ID: 1175816962

View in Genome Browser
Species Human (GRCh38)
Location 20:61888205-61888227
Sequence TGGATGAAATGAGACTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175816952_1175816962 20 Left 1175816952 20:61888162-61888184 CCCTGCAGAGCCGCCGCCACTGC 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816953_1175816962 19 Left 1175816953 20:61888163-61888185 CCTGCAGAGCCGCCGCCACTGCC 0: 1
1: 0
2: 3
3: 56
4: 441
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816956_1175816962 7 Left 1175816956 20:61888175-61888197 CCGCCACTGCCGGTACACACAGA 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816960_1175816962 -2 Left 1175816960 20:61888184-61888206 CCGGTACACACAGATGGGACATG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816955_1175816962 10 Left 1175816955 20:61888172-61888194 CCGCCGCCACTGCCGGTACACAC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816957_1175816962 4 Left 1175816957 20:61888178-61888200 CCACTGCCGGTACACACAGATGG 0: 1
1: 0
2: 0
3: 15
4: 82
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1175816951_1175816962 26 Left 1175816951 20:61888156-61888178 CCACATCCCTGCAGAGCCGCCGC 0: 1
1: 0
2: 0
3: 34
4: 230
Right 1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175816962 Original CRISPR TGGATGAAATGAGACTCCGC AGG Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901783909 1:11612075-11612097 GGGAAGAAATGAGACTGGGCAGG + Intergenic
902490173 1:16775729-16775751 TGGATGCAAGGAGACTGTGCTGG - Intronic
904277244 1:29392519-29392541 TGGGTGAAATCAGACTATGCAGG - Intergenic
910523004 1:88144866-88144888 TGGATGAATTCAGCCTCCACAGG + Intergenic
912118758 1:106441735-106441757 TGGATGAGCTGAGACTCCAGAGG + Intergenic
923530265 1:234806801-234806823 TGGATGCAAGGAGACTGTGCTGG + Intergenic
1062895521 10:1100396-1100418 TGGATGAAATGAGGCTCCTTAGG + Intronic
1064973398 10:21088994-21089016 TGGGTGAAATGAGGGTCCCCTGG + Intronic
1067330288 10:45309370-45309392 TGGATGAAATGAGATCAAGCAGG - Intronic
1067778767 10:49182588-49182610 TGGATGGAATTAGAGTCCACAGG + Intronic
1068579741 10:58725688-58725710 TGGATGAGATGAGGATCCACAGG - Intronic
1071579252 10:86755666-86755688 TGGACGGAATGAGCCTCCGGAGG + Intergenic
1075005594 10:118827687-118827709 AGGATTAAATGAGACAACGCAGG + Intergenic
1075635103 10:124025393-124025415 TGGATGAAAAGAGACTCCTTTGG + Intronic
1077847047 11:6036964-6036986 TGGATGAAATGAGAATGCAATGG - Intergenic
1079104355 11:17560938-17560960 TGGATCTAATGAGACTCCCCTGG - Intronic
1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG + Intronic
1081650054 11:44817895-44817917 TGGATGAAATGAAACCACACTGG - Intronic
1082306138 11:50578135-50578157 TGAATGAAAAGAGACTCTGCAGG + Intergenic
1082812243 11:57485424-57485446 TGGCTGAGATGAGACTTCTCAGG + Intronic
1086612986 11:88779392-88779414 TGGAATACATCAGACTCCGCTGG + Intronic
1090857669 11:130624371-130624393 TGGATAAAATGAGACTCTTCTGG - Intergenic
1100617821 12:96244967-96244989 TGGCGTAAATGAGACCCCGCGGG + Intronic
1101443422 12:104720241-104720263 AGGATAAAATTAGACTCTGCAGG - Intronic
1101761463 12:107662295-107662317 TGGATGACACGAGACTCCCATGG + Intergenic
1102848075 12:116209347-116209369 TGGATTAAATGAGACCCCTAAGG + Intronic
1105545217 13:21346325-21346347 TGCATGTAATTAGACTCCGAAGG + Intergenic
1107542241 13:41401809-41401831 TGGATGAATTGAGACTCCACTGG - Intergenic
1108062328 13:46545764-46545786 TAAATGAAATGATACTCTGCAGG - Intergenic
1110805226 13:79746726-79746748 TGAATGAGATGAGAATCCACTGG + Intergenic
1111906040 13:94257388-94257410 TAGATGAAATGAGAGTCTCCTGG + Intronic
1112376635 13:98848389-98848411 GAGGTGAAATGAGACTTCGCCGG + Intronic
1123787875 15:23690605-23690627 TGGATGAAATGTGAATCCTCTGG + Intergenic
1134875994 16:17699219-17699241 TGGATGAAATGTGACACAGCTGG - Intergenic
1140139980 16:72246363-72246385 TGGATAACATCAGACTCCTCAGG + Intergenic
1143336033 17:6172099-6172121 AGGAGGAAATGGGTCTCCGCGGG - Intergenic
1143810361 17:9466766-9466788 TGGTTGAATTGAGATTCCCCAGG - Intronic
1143976727 17:10835798-10835820 AGGATTAAAAGAGACTCCCCAGG - Intronic
1145060234 17:19728623-19728645 TGGATTAAATGAGATTGTGCAGG - Intergenic
1146815624 17:35939791-35939813 TGGATGAAATGAGATTGGCCAGG - Intronic
1162503251 19:11066738-11066760 TGGGGGACATGAGACTCCTCAGG + Intergenic
1163008345 19:14410084-14410106 GGGAGGAAAGGAGGCTCCGCCGG + Intronic
929406074 2:41642755-41642777 TGGATGAAATGATTATCAGCTGG - Intergenic
929406208 2:41644800-41644822 TGGATGAAATGATCATCAGCTGG - Intergenic
931686160 2:64795975-64795997 TGGATGAAATGCCACACCGCAGG - Intergenic
933223420 2:79717237-79717259 TGGATGGAAAGAAACTCCACAGG + Intronic
940800188 2:158124478-158124500 TGGGTGAAATGAGAAGCCACTGG + Intronic
946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG + Intergenic
946559848 2:220900277-220900299 GGGATGAAATGAAAACCCGCAGG - Intergenic
1168835894 20:877082-877104 TGGCTTAAATGGGACTCAGCTGG + Intronic
1169321274 20:4635115-4635137 TGGATGTAAGGAGAAGCCGCTGG - Intergenic
1171147994 20:22802633-22802655 TCCATGAAATGAGACTGGGCTGG - Intergenic
1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG + Intronic
1178069016 21:28940789-28940811 TGGATAAAATGAGATTAGGCTGG + Intronic
1183573677 22:38673202-38673224 TGGATGAACTGAGGATCAGCCGG + Exonic
950304223 3:11905915-11905937 TGAATGAAAAGAGACGCCACAGG - Intergenic
951740815 3:25921301-25921323 TGGCTGAAATGAGAATCATCTGG - Intergenic
952001612 3:28792084-28792106 CAGCTGAAATGAGACACCGCAGG - Intergenic
952305914 3:32145965-32145987 TGGATGAAATGAGACTGGCCAGG - Intronic
955209625 3:56928670-56928692 TAGATGAACTGAGACACAGCAGG + Intronic
955371261 3:58354140-58354162 TGGAGGAAATGAGTCTCTGAAGG - Intronic
957319142 3:78606735-78606757 TGGATGAGATGAGTCTTTGCTGG + Exonic
958580853 3:96020292-96020314 TAGAAGAAATGACACTGCGCTGG + Intergenic
964741000 3:159965856-159965878 TAGATGAAAATAGACTCTGCCGG - Intergenic
965376172 3:167926974-167926996 TGAATGGAATAAGACTCCCCCGG + Intergenic
975092089 4:70415938-70415960 TGGAGGTAATGAGACTCCGAAGG + Intergenic
982147575 4:152413554-152413576 TGCATGAAAGGAGACTCAGTTGG - Intronic
983876474 4:172882519-172882541 TGGAGCAAATGTGACTCTGCAGG + Intronic
986790767 5:11157470-11157492 TGGAAGAAATGGCACTCAGCCGG - Intronic
994491832 5:100457464-100457486 TGTGTGAAATGAGAGTCAGCTGG - Intergenic
999286525 5:150397497-150397519 AGGTAGAAATGAGACTCAGCAGG + Intronic
1001270223 5:170305562-170305584 TGGATCAGATGAAACTCTGCAGG - Intergenic
1003126362 6:3359200-3359222 AGAATGAAATGAGTCTCAGCTGG - Intronic
1003256806 6:4482397-4482419 TGTAAGAAATGAAACTCCCCAGG + Intergenic
1004557580 6:16714331-16714353 TGACTGAAATGAGACACAGCTGG + Intronic
1005611690 6:27531983-27532005 TTGATGGAAGGAGACTACGCGGG - Intergenic
1007602324 6:43090235-43090257 TGGATCAAAGGAGCCTCCTCAGG + Intronic
1015721825 6:136250325-136250347 AGGACGAAATCAAACTCCGCGGG + Intronic
1017676583 6:156820572-156820594 TGGATTAAATGAGATACCACAGG - Intronic
1021949382 7:25760107-25760129 TTGATGAAATGACACTCGGCAGG - Intergenic
1025790440 7:64682748-64682770 AGGAAGAAATGAGACTCTGGAGG - Intronic
1030085547 7:105812247-105812269 TGGCTGAAATGGGACTCTTCTGG + Intronic
1030688711 7:112511335-112511357 AGCATGAAATGAGACAACGCTGG - Intergenic
1035287101 7:157813631-157813653 AGGAAGAAATGCGACTCCCCCGG - Intronic
1039608226 8:38900386-38900408 TGGATCAAATGAGATAGCGCAGG + Intergenic
1046628247 8:116598079-116598101 TGGAGGAAGCGAGACTCCACTGG - Intergenic
1050369875 9:4909831-4909853 TGGATGAAATAAGATTCTGTTGG - Intergenic
1058746759 9:107999172-107999194 TGGATGTAATGCGACACCGTGGG - Intergenic
1191777347 X:64829895-64829917 TGAATGAAATTAGATTCCTCTGG + Intergenic
1192089259 X:68135485-68135507 TGAATGAAATGAGAAACCACTGG + Intronic
1195392299 X:104375243-104375265 TCAATGAAATTAGACTCAGCTGG - Intergenic