ID: 1175816961

View in Genome Browser
Species Human (GRCh38)
Location 20:61888185-61888207
Sequence CGGTACACACAGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175816951_1175816961 6 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1175816952_1175816961 0 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1175816953_1175816961 -1 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1175816955_1175816961 -10 Left 1175816955 20:61888172-61888194 CCGCCGCCACTGCCGGTACACAC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG 0: 1
1: 0
2: 0
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175816961 Original CRISPR CGGTACACACAGATGGGACA TGG Intronic
904776553 1:32911877-32911899 GGGTACACACATTTGGAACATGG - Intergenic
905119036 1:35667606-35667628 CGGTGCATACACATGGGGCAGGG - Intergenic
906650678 1:47510338-47510360 CGTTAAACAAAGATGGGATAAGG + Intergenic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
921278707 1:213544533-213544555 GGGAACACACAGAGGGGCCACGG - Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1065512033 10:26488917-26488939 GTGTACATACACATGGGACAAGG - Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG + Exonic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1076404030 10:130200767-130200789 AGGTACACAGAGAAAGGACACGG + Intergenic
1076493115 10:130877228-130877250 CGGTTCACACAAATGGCTCATGG + Intergenic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG + Exonic
1084629310 11:70335879-70335901 CCATACACACAAATGGGGCATGG - Intronic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1102962340 12:117100714-117100736 CGGTGCCCACAGAGGGGACTCGG + Intergenic
1103172752 12:118835661-118835683 GGAAACACACAGAAGGGACACGG + Intergenic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG + Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114223787 14:20720502-20720524 CGGTACACACAGTTGGGCATTGG - Intergenic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1119535274 14:75397793-75397815 CAGTTCAGACAGAGGGGACAAGG + Intergenic
1121230449 14:92353866-92353888 CGGCACAGGCAGCTGGGACAGGG - Intronic
1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG + Intronic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG + Intronic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1132959751 16:2615212-2615234 AGGAACCCACATATGGGACATGG - Intergenic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG + Intergenic
1138473873 16:57259219-57259241 TGGTACAAAGAGATGGGTCATGG - Intronic
1138804971 16:60081168-60081190 GGTCACACACAGATGGGACGCGG - Intergenic
1139458727 16:67105369-67105391 CAGTACACAGTGGTGGGACAGGG + Intergenic
1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG + Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1148123819 17:45226815-45226837 GGGTCCCCACAGCTGGGACAAGG - Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155718258 18:28973918-28973940 GGGTACAGTCAGATGGGAGATGG + Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160973236 19:1779703-1779725 CCAGACACACAGATGCGACACGG - Exonic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1162262232 19:9542572-9542594 GGGGTCCCACAGATGGGACATGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1166302239 19:41917878-41917900 TCGTGCACCCAGATGGGACAGGG - Intronic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
936666649 2:114604465-114604487 CTGTACACGCAGATGGGTCAGGG - Intronic
937604321 2:123778892-123778914 CAATACACAACGATGGGACAAGG + Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG + Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
941174885 2:162184541-162184563 CGGGACAAACAGATGGGAAGAGG + Intronic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1175460313 20:59147433-59147455 GGATACACCCAGAGGGGACAAGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG + Intronic
1181010127 22:20035392-20035414 CAGTGCTCACAGCTGGGACATGG - Intronic
1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG + Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1184219234 22:43088641-43088663 CGGTACAAAAAGATGGGCCCCGG - Intronic
1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG + Intronic
952034296 3:29180773-29180795 AGGTACAATCAGAAGGGACAAGG + Intergenic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
962752466 3:138443912-138443934 GGGTCCACACAGATGGGTCTGGG - Intronic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
966239173 3:177736898-177736920 CGGTGCACACAGATGTGATGTGG - Intergenic
967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG + Intergenic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
968903162 4:3440548-3440570 TGGTACACACAGCTGGCACTGGG - Intergenic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
970781792 4:19746336-19746358 CAGTACACAAATATGAGACAGGG - Intergenic
971200156 4:24503343-24503365 CGTCCCGCACAGATGGGACACGG - Intergenic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG + Intronic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
986705528 5:10451594-10451616 CGCCACACTCAGATGTGACATGG - Intronic
991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG + Intronic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
998672126 5:144365812-144365834 TGGTACACACAGATAGGCTAAGG - Intronic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1021644456 7:22774936-22774958 CTGTACACCTAGCTGGGACATGG - Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1027806509 7:82832175-82832197 CAATACATAAAGATGGGACATGG + Intronic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1035651650 8:1270237-1270259 CCGTATACACAGAAGGGACTTGG + Intergenic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG + Intergenic
1039823190 8:41151896-41151918 CAGTACAAACAGACTGGACAGGG - Intergenic
1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG + Intergenic
1042035834 8:64533028-64533050 CGAAACACACAGATGGCAAATGG + Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1046294137 8:112198155-112198177 GGTTCCACAAAGATGGGACATGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049194349 8:141307577-141307599 CGGTCCAGACAGAGGGGAGAGGG + Intronic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1189755896 X:44271013-44271035 AGGTTCACACACTTGGGACAGGG - Intronic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic
1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG + Exonic
1199631012 X:149776600-149776622 CGGTACCCAGAGATGGCAAAAGG - Exonic
1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG + Intergenic