ID: 1175817374

View in Genome Browser
Species Human (GRCh38)
Location 20:61890368-61890390
Sequence ATGGGTAAGCAGATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175817374 Original CRISPR ATGGGTAAGCAGATGGTGGA TGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901370032 1:8789200-8789222 TTGGGGAAGCCGATGGGGGAGGG + Intronic
902202562 1:14844859-14844881 ATGGGTGAGTAGGTGGTGAATGG + Intronic
902268593 1:15287072-15287094 ATGGGGAAGGACATGATGGACGG + Intronic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
904004310 1:27355704-27355726 ATAGGTGAGCAGAGTGTGGAGGG + Exonic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
904576635 1:31509243-31509265 ATGGTGTAGCAGATGGTGGCAGG - Intergenic
905399175 1:37689639-37689661 AGGCGTAAGCAGCTGGTGGCTGG - Exonic
906666973 1:47628762-47628784 GTGGGTATGCAGGTGGTGGCTGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909201331 1:72693420-72693442 ATGTGTCAGCAGATAGTGGGAGG + Intergenic
912560453 1:110547904-110547926 TTAGGTCAGCAGATGGTTGAGGG - Intergenic
914351262 1:146842578-146842600 ATGGATGAGTAGATGATGGATGG + Intergenic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
919833844 1:201560392-201560414 AGGGATATGCTGATGGTGGAGGG - Intergenic
920249284 1:204612336-204612358 ATGGGTAAGAATATACTGGATGG + Intergenic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
920724307 1:208419508-208419530 TTGGGGAAGCAGATGGGGGTGGG - Intergenic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922428029 1:225517746-225517768 ATGGGGAAGAACAGGGTGGAAGG + Intronic
923446126 1:234072938-234072960 ATGGCAAAGCAGATGGTGGGAGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063040923 10:2336478-2336500 GGTGGTAAGCAGATGATGGATGG + Intergenic
1063862186 10:10323076-10323098 AAGGTTAAGTAGATGGTGGATGG + Intergenic
1063957978 10:11283583-11283605 ATGGGTGACTAGATGATGGATGG + Intronic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1065860674 10:29870310-29870332 ATGGTTAGACAGATGGTGGTTGG - Intergenic
1066412026 10:35181087-35181109 ATAGGGAAGCAGATGCTGTAGGG + Intronic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1068656155 10:59578094-59578116 AGTAGTAAGCAGATGGTAGAGGG + Intergenic
1071273513 10:84030808-84030830 ATGGGAAAGCAGATCTTGTAGGG + Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1074529142 10:114285073-114285095 ATTGGAAAGCAGATGGTTCAAGG - Intronic
1075347745 10:121696700-121696722 ATGGAAAAGCAGATCTTGGATGG - Intergenic
1075473764 10:122715406-122715428 AGGGGTAAGATGATGGTGCATGG - Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077159474 11:1106174-1106196 TTGGGTAGGTGGATGGTGGATGG - Intergenic
1077248758 11:1551477-1551499 ATGGATAGGCAGATGATGAATGG - Intergenic
1077418969 11:2440612-2440634 ATGGGGGTGCAGATTGTGGAGGG - Intergenic
1077537557 11:3131754-3131776 ATGGATGGGAAGATGGTGGATGG - Intronic
1077613970 11:3661902-3661924 GTGGGAGAGCAGATGGTTGAGGG + Intronic
1079124647 11:17709838-17709860 AGGGATAAGCAGATTTTGGAGGG + Intergenic
1079410022 11:20178974-20178996 ATAGGTAATAAGATGTTGGAGGG - Intergenic
1080239309 11:30108330-30108352 ATGGTTAAGTAGATTGTGAAAGG - Intergenic
1081765843 11:45609564-45609586 ATGGGTATTCGGATGATGGATGG + Intergenic
1083249416 11:61455916-61455938 ATGGGTGTGCAGATGTGGGAAGG - Intronic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084609817 11:70194932-70194954 ATGGGTGGGTAGATGGTAGATGG + Intergenic
1084637408 11:70400997-70401019 AATGGAAAGCTGATGGTGGACGG + Intronic
1084684656 11:70686492-70686514 ATGGATAGACAGATGATGGATGG - Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085519681 11:77130701-77130723 ACGGGTAAGCATATGGATGAGGG - Intronic
1090338446 11:125992511-125992533 ATGGGAAAGCAGAGCCTGGAAGG - Intronic
1090481597 11:127073801-127073823 ATGGGAAACCACAGGGTGGATGG + Intergenic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1094354105 12:29559265-29559287 ATGGGTGAGCCCATGGTGGAAGG - Intronic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1096254194 12:50052936-50052958 ATGGGTTGGCAGGTGGTGGGGGG + Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1098455415 12:70667463-70667485 ATGGGTAACCAGGGGGTTGATGG - Intronic
1101801078 12:108022397-108022419 ATGGGTAAGCAGATGGGAAATGG - Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104896388 12:132166955-132166977 ATGGGTAGGTGGATGATGGATGG - Intergenic
1104971665 12:132533595-132533617 ATGGGTGAGCAGATGGGTGCGGG - Intronic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1108615834 13:52131133-52131155 ACAGCTAAGCAGATGGCGGATGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112156719 13:96825155-96825177 AGGGTTAAGCTGGTGGTGGAAGG + Intronic
1112659310 13:101489290-101489312 ATGGATAAACACATGGTAGATGG + Intronic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119204590 14:72784569-72784591 TTGGGAAAGAAGATGGTAGAGGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1128308479 15:66615546-66615568 ATGGACAGGCAGATGATGGAAGG + Intronic
1129671057 15:77607857-77607879 ATGGGTGAGCACATGGTGGCGGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130913359 15:88285912-88285934 ATGAGTGAGTAGGTGGTGGATGG - Intergenic
1131683406 15:94747380-94747402 TTGGGGAAGCAGATGTTGAACGG - Intergenic
1132644825 16:994027-994049 ATGGGTGAGTGGGTGGTGGATGG - Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1134105942 16:11486115-11486137 ATGGGTAGACAGATGATGGGTGG + Intronic
1134105983 16:11486306-11486328 ATGGGTAGACAGATGATGGGTGG + Intronic
1134106008 16:11486455-11486477 ATGGGTAGACAGATGATGGGTGG + Intronic
1135489757 16:22899194-22899216 ATGAGGGTGCAGATGGTGGAGGG + Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137798899 16:51244661-51244683 TTGGGTAGGCAGATGGGTGAAGG - Intergenic
1137851880 16:51754233-51754255 ATGGGAAATCTGCTGGTGGATGG + Intergenic
1139620655 16:68138568-68138590 ATGGGAAAGAAGAAGGTGTATGG + Intronic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1139982774 16:70872968-70872990 ATGGATGAGTAGATGATGGATGG - Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1140979405 16:80092487-80092509 ATGGGTGGGTAGATGGGGGATGG - Intergenic
1141110073 16:81265208-81265230 ATGGGTGGACGGATGGTGGATGG - Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141163731 16:81646323-81646345 GTGGGTGAGTAGATGATGGATGG + Intronic
1141319501 16:82994080-82994102 ATGGGTAATTAGATGGAGGGTGG - Intronic
1141402798 16:83765119-83765141 ATATGTAAGCAGATGTGGGATGG - Intronic
1142244761 16:88964981-88965003 ATGGATAAATAGATGGTGGGTGG - Intronic
1142478640 17:204644-204666 ATGGGTCAGTGGGTGGTGGAGGG - Intergenic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1143836998 17:9700664-9700686 GAGGGTAAGCAGTTGCTGGAGGG + Intronic
1144149972 17:12433901-12433923 ATGCGTATGCATATGGAGGAGGG - Intergenic
1146271960 17:31490410-31490432 ATGGGTAAGGAGGGGGTGAAGGG + Intronic
1146404216 17:32523242-32523264 ATGGGAAGGCAGGTGGGGGAGGG + Intronic
1147878137 17:43636213-43636235 CTGGGTAAGCCCATGGTGGGTGG - Intergenic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148202012 17:45755721-45755743 GTGGCTGGGCAGATGGTGGATGG - Intergenic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1152167947 17:78723194-78723216 GTGGGTAAGAGGCTGGTGGATGG - Intronic
1152263879 17:79282185-79282207 ATGGGTGGGGAGGTGGTGGAAGG + Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1153597495 18:6742521-6742543 GTGGATGAGCAGATTGTGGATGG + Intronic
1155041506 18:22069118-22069140 ATGTGTAAGCAGAAGCTGTAGGG - Intergenic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159936897 18:74376192-74376214 ATGGGCAAGCAGGTGGATGATGG + Intergenic
1160049173 18:75415692-75415714 ATGAATAAGCAGATGATTGATGG - Intronic
1160185406 18:76672786-76672808 CTGCGTCAGCACATGGTGGAAGG - Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160687114 19:442266-442288 ATGGGTGAGTGGATGATGGATGG + Intronic
1160692430 19:466161-466183 ATGGTTAGGTAGATGGTAGATGG + Intronic
1160692456 19:466252-466274 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160692499 19:466406-466428 AAGGTTAGGTAGATGGTGGATGG + Intronic
1160692521 19:466493-466515 ATGGTTAGGTAGATGGTGGATGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162220661 19:9173540-9173562 ATGGGTGAGCCCAAGGTGGAAGG + Intergenic
1163152691 19:15424498-15424520 ATGGGTAAGCAACTGGAGAAAGG + Intronic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925260202 2:2522066-2522088 ATGGATGGGCAGATGGGGGATGG - Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
926361704 2:12094152-12094174 ATGGTTTAGCAGAAGGTGCAGGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
929119874 2:38475910-38475932 ATGAGTATAAAGATGGTGGAGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929812838 2:45206271-45206293 ATAGTTCAGCAGAGGGTGGAGGG + Intergenic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
933543676 2:83681431-83681453 CTGGGTAATCAGATACTGGAAGG - Intergenic
934723835 2:96602180-96602202 ATTGGTCAGCAGCTGGTGGATGG + Exonic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936478527 2:112863673-112863695 ATAAGAAAACAGATGGTGGATGG - Intergenic
937161262 2:119764090-119764112 ATGGGTGAGCATATTGGGGAGGG - Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938107690 2:128544597-128544619 ATGGGTAAGCAGAGAGTGTGAGG - Intergenic
938124111 2:128659483-128659505 AGGAGGAAGCATATGGTGGAGGG - Intergenic
940806641 2:158194879-158194901 GTGGATGAGCAGATGGGGGATGG - Intronic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
943466704 2:188237283-188237305 AGGCTTAAGCAAATGGTGGAAGG + Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946074593 2:217063555-217063577 TTGGGAGAGCAGATGGTGGGAGG + Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948592060 2:239056754-239056776 AAGCGTAACCCGATGGTGGAAGG + Intronic
1168857642 20:1019879-1019901 ATAGGTGGGTAGATGGTGGATGG - Intergenic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1171467636 20:25341927-25341949 ATGAGTAAGTAGATTGTGGGAGG - Intronic
1172230773 20:33334154-33334176 ATGGGTAGATGGATGGTGGATGG + Intergenic
1172899096 20:38320998-38321020 ATGGGTAAGTAGATGGGAGGTGG + Intronic
1173031809 20:39367944-39367966 ATGAGGTAGCAGATGGGGGATGG - Intergenic
1173159081 20:40639105-40639127 GTGGGTAGGCAGTTGGTAGAAGG - Intergenic
1173976600 20:47191490-47191512 ATGGATTAGTGGATGGTGGATGG + Intergenic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1175676476 20:60950397-60950419 ATGGGTAAGTGGATGATGGGTGG + Intergenic
1175770477 20:61620244-61620266 ATGGGTAGATAGATGATGGATGG + Intronic
1175770482 20:61620263-61620285 ATGGGTGGGTAGATGGTTGATGG + Intronic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1176033542 20:63025365-63025387 ATGGGAAAGAACATCGTGGAGGG - Intergenic
1176057911 20:63158475-63158497 ATGGGTGAATAGATGGTGGGTGG + Intergenic
1178687559 21:34723414-34723436 ATGGGTAAGGAGCTGATGGAAGG + Intergenic
1183249007 22:36715244-36715266 ATGGGTACGGAGATGGGAGAGGG - Intergenic
1184023253 22:41834789-41834811 ATGGGTTAACAAATGGGGGATGG + Intronic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184414695 22:44345496-44345518 ATGGGTAGGTAATTGGTGGATGG + Intergenic
1184414729 22:44345635-44345657 ATGGGTGAGTAGATGATGGGCGG + Intergenic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1185018805 22:48361283-48361305 ATGGATGAGTAGATGATGGATGG + Intergenic
1185053573 22:48566353-48566375 ATGGGTGGACGGATGGTGGATGG + Intronic
1185146233 22:49138287-49138309 ATGGATGAGTAGATGATGGATGG - Intergenic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
949450747 3:4182187-4182209 ATGGGTAAGCATGGGGTAGATGG + Intronic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950202938 3:11057607-11057629 ATGGGTGAGTGGATGGTGAATGG + Intergenic
950837493 3:15934863-15934885 AAGGCTGAGCAGCTGGTGGAAGG + Intergenic
951541171 3:23783416-23783438 ATGAGAAGGCAGCTGGTGGAGGG + Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952609963 3:35196763-35196785 ACGAGTAAGCTGATTGTGGAAGG + Intergenic
953859106 3:46527101-46527123 AGGGGTCAGCAGATGTTGAAAGG - Intronic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960195929 3:114768037-114768059 ATGGATAATTAGATGGTGCAGGG - Intronic
960673512 3:120173940-120173962 ATGGGTAGGCAGATGGGCTAAGG - Intronic
961606879 3:128102130-128102152 ATTGGTAAGCAGGTGCTGGCAGG - Intronic
962785122 3:138761383-138761405 AGGAGGAAGAAGATGGTGGAAGG + Intronic
963106944 3:141655466-141655488 ATAGCTGAGCAGATGATGGAAGG - Intergenic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
968049253 3:195642873-195642895 AGGGGAAGGCAGATGATGGATGG + Intergenic
968106655 3:196006269-196006291 AGGGGAAGGCAGATGATGGATGG - Intergenic
968305362 3:197647061-197647083 AGGGGAAGGCAGATGATGGATGG - Intergenic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
971719066 4:30221223-30221245 ATTGGTAAGCAGGTGTTGAAAGG - Intergenic
975858492 4:78650525-78650547 ATGGGTAAGGAGATGGGGAGGGG - Intergenic
975876492 4:78844255-78844277 ATGGTTAAGCAGATTGTCCAAGG + Intronic
976205233 4:82617877-82617899 ATAGGTAAAAAGATGGGGGAAGG - Intergenic
976618302 4:87100554-87100576 ATGGGTAACAAGCTTGTGGAGGG - Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
981142339 4:141283032-141283054 GAAGGTAAGCAGATGGTGAATGG - Intergenic
981578316 4:146227713-146227735 ATGGGAAATTAGATGGTGGAGGG + Intronic
982194683 4:152899136-152899158 ATATGTAGGCAGATGTTGGAGGG - Intronic
982772384 4:159408797-159408819 ATGGGAGAGCAGGTGGGGGAAGG - Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984555638 4:181211203-181211225 ATGGGGAAGCAGGTGCTGGTAGG + Intergenic
985529613 5:426294-426316 ATGGATGAGAAGATGATGGATGG + Intronic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985703726 5:1388747-1388769 ATGGGCAGGCAGATGATGGCTGG - Intergenic
985837272 5:2280621-2280643 ATGGGTGGGTAGGTGGTGGATGG + Intergenic
987224957 5:15830788-15830810 AAGGGAGAGAAGATGGTGGAGGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991452966 5:66772200-66772222 AAAGGTAAGAAGATGGTGGGTGG + Intronic
993761563 5:91802411-91802433 ATGCCTAGGCAGATGGGGGAGGG + Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
997371350 5:133363217-133363239 ATGGTTAAGCATGTGGTGGGGGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997749544 5:136330968-136330990 GTGGGTAAGCAGAGGGTTTATGG + Intronic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
1000051123 5:157563678-157563700 ATGGCTAAGTAGATGGGGAATGG + Intronic
1000051243 5:157564618-157564640 AGGAGAAAGCAGATGGGGGAAGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001182920 5:169537805-169537827 ATGTATAAGCACGTGGTGGAAGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001517056 5:172363288-172363310 ATGGGTGATGAGATGGTTGATGG - Intronic
1001669523 5:173462289-173462311 ATGGCTGAGCAGGTGGTGGTGGG + Intergenic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002606354 5:180385188-180385210 AGGGGGAAGAAGACGGTGGAGGG + Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1004185711 6:13419632-13419654 AGGAGGAAGCAGATCGTGGAGGG - Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1006388048 6:33742956-33742978 AAGGGCAAGGAGATGGTGGGAGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1010032501 6:71286257-71286279 AAAGGTATTCAGATGGTGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1013176175 6:107679013-107679035 ATAAGTAAGCAGATGGTAGATGG - Intergenic
1013279811 6:108625547-108625569 ATGGTTAAAAAGATGATGGAAGG + Intronic
1015437019 6:133201345-133201367 ATTGGTAAGCTGAGGGTAGAAGG - Intergenic
1016191105 6:141265638-141265660 ATCAGTAATCAGATGGTGGAGGG + Intergenic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017848544 6:158281831-158281853 AAGAGTCATCAGATGGTGGAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018831984 6:167450248-167450270 ATGGGTAAGCAGAATGTTAATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024160150 7:46665817-46665839 TTGGGGAAGCAGATGGTGTTTGG + Intergenic
1026230401 7:68478255-68478277 ATGGGCAACCTGATGGTGTAAGG + Intergenic
1029654999 7:101918472-101918494 AAGGGGAGGCAGATGATGGAAGG + Intronic
1031496449 7:122454880-122454902 AGGGATAAGCAGATAGTGGCTGG - Intronic
1032464841 7:132137700-132137722 ATGGGTGGGGAGATGGTGGGAGG + Intronic
1032464889 7:132137907-132137929 ATGAGTATGAGGATGGTGGAAGG + Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033409974 7:141108572-141108594 ATGGGGGAGCAGGTGATGGAGGG + Intronic
1033418198 7:141182848-141182870 ATGGCTAAGGAAACGGTGGAAGG - Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1038201030 8:25412908-25412930 ATGAGTATGCAGATTCTGGAAGG + Exonic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1048254096 8:132892252-132892274 AAGGATAGGCAGATGATGGATGG - Intronic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1048736953 8:137512766-137512788 ATGGGAGAGGATATGGTGGATGG + Intergenic
1048989510 8:139753029-139753051 ATGGGTAGATAGATGTTGGATGG - Intronic
1049071407 8:140358600-140358622 AGGGGAAAGCAGTGGGTGGAGGG + Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049400647 8:142425456-142425478 ACATGCAAGCAGATGGTGGATGG - Intergenic
1049474729 8:142791489-142791511 ATGAGTGGGCAGATGGTAGATGG - Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050156638 9:2673851-2673873 AAGGTTAAGTAGATGGTGGGAGG - Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1053008749 9:34621566-34621588 AGGGGTGAGGAGATGGTAGAGGG + Intronic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1056236159 9:84596879-84596901 ATGGGTAAGTAGAAGCTAGAGGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057297507 9:93857988-93858010 ATGGGTAAGTGGATGATGGGTGG + Intergenic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058723643 9:107781950-107781972 ATGGGCAGGGAGGTGGTGGAAGG - Intergenic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061607843 9:131724900-131724922 ATGGGTAAGCACAAGGCAGATGG - Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062171896 9:135139377-135139399 ATGGCAGAGCAGATGCTGGAAGG - Intergenic
1062201271 9:135304094-135304116 ATGGATAGACAGATGATGGAGGG + Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1062394914 9:136348915-136348937 ATGGGTGAGCAGGTGGCAGATGG - Intronic
1185613698 X:1407526-1407548 ATGGGTAGGTAGATGATGGATGG + Intronic
1185638963 X:1575827-1575849 ATGGGTAAGTAGAAAGTGGGTGG + Intergenic
1185842776 X:3408520-3408542 ATGGGTCCTCACATGGTGGAAGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189236236 X:39489450-39489472 ATGGGAAAGCTGATGATGGAGGG - Intergenic
1189351159 X:40276826-40276848 ATGTGTGAGGACATGGTGGAAGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190127732 X:47721715-47721737 ATGGGTGATCGAATGGTGGATGG - Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1192338026 X:70238236-70238258 ATGGCTCAGCAGATAGTTGATGG - Exonic
1196185887 X:112744399-112744421 ATGGCTATGCAGATGGAAGAAGG - Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200952572 Y:8914575-8914597 ATGGGTTAACAGCTTGTGGAAGG - Intergenic
1201016784 Y:9612047-9612069 ATGGGTTAACAGCTTGTGGAAGG + Intergenic
1201071509 Y:10151021-10151043 ATGGGTCCTCACATGGTGGAAGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1202101810 Y:21317114-21317136 ATGGGTTAGCAGCTTGTGTAAGG - Intergenic
1202112092 Y:21432189-21432211 ATGGGTTAACAGTTTGTGGAAGG + Intergenic
1202240641 Y:22764334-22764356 ATGGGTTAGCAGGTTGTGTAAGG + Intergenic
1202393627 Y:24398087-24398109 ATGGGTTAGCAGGTTGTGTAAGG + Intergenic
1202477158 Y:25272013-25272035 ATGGGTTAGCAGGTTGTGTAAGG - Intergenic