCAGTGGCGGGGG - Intergenic
984057567 4:174948809-174948831 GTTTGTACCAGCAGTGGTGATGG + Intronic
985658591 5:1144428-1144450 GTGGGTGGGGGCAGTGGCGGCGG - Intergenic
993944173 5:94097851-94097873 GTGTGTACCAGCGGTGGGGTGGG - Intronic
1000765816 5:165287056-165287078 GTGGGTGCCAGCAGTGGTGGTGG - Intergenic
1004843765 6:19615356-19615378 GTGTGTAATGGCAGTAGCAGTGG - Intergenic
1006679392 6:35786603-35786625 GTGTGTAGGGGGAGGGGCGGTGG + Intronic
1006930583 6:37685698-37685720 ATGTGAACCGACAGTGTCGGGGG + Intronic
1007851132 6:44803789-44803811 GAGTGTCCTGGCAGTGGTGGAGG + Intergenic
1008092752 6:47309383-47309405 GCGTGGACCGGGGGTGGCGGCGG - Intronic
1008369184 6:50714135-50714157 GTGTGTGGCGGCGGCGGCGGTGG + Intronic
1012555336 6:100504931-100504953 GTGTGTGGAGGCAGTGGTGGTGG + Intergenic
1018210164 6:161473557-161473579 GTGGTTACCGGAAGTGGTGGGGG + Intronic
1018375837 6:163211903-163211925 GCGTCTACCTGCAGTGGCAGAGG + Intronic
1023531566 7:41162024-41162046 GTGTGCAACGGAAGTGGCAGTGG + Intergenic
1033412587 7:141132601-141132623 GTGGGCACCAGCAGTGGCAGTGG - Intronic
1037529360 8:19757999-19758021 GTGTGTGCTGGAGGTGGCGGTGG - Intronic
1038960190 8:32509830-32509852 GTGTGTACTGGAGGTGGTGGTGG + Intronic
1039177727 8:34828127-34828149 GAGTGACCCGGCAGTGGAGGCGG + Intergenic
1043555031 8:81420906-81420928 GTGGGTTCAGGCAGTGGAGGAGG + Intergenic
1049189394 8:141278549-141278571 GTGAGCACCTGCAGTGGAGGTGG + Intronic
1049278435 8:141731654-141731676 GTGTGTCCCAGCAGGGGTGGAGG - Intergenic
1052200656 9:25775077-25775099 GTGTGTACTGGGTGTAGCGGGGG - Intergenic
1057379340 9:94554336-94554358 ACGTGTACTGCCAGTGGCGGTGG - Intergenic
1057744608 9:97741307-97741329 GACTGTCCCGGCAGGGGCGGAGG - Intergenic
1061874618 9:133537486-133537508 GCGTGTTCCCGCAGTTGCGGGGG + Exonic
1188154437 X:26723227-26723249 GTGGGTACTGGCAGTGGCAGTGG - Intergenic
1190255523 X:48759574-48759596 GTGTGTACCTGCAAGGGTGGGGG + Intergenic
1190328229 X:49219611-49219633 GTGAGTGCCGGAAGTGGCAGGGG - Intronic
1192241391 X:69332552-69332574 GTGTGTGCCAGCAGTGTCTGTGG + Intergenic
1196763195 X:119218782-119218804 GTGTGTAGAGGCAGTGAAGGTGG - Intergenic
1198309974 X:135421633-135421655 GGGTGGAGCGGCAGTGGAGGAGG - Intergenic