ID: 1175818038

View in Genome Browser
Species Human (GRCh38)
Location 20:61893710-61893732
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 3, 1: 4, 2: 18, 3: 139, 4: 867}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900081513 1:861849-861871 ATAAATAGATGGATGATGGATGG + Intergenic
900081529 1:862063-862085 ATAAATAGATGGATGATGGATGG + Intergenic
900498152 1:2985943-2985965 GTGGATGGATGGATGATGGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498754 1:2989403-2989425 GTGGATGGATGGATGATGGATGG - Intergenic
900498762 1:2989441-2989463 GAGTATAGATGGATGGAGGATGG - Intergenic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900705840 1:4079653-4079675 GTGAAGAGAGAGATTGTGCAGGG + Intergenic
900859541 1:5218238-5218260 GGGAAGAGAGGGATGGTGGTGGG - Intergenic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
900993424 1:6108116-6108138 AGGCATAGAGGGATGATGGAGGG + Intronic
900993510 1:6108475-6108497 GAGAATGGAAGGATGATGGAGGG + Intronic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006594 1:6174672-6174694 GTGGAAGGATGGATGGTGGATGG + Intronic
901006615 1:6174786-6174808 GTGGATGGATGAATGGTGGATGG + Intronic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901006779 1:6175551-6175573 GTGGATGGGTGGATGGTGGATGG + Intronic
901134403 1:6983786-6983808 GTGGATAGATGGTTGATGGATGG + Intronic
901226191 1:7614071-7614093 GGGAGGAGAGGGATGGTGGTGGG + Intronic
901699820 1:11039315-11039337 GTGGATGGAAGGATGGTGGATGG + Intronic
901700270 1:11041584-11041606 GTGGGTGGATGGATGGTGGATGG + Intronic
901774665 1:11552074-11552096 GTGAATGAAGGGAAGATGGAAGG + Intergenic
902129089 1:14243115-14243137 GTGTGTAGTGGCATGGTGGAGGG - Intergenic
902398066 1:16143145-16143167 GTGAATGGATGGATGATGGATGG + Intronic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
902898144 1:19493832-19493854 CTGAATTGAGGCAAGGTGGAAGG + Intergenic
903298454 1:22361045-22361067 ATCACTAGAGGGATGGTTGAAGG + Intergenic
903325913 1:22568417-22568439 GAGCATCCAGGGATGGTGGATGG + Intronic
903565979 1:24266182-24266204 ATGGATAGAGGGAGGGTGGGAGG + Intergenic
903818379 1:26081900-26081922 GTGAATAGGGGGATTGGGGGTGG - Intergenic
904313243 1:29642849-29642871 AGGAATGGAGGGATGGTGGCAGG - Intergenic
904753499 1:32755188-32755210 GTGAATCCAGAGATGGGGGAAGG + Intronic
904847963 1:33435039-33435061 GTGTATATATGGATGGGGGAAGG - Intergenic
904960248 1:34327079-34327101 GAGAAGAGAGAGATGATGGAGGG - Intergenic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
904988792 1:34574489-34574511 GTGGTTAGAGGGAGGGAGGATGG - Intergenic
904993706 1:34614534-34614556 GTGGATGGATGGATGGTGGGTGG + Intergenic
905272039 1:36793675-36793697 GTGGATGGATGGGTGGTGGATGG + Intergenic
906196679 1:43934261-43934283 GTGAGTAGCGGGCTGGTGGATGG + Intronic
906277030 1:44524098-44524120 GTGAATGGGGGGATGCTGGAGGG + Intronic
906617639 1:47245089-47245111 GTGCGTAGAGGAAAGGTGGAGGG + Intergenic
906747639 1:48232822-48232844 GAGAAAAGAGGGAGGGAGGAAGG + Intronic
907660677 1:56390000-56390022 GAGAAAACAGGGAGGGTGGAGGG + Intergenic
907998607 1:59657822-59657844 GTAAGTTTAGGGATGGTGGAGGG + Intronic
908245729 1:62226481-62226503 GAGAAGGGAGGGAAGGTGGATGG - Intergenic
910987422 1:93019183-93019205 CAGAAGCGAGGGATGGTGGAAGG + Intergenic
911450052 1:98050564-98050586 GGAAATATAGGGATGGGGGAGGG + Intergenic
912843456 1:113059389-113059411 GTGAACAGAGTGAGGCTGGAGGG + Intergenic
914334738 1:146704217-146704239 GAGAAGAGAGGGATAGAGGAAGG + Intergenic
914351337 1:146842890-146842912 GTGGATAGGTGGATGGTGGATGG + Intergenic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
916583537 1:166129768-166129790 CTGAATAGAGTGATTGTGGTAGG - Intronic
916626808 1:166567111-166567133 GGGAAAAGAGAGAAGGTGGAAGG + Intergenic
916666021 1:166968292-166968314 GAGAAGAGTGGGATGGGGGAAGG - Intronic
916940644 1:169673655-169673677 GAGAATAGAGGGTGGGAGGAGGG + Intronic
917119759 1:171635129-171635151 GTGAATAGAGGGTGGGTTCAGGG + Intergenic
918273307 1:182924815-182924837 GGGAAGAGAGGGGTGGGGGAAGG + Intronic
919064949 1:192682890-192682912 CGGAATAGAGGGAAGGGGGACGG - Intergenic
919503497 1:198368502-198368524 GTGAATAGTGGGGTGGGGGGAGG - Intergenic
919911087 1:202111124-202111146 GTGAATAGAGGGAGTGAGGAAGG + Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
919935184 1:202246240-202246262 ATGGATGGAGGGATGGGGGATGG - Intronic
920264552 1:204712110-204712132 CTGAGTAGAGGGATGGAGGCCGG - Intergenic
920287354 1:204890214-204890236 GTGAATGGATGGATGCAGGAAGG - Intronic
921370705 1:214419938-214419960 GAGGATAGAGGGATGGAGGGAGG - Intronic
921809637 1:219497907-219497929 GTTTAAAGTGGGATGGTGGATGG - Intergenic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922745787 1:228042865-228042887 ATGGATAGATGGGTGGTGGATGG + Intronic
922790588 1:228308821-228308843 ATAAATAGATGGATTGTGGATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922792838 1:228319638-228319660 ATGGATAGATGAATGGTGGATGG - Intronic
922792858 1:228319739-228319761 ATGAATGGATGAATGGTGGATGG - Intronic
923064144 1:230502811-230502833 GAGAATGGAGGGAGGGGGGATGG - Intergenic
923478828 1:234363784-234363806 CTGTATAGATGGATGATGGATGG + Intergenic
924113036 1:240718577-240718599 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
924815593 1:247438986-247439008 GAAAATAGAGGGATGGATGATGG - Intronic
1062928762 10:1338727-1338749 GTGGATAGAGAGGTGGAGGAAGG + Intronic
1062940159 10:1414930-1414952 GTGGATGGATGGATGGTGGATGG + Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1063050968 10:2446922-2446944 GAGAGTAGAGGGACGCTGGATGG + Intergenic
1063353959 10:5380990-5381012 GTGGCGGGAGGGATGGTGGATGG - Intergenic
1063419017 10:5896293-5896315 GAGATTTGAGGGGTGGTGGAGGG + Intronic
1063958242 10:11284773-11284795 GTGGATGGATGGATGGTGGATGG + Intronic
1064011181 10:11737784-11737806 GTGAGCAGAGGGAGGGAGGATGG - Intergenic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064698503 10:17992207-17992229 ATGGATAGAGGGATGATAGATGG + Intronic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1067174826 10:43938224-43938246 GTAAATATATGGATGGGGGAGGG + Intergenic
1067893970 10:50160135-50160157 GTGAAAGGAGAGATGGAGGAAGG - Intergenic
1067954877 10:50780129-50780151 GTGAAAGGAGAGATGGAGGAAGG + Intronic
1067958927 10:50825752-50825774 AGGAATAGAGGGAAGGTGGAAGG - Intronic
1068331424 10:55575987-55576009 GTGAATAGAGTGAAAGTGAACGG - Intronic
1068740652 10:60465592-60465614 GTGACTAGAGGGATATTGAAAGG + Intronic
1069392570 10:67951818-67951840 GTGAATGAAGGAATTGTGGAAGG - Intronic
1070050646 10:72886332-72886354 GTCAGTAAAGGGATGCTGGAAGG - Exonic
1070162121 10:73873168-73873190 GTGACTAGAGGTCTGGTGGTGGG - Intronic
1070953309 10:80447976-80447998 GGGAAAAGAGGGAGGGAGGAGGG - Intergenic
1071131212 10:82395660-82395682 ATGAATGGATGGATGATGGATGG - Intronic
1071509032 10:86249872-86249894 ATAAATGGATGGATGGTGGAAGG + Intronic
1072352040 10:94566469-94566491 GTGAAAAGAGTGATGAAGGAAGG + Intronic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1072631737 10:97151268-97151290 GCGAATACAGGGGTGGAGGAAGG + Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467235 10:103701288-103701310 ATGAATGGATGGATGATGGATGG - Intronic
1073467239 10:103701311-103701333 ATGAATGGATGGATGATGGATGG - Intronic
1073467254 10:103701387-103701409 GTGGATGGATGGATGATGGATGG - Intronic
1073467257 10:103701402-103701424 GTGGATGGATGGATGGTGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467274 10:103701484-103701506 ATGAATGGATGGATGATGGATGG - Intronic
1073467279 10:103701511-103701533 GTGGATGGATGGATGATGGATGG - Intronic
1073467282 10:103701526-103701548 GTGGATGGATGGATGGTGGATGG - Intronic
1073467297 10:103701608-103701630 GTGGATGGATGGATGATGGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467376 10:103702031-103702053 ATGGATAGATGGATGATGGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1074890929 10:117736036-117736058 GTGAAGGGTGGGATGGTTGATGG - Intergenic
1075105588 10:119538167-119538189 GAGGAGAGAGGGATGGAGGAAGG + Intronic
1075695622 10:124432898-124432920 GTGAAGAGAGGTTTGGTGAATGG + Intergenic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076844985 10:133065582-133065604 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845004 10:133065654-133065676 ATGGATAGATGGAGGGTGGATGG + Intergenic
1076845054 10:133065817-133065839 GTGGATGGATGGAGGGTGGACGG + Intergenic
1076845126 10:133066061-133066083 GTGGATGGATGGAGGGTGGATGG + Intergenic
1076845138 10:133066100-133066122 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845186 10:133066247-133066269 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845225 10:133066368-133066390 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845241 10:133066417-133066439 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845269 10:133066508-133066530 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845285 10:133066557-133066579 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845313 10:133066648-133066670 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845355 10:133066760-133066782 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076867588 10:133175651-133175673 GTGGATAGATGGGTGGAGGATGG + Intronic
1077159495 11:1106246-1106268 GTGGATGGATGGATGGTGGATGG - Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077159606 11:1106644-1106666 GTGAATGGAGGGAGGGAGAATGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1078406983 11:11079045-11079067 GTGAACAGTGGGATAGTGGAAGG + Intergenic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080788634 11:35499362-35499384 GTGAATAGAGGGAGGGGGTGAGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081075949 11:38673826-38673848 AGGAAGAGAGGGATGGAGGAAGG - Intergenic
1081287449 11:41288476-41288498 GTTAATAGAGAGTGGGTGGAGGG + Intronic
1081487553 11:43543589-43543611 GTGAAGAGAGGAAAGGTGCATGG - Intergenic
1081800994 11:45859234-45859256 GTGAACAGAGGTCTGTTGGAGGG - Intronic
1082225634 11:49703286-49703308 GTGAACTGGGGGATGGGGGAGGG + Intergenic
1082632769 11:55560808-55560830 GTGAAAAGAGGCTTGGAGGAGGG - Intergenic
1084368607 11:68721265-68721287 GGCAAGAGAGGGAGGGTGGATGG - Intronic
1084413444 11:69016880-69016902 GTGGATGGATGGATGATGGATGG - Intergenic
1084543902 11:69804227-69804249 ATGGATAGATGGATGATGGATGG + Intergenic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084596335 11:70119072-70119094 GTGAATTGATGGATGCTGGAGGG + Intronic
1084596474 11:70119697-70119719 GTGAATAGATGGATGCCGGAGGG + Intronic
1084596493 11:70119799-70119821 GTGAATAGATGGATGCCAGAGGG + Intronic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084773455 11:71359118-71359140 GTGAATAGAAAGATGATGGATGG - Intergenic
1084781803 11:71414780-71414802 GTGGGTAGATGGATGATGGATGG + Intergenic
1084781888 11:71415145-71415167 GTGAATGGATGGATGATGGGTGG + Intergenic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406877 11:76268699-76268721 GTGGATGGATGGATGATGGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085528583 11:77178329-77178351 GTGGATGGATGGATGGTGGATGG - Intronic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1088269373 11:108018100-108018122 GTGCAGAGAGGAATGGAGGAAGG + Intronic
1089062779 11:115639603-115639625 GTGAGTAGCAGGATGGAGGAAGG + Intergenic
1089159652 11:116427883-116427905 GGGGATAGAGGGCTGGTGGTGGG - Intergenic
1089580055 11:119476096-119476118 ATGAATAGATGGATGGTGGGTGG + Intergenic
1089682550 11:120127253-120127275 GTGGATGGATGGATGTTGGAGGG + Intronic
1090406484 11:126478833-126478855 GTGAGTAGTGGGAGGGAGGAGGG + Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1091117902 11:133031578-133031600 GTGAATGGATGGGTGGTGGATGG + Intronic
1091187385 11:133658560-133658582 GTGTATAGATGGATGATGGGTGG + Intergenic
1091369781 11:135048246-135048268 GTGAATAGAAGAAAGGTGGCCGG - Intergenic
1091615140 12:2045109-2045131 GTGAATAGAATGAGGGTTGATGG + Intronic
1091637569 12:2208987-2209009 GTAAATAGAGGGTTTGTGCATGG + Intronic
1091993031 12:4972336-4972358 GTGAATGGATGGATGGAGGGAGG - Intergenic
1092070659 12:5628954-5628976 GTGAAAGGAGGGATGGGGAAAGG - Intronic
1092725374 12:11480411-11480433 GTGAATCGAGGAGTAGTGGATGG - Intronic
1093832251 12:23776624-23776646 TTTAACAGGGGGATGGTGGAAGG + Intronic
1094151607 12:27290715-27290737 GGGAATGGAGAGTTGGTGGACGG + Intronic
1095474021 12:42566701-42566723 ATGAATGGAAGGAGGGTGGAAGG - Intronic
1095943114 12:47739108-47739130 GGGAATGGAGGGATGGAGGCAGG + Intronic
1096517103 12:52162859-52162881 GTGAATAGAGGGGTTCTGGCAGG + Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1096611228 12:52803316-52803338 ATGAATAGATGGATGATGGATGG + Intergenic
1097107747 12:56635236-56635258 GTGAAGTGGGGGATGGTGGTAGG + Intronic
1098450604 12:70614008-70614030 GTGAAGAGAGGGAAGATGAAAGG + Intronic
1098550205 12:71754386-71754408 GGGAATGGAAGGATGGGGGAAGG + Intergenic
1098637319 12:72800537-72800559 GTGAGTATAGGGATGGAGGTTGG - Intergenic
1099769707 12:87035280-87035302 GGAAATAGAGGGATGGAGGAGGG + Intergenic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1100640051 12:96473898-96473920 GAGATTAGAGCAATGGTGGAAGG + Intergenic
1101879000 12:108613834-108613856 GTGAGTCCAGGGGTGGTGGAAGG + Intergenic
1102042379 12:109809093-109809115 GTGAATGGTGGGTGGGTGGATGG - Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102705703 12:114878457-114878479 GGGAAGAGAAGGAGGGTGGAGGG - Intergenic
1102920821 12:116789933-116789955 GTGGATGGATGGATGGTGGATGG + Intronic
1103004405 12:117409542-117409564 GTGGATAGAGGGTAGATGGATGG + Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103064171 12:117883084-117883106 CTGAATGGATGGATGGTTGAAGG - Intronic
1103080901 12:118023376-118023398 GTTAAGAGAAGGATGGGGGAAGG + Intronic
1103173090 12:118838778-118838800 GGGAAAAGGGGGAAGGTGGAAGG - Intergenic
1103184864 12:118947995-118948017 GTGAATAGATGGGTGGATGAGGG - Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103444826 12:120987993-120988015 GTGGGTAGATGGATGATGGATGG - Intronic
1103444876 12:120988182-120988204 GTGGGTAGATGGATGATGGATGG - Intronic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104092295 12:125526939-125526961 GTGGATAGAAGGGTGGTGGATGG - Intronic
1104356277 12:128089791-128089813 GTGAATGTGGGCATGGTGGAGGG + Intergenic
1104475266 12:129065917-129065939 ATGAATAGATGAATGGTGGGTGG - Intergenic
1104778449 12:131404805-131404827 GTGGATGGATGGATGATGGATGG - Intergenic
1104778505 12:131405022-131405044 GTGGATGGATGGATGATGGATGG - Intergenic
1104778520 12:131405084-131405106 GTGGATGGATGGATGATGGATGG - Intergenic
1104778534 12:131405135-131405157 GTGGATGGATGGATGATGGATGG - Intergenic
1104778580 12:131405306-131405328 GTGGATGGATGGATGATGGATGG - Intergenic
1104779309 12:131409677-131409699 GTGGATAGATGGATGATGGATGG - Intergenic
1104779334 12:131409819-131409841 GTGAATGGATGGATGGATGATGG - Intergenic
1104896311 12:132166667-132166689 GTGAATGGATGGATGATGGGTGG - Intergenic
1105836640 13:24217868-24217890 GTGACTTGAGGGTTGGGGGAAGG - Intronic
1106161424 13:27204417-27204439 GTTAATAACGGAATGGTGGAGGG - Intergenic
1106676793 13:31968383-31968405 GTGTATAGAGGGAAACTGGAGGG - Intergenic
1106900611 13:34351427-34351449 ATGAGTAGAGGGATGATGGATGG + Intergenic
1106929327 13:34646904-34646926 GTGAATAGTGGGAGGGAGGGAGG + Intergenic
1107515240 13:41122536-41122558 GTGAGTGGAGGGATGGGGGTGGG + Intergenic
1108433224 13:50375666-50375688 GAGAAAAGAGGGATGGAGGAAGG - Intronic
1108546767 13:51502872-51502894 GTTAATTGTGTGATGGTGGAGGG - Intergenic
1108885151 13:55171126-55171148 GAGAGTAGAGGGTTGGAGGAGGG + Intergenic
1110096506 13:71529556-71529578 GAGAATAGAGGCCTGGTGGCAGG - Intronic
1112439145 13:99413028-99413050 ATGAATAGAGGGACAGAGGATGG + Intergenic
1113224734 13:108147352-108147374 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113224753 13:108147450-108147472 CTGAATAGATGGAAGATGGAGGG - Intergenic
1113224809 13:108147793-108147815 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113224838 13:108147939-108147961 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113224860 13:108148036-108148058 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113574090 13:111382223-111382245 GGCACTAGAGAGATGGTGGAGGG + Intergenic
1115518142 14:34205960-34205982 GTGGAGCTAGGGATGGTGGAGGG - Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG + Intergenic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1117958806 14:61143495-61143517 GTGAAGAGAGAGATTGTGTAGGG + Intergenic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118502368 14:66373734-66373756 CTGAATTGAGGGACCGTGGAAGG - Intergenic
1118775934 14:68974020-68974042 GTGCATAGAGAGATGTTGGTAGG - Intronic
1119575628 14:75719017-75719039 GTGGAGAGTGGGATGGTGGTAGG + Intronic
1120818748 14:88892149-88892171 GTGAGTTGAGGGATGCTGCAAGG - Intergenic
1121029945 14:90649760-90649782 GTGGATGGTTGGATGGTGGATGG - Intronic
1121029954 14:90649791-90649813 GTGGATGGGTGGATGGTGGATGG - Intronic
1121399376 14:93658890-93658912 TTGAATAGAGACATGGTGGATGG - Intronic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121604861 14:95233312-95233334 GTGGATGGAGGGATGATGGATGG - Intronic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600746 14:102920520-102920542 GTGGATGAAGGGATGGTGGATGG - Intergenic
1122600758 14:102920568-102920590 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600779 14:102920672-102920694 GTGGATGGATGAATGGTGGATGG - Intergenic
1122600787 14:102920703-102920725 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122794227 14:104197936-104197958 GTGAATGGAGGGAGAGAGGAAGG - Intergenic
1122867510 14:104614057-104614079 GTGAATGGATGGAGGGTGGTTGG + Intergenic
1122958313 14:105083068-105083090 GTGGATGGATGGATGATGGAGGG - Intergenic
1122958335 14:105083149-105083171 GTGGATGGATGGATGATGGAGGG - Intergenic
1122958447 14:105083551-105083573 GTGGATAGAGAGATGGTGGATGG - Intergenic
1122983932 14:105203618-105203640 GTGAAGGGAGGGGTGGGGGATGG + Intergenic
1123058820 14:105585299-105585321 GTGAATGGAGGATGGGTGGATGG - Intergenic
1124211995 15:27771071-27771093 GAGAAAAGAGGGAGGGAGGAAGG - Intronic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126419553 15:48457066-48457088 TAGAATAGAGGGATGGTCAAGGG + Intronic
1126759613 15:51957431-51957453 ATGAGTAGATGGGTGGTGGAGGG + Intronic
1126778508 15:52119304-52119326 GTGATGAGAGGGAGGGAGGAGGG + Exonic
1127764016 15:62166980-62167002 GTGAATAGATGGAGGAAGGATGG - Intergenic
1128252752 15:66174398-66174420 GTGAATTGAGGCATGGTGTAGGG + Intronic
1128793559 15:70449695-70449717 GTGGTTAGAGGGATGGAGGGAGG + Intergenic
1128793581 15:70449759-70449781 GTGGATACAGGGATGGAGGGAGG + Intergenic
1129516858 15:76162263-76162285 GTGAATGGAGGGCCGGTGCATGG + Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1130278184 15:82494593-82494615 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130470513 15:84221778-84221800 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130478001 15:84336345-84336367 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130493764 15:84451785-84451807 GTCAATAGATGGAGGCTGGATGG + Intergenic
1130592800 15:85226404-85226426 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130843853 15:87726045-87726067 TTGATTAGGGAGATGGTGGAGGG + Intergenic
1130846750 15:87754876-87754898 ATGCACAGAGGGAAGGTGGAAGG - Intergenic
1131035441 15:89218912-89218934 GAGAAGAGAGGGAAGGTGGGTGG + Intronic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030943 15:98438128-98438150 GTGGATGGATGGATGATGGATGG + Exonic
1132057975 15:98666725-98666747 GTGAATAGAGGCTGGGGGGAGGG + Intronic
1132653706 16:1032785-1032807 GTGGATGGATGGATGATGGATGG - Intergenic
1132653748 16:1032990-1033012 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653760 16:1033060-1033082 GTGGATGGATGGATGATGGATGG - Intergenic
1132653776 16:1033142-1033164 ATGGATTGATGGATGGTGGATGG - Intergenic
1132653867 16:1033565-1033587 GTGGATGGATGGATGATGGATGG - Intergenic
1132653907 16:1033750-1033772 GTGGATGGATGGATGGTGGATGG - Intergenic
1133040088 16:3056103-3056125 GTGAACAGGGAGATGGGGGAGGG + Intronic
1133204758 16:4226655-4226677 GTGAATGGAAGGATGATGGATGG + Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133413526 16:5588202-5588224 GGGAATGGGGGGATGGGGGATGG + Intergenic
1133523622 16:6582673-6582695 GAGAAGAGAGAAATGGTGGAGGG - Intronic
1133550372 16:6848619-6848641 GTGTAGAGAGAGATGATGGAAGG + Intronic
1133689547 16:8199989-8200011 GAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1133910021 16:10057109-10057131 GTGAATGGATGAATGATGGATGG - Intronic
1134105971 16:11486251-11486273 GTGAATAGATGGATGGATGGAGG + Intronic
1134224454 16:12380540-12380562 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224460 16:12380559-12380581 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224475 16:12380601-12380623 GTGGATGGATGGATGGTGGATGG - Intronic
1134224482 16:12380624-12380646 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224495 16:12380662-12380684 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224500 16:12380677-12380699 GTGGATGGGTGGATGGTGGATGG - Intronic
1134224526 16:12380762-12380784 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224574 16:12380915-12380937 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224579 16:12380930-12380952 GTGGATGGATGGATGGTGGATGG - Intronic
1134224588 16:12380970-12380992 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224647 16:12381134-12381156 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224653 16:12381153-12381175 GTGGATGGATGGATGGTGGGTGG - Intronic
1134487451 16:14669831-14669853 GTGAATAGATGGAGGATGGCTGG + Intergenic
1134488439 16:14677764-14677786 CTGGATAGATGGATGGTGGGTGG + Intronic
1134488469 16:14677907-14677929 ATGAATGGATGGATGATGGATGG + Intronic
1134632261 16:15765307-15765329 GAGGATAGACGGATGATGGATGG + Intronic
1134746649 16:16593873-16593895 GTGAATGGAGAGTAGGTGGATGG - Intergenic
1134819995 16:17239326-17239348 GTGGATGGATGGATGATGGATGG - Intronic
1134820023 16:17239464-17239486 GTGGATGGATGGATGATGGATGG - Intronic
1134839905 16:17393448-17393470 GTGAAGAGTGGGAGGGTGGTTGG - Intronic
1135803047 16:25517081-25517103 GAGAATCGAGAGATGGTAGAAGG + Intergenic
1137386085 16:48043911-48043933 GTGAATGGATTGATGGTGAATGG - Intergenic
1137386121 16:48044097-48044119 GTGGTTGGATGGATGGTGGATGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137569445 16:49555764-49555786 ATGGATGGAGGGATGGTGCATGG + Intronic
1137742120 16:50788554-50788576 GAGAATAGAGGGAGGCTGGGTGG + Intronic
1137789765 16:51165196-51165218 GTGAATGGAGGGTTGGAGAAAGG + Intergenic
1138050871 16:53776010-53776032 GGGAAAAAGGGGATGGTGGAGGG + Intronic
1138404778 16:56782064-56782086 CTGAATTGAGGGATGGGGGTGGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1139982701 16:70872660-70872682 GTGGATAGGTGGATGGTGGATGG - Intronic
1139998887 16:71007019-71007041 GAGAAGAGAGGGATAGAGGAAGG - Intronic
1140067641 16:71625228-71625250 GTGAGTGGATGAATGGTGGATGG + Intergenic
1140067682 16:71625367-71625389 GTGGGTGGATGGATGGTGGATGG + Intergenic
1140356918 16:74314406-74314428 GGGAAAAGAAGGATGGAGGAAGG - Intergenic
1140678923 16:77364634-77364656 GTGGATGGATGGATGGTGGATGG + Intronic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110200 16:81265689-81265711 GTAGGTAGATGGATGGTGGATGG - Intronic
1141110239 16:81265875-81265897 GTGGATGGATGGATGGTAGATGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141177994 16:81733346-81733368 ATGGATAGAGGGTGGGTGGATGG - Intergenic
1141391324 16:83667074-83667096 ATGGATAGATGGATGATGGATGG + Intronic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141774570 16:86114237-86114259 GGGAAAAGAGGAAGGGTGGAGGG + Intergenic
1142124131 16:88401794-88401816 GTGGATGGATGGATGGTAGATGG + Intergenic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142152397 16:88518440-88518462 ATGGATAGATGGATGGTGGGTGG + Intronic
1142152629 16:88519433-88519455 ATGGATAGATGCATGGTGGATGG + Intronic
1142152860 16:88520443-88520465 GTGGGTAGATGGATGGTGGATGG + Intronic
1142198675 16:88750833-88750855 GTGGATAGTGGGCTGGAGGATGG - Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1144728573 17:17513992-17514014 GAGGATAGATGGATGGAGGAAGG - Intronic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1145978730 17:28999073-28999095 TTGAATAGAGGGTTGCTGAATGG + Intronic
1146422233 17:32698337-32698359 GGGAAGAGAGGGAGGGAGGAAGG - Intronic
1146939192 17:36832292-36832314 ATGGACAGATGGATGGTGGATGG - Intergenic
1147977342 17:44255351-44255373 GTGAATATAGGGCAGGAGGAAGG - Intronic
1147977502 17:44256179-44256201 ATGAATAGATGGATAATGGATGG - Intronic
1148161049 17:45450273-45450295 TTAGATAGATGGATGGTGGATGG - Intronic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1150392281 17:64796911-64796933 ATAGATAGATGGATGGTGGATGG - Intergenic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1151345694 17:73500099-73500121 GAGAATGGAGGGAGGATGGACGG - Intronic
1151345835 17:73500670-73500692 GAGAATGGAGGGAGGATGGATGG - Intronic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152312481 17:79559540-79559562 GTGGATAGATGAATGGTGGGTGG + Intergenic
1152312505 17:79559636-79559658 GTGAATAGTGGATGGGTGGATGG + Intergenic
1152314102 17:79570155-79570177 GATAATAGATGGATGGTAGATGG + Intergenic
1152473754 17:80504252-80504274 GTGGATGGAGGGATGATGGATGG + Intergenic
1152767482 17:82148995-82149017 ATGAATGGATGGGTGGTGGATGG + Intronic
1154307812 18:13243518-13243540 GTGGATGGATGGATGATGGATGG - Intronic
1155149057 18:23108073-23108095 GAGAGTAGAGGGAGGGTGGGAGG - Intergenic
1155488571 18:26373784-26373806 GTGAACAGAGGGAGGGAGGGAGG - Intronic
1156109255 18:33703666-33703688 GTGAGGAGAGGGATGGGGGTGGG - Intronic
1157364995 18:47056456-47056478 TTGAACAGATGGCTGGTGGAGGG + Intronic
1157460391 18:47887105-47887127 ATGACTAGAGTGGTGGTGGAAGG - Intronic
1157479732 18:48045669-48045691 CTGAATTGAGGGATGGGGAAAGG - Intronic
1157518152 18:48325791-48325813 GTGAAGAAAGGGCTTGTGGAGGG + Intronic
1159100499 18:63952794-63952816 AGGAACACAGGGATGGTGGAAGG - Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159812964 18:73038986-73039008 GGGAGAAGAGGGATGGGGGAGGG - Intergenic
1159916603 18:74193770-74193792 GTGGAGGGGGGGATGGTGGAGGG - Intergenic
1160502560 18:79409521-79409543 ATGAATGGATGGATGATGGATGG - Intronic
1160526572 18:79542138-79542160 GTGGATGGATGGATGTTGGATGG - Intergenic
1160588028 18:79923301-79923323 GTGGATGGGTGGATGGTGGACGG + Intronic
1160687132 19:442336-442358 GTGGATGGATGGAGGGTGGAAGG + Intronic
1160687368 19:443075-443097 GTGGATGGATGGAGGGTGGATGG + Intronic
1160687643 19:444073-444095 GTGGATGGATGGAGGGTGGATGG + Intronic
1160692724 19:467192-467214 GTGGAAAGATGGTTGGTGGAGGG + Intronic
1161033477 19:2071096-2071118 GTGGATGGAGTGAGGGTGGAGGG + Exonic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161286453 19:3471008-3471030 GTGAGGAGAGGGATGGAGGGAGG + Intergenic
1161287292 19:3475438-3475460 GTGGATAGTGGGTGGGTGGATGG + Intronic
1161287320 19:3475548-3475570 GTGGATAGATGGATGATGAATGG + Intronic
1161287553 19:3476826-3476848 GTGAATAGATGGGTGATGGATGG + Intronic
1161287617 19:3477077-3477099 GTGAATAGATGGGTGATGGATGG + Intronic
1161329082 19:3677929-3677951 GAGAATGGAGGGATGGAGGGAGG + Intronic
1161329094 19:3677972-3677994 AGGAATAGAGGGAAGGAGGATGG + Intronic
1161329110 19:3678034-3678056 GAGAATGGAGGGATGGAGAATGG + Intronic
1161329222 19:3678447-3678469 GAGGATGGAGGGATGGAGGATGG + Intronic
1161329228 19:3678462-3678484 GAGGATGGAGGGATGGAGGAGGG + Intronic
1161347788 19:3776774-3776796 GTGGATAGTGGGTGGGTGGATGG + Intergenic
1161449206 19:4335189-4335211 GTGGATGGATGGATGATGGATGG - Intronic
1161633118 19:5369339-5369361 ATGAATAGATGGATGATGGATGG - Intergenic
1161657497 19:5525094-5525116 GTGAATGGATGGATGATGGATGG - Intergenic
1161681462 19:5681760-5681782 GTGGATGGATGGATGATGGACGG - Intronic
1161800842 19:6416106-6416128 GTGCACAGAGGGATGCTGAAAGG + Intronic
1161916093 19:7229287-7229309 GTGGATGGAGGGATGATGGATGG + Intronic
1162085817 19:8248566-8248588 GTGGACAGATGGATGATGGATGG + Intronic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162963756 19:14145542-14145564 GTGGATATGGGGATGGGGGAGGG + Intergenic
1163041862 19:14608595-14608617 GAGAAAAAAGGGAGGGTGGAAGG + Intronic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163495173 19:17642347-17642369 GTGGCTAGATGGATGATGGATGG - Intronic
1163609884 19:18295314-18295336 GTAGATGGATGGATGGTGGATGG - Intergenic
1163609920 19:18295439-18295461 GTGGATGGATGGCTGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163610016 19:18295803-18295825 GTGGATGGGTGGATGGTGGATGG - Intergenic
1163675734 19:18654431-18654453 GTGGATGGTGGGTTGGTGGATGG - Intronic
1163809056 19:19419050-19419072 CTGAATTCAAGGATGGTGGAGGG - Intronic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164670170 19:30067965-30067987 GTGAATGGAGGGATGGATGGAGG - Intergenic
1164670297 19:30068536-30068558 ATGGATAGATGGATGATGGATGG - Intergenic
1164701504 19:30287798-30287820 GAGGATGGATGGATGGTGGATGG + Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164719687 19:30423267-30423289 ATGAATAGATGGGTGGTAGATGG - Intronic
1164725852 19:30465164-30465186 GAGAATAGAGGCAAGGTGGCAGG - Intronic
1165102069 19:33444802-33444824 GTGGAGAGAGACATGGTGGATGG - Intronic
1166201474 19:41240232-41240254 GTGGATATATGGAGGGTGGATGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167161431 19:47769789-47769811 GTGGATGGATGGATGATGGATGG - Intergenic
1168326912 19:55543201-55543223 GTGGATGGATGGATGGTGGATGG - Intronic
1168330880 19:55567779-55567801 GTGAATGGATGGATGGATGATGG + Intergenic
1168330890 19:55567830-55567852 GTGAATGGATGGATGGATGATGG + Intergenic
1168508272 19:56954604-56954626 GTGGATAGATGGAGGATGGATGG - Intergenic
925382749 2:3438277-3438299 GTTAATCCAGGGATGGTGGGGGG - Intronic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926727543 2:16010100-16010122 GTGAATAGAGGCAGGGAGGTTGG - Intergenic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928578458 2:32680568-32680590 GTGAAATGAGGGATGGGGGAAGG + Intronic
930003740 2:46879801-46879823 GTGAATGGATGGATGGTGAGTGG + Intergenic
930034431 2:47076587-47076609 GGGAATGGAGGGAATGTGGAAGG + Intronic
930366499 2:50446350-50446372 GTGAAAAGAGGGAGGGAGGAAGG - Intronic
931009418 2:57891525-57891547 GTGGATAGAGGGAGAGTTGAGGG + Intergenic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931367726 2:61633900-61633922 AGGAATAGAGGGATGGCAGATGG - Intergenic
933310682 2:80658051-80658073 GAGAATAGAGGGTAGGAGGAGGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
936060579 2:109293238-109293260 GAGGACAGAGGGATGGTGGAGGG + Intronic
936527984 2:113255111-113255133 AGGAATAGAGGGAAGGAGGAAGG + Intronic
936578180 2:113672561-113672583 GTCACTGGAGGGATGATGGAAGG - Intergenic
936816889 2:116471062-116471084 GTTAAAAGAAGGATGATGGAAGG + Intergenic
937135193 2:119545578-119545600 GTTAGCAGAGGGATGGAGGAGGG + Intronic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
938698715 2:133857713-133857735 CAGAATGGAGGGATGATGGAGGG - Intergenic
939010268 2:136838273-136838295 GGGTATAGAGGGAAGGAGGAGGG + Intronic
939500274 2:142975368-142975390 GTGAATTGAGTGATGGAGGTGGG - Intronic
940027364 2:149222456-149222478 TTGAATGGAGGAAGGGTGGATGG + Intergenic
941563745 2:167082087-167082109 GTGGGTAGAGGGAGGGGGGAGGG - Intronic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
941810721 2:169753808-169753830 GTGAAGGGAGGGAGGATGGAGGG - Intronic
943330757 2:186556296-186556318 AGGAATAGAGGGAGGGAGGAAGG - Intergenic
944496455 2:200311915-200311937 GGGAATATAAGGATGGGGGAAGG + Intronic
945214608 2:207420159-207420181 ATGATTAGAGAGACGGTGGAGGG - Intergenic
945358549 2:208867684-208867706 GTAAATAGGGTGATGGTGGAGGG - Intergenic
946119081 2:217493407-217493429 GTGAATGGAGGGTGGGAGGAGGG - Intronic
946804837 2:223461838-223461860 AGGAAGAGAGAGATGGTGGAAGG - Intergenic
947088938 2:226488422-226488444 GTGAATCCAAGGAAGGTGGAAGG - Intergenic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947380291 2:229538916-229538938 GTGCAGAGTGGGATAGTGGATGG - Intronic
947812837 2:233015136-233015158 GTGGATGGATGGATGGTGGATGG - Intronic
947812841 2:233015151-233015173 GTGAAGGGATGGATGGTGGATGG - Intronic
947812912 2:233015413-233015435 GTGGATGGATGGATGGTGGATGG - Intronic
947812932 2:233015496-233015518 GTGGATGGATGGATGGTGGATGG - Intronic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948753331 2:240144810-240144832 GGGAACAGAGGGATGGGGGCTGG - Intergenic
949065748 2:241989561-241989583 GTGGATGGATGGATGGTGGATGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065788 2:241989733-241989755 GTGGATGGATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065812 2:241989834-241989856 GTGGGTGGATGGATGGTGGATGG - Intergenic
949065838 2:241989948-241989970 GTGGATGGATGGATGGTGGATGG - Intergenic
949065842 2:241989963-241989985 GATAATGGATGGATGGTGGATGG - Intergenic
949065862 2:241990050-241990072 GTGGATGGATGGATGATGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
949066000 2:241990591-241990613 GTGGATGGATGGATGGTGGATGG - Intergenic
1168875893 20:1171929-1171951 GTGAAGAGAGGGATGGCCCAGGG + Intronic
1169588619 20:7115813-7115835 GTAAATAGAGGAGTTGTGGATGG + Intergenic
1169595233 20:7190923-7190945 GTGAGTATAGGGATGGGAGATGG + Intergenic
1170361181 20:15548103-15548125 GTGGACAGATGGATGGTGGATGG - Intronic
1170729532 20:18961162-18961184 GTGAATAGGTGGATGCTGAAGGG + Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171227084 20:23451024-23451046 GTAAATGGATGGATGGGGGATGG - Intronic
1171992773 20:31709130-31709152 CTGGACAGAGGGATGGTTGATGG - Intronic
1172230773 20:33334154-33334176 ATGGGTAGATGGATGGTGGATGG + Intergenic
1172230814 20:33334342-33334364 GTGGGTAGATGGATGGTGGATGG + Intergenic
1172230832 20:33334421-33334443 TTGGGTAGATGGATGGTGGATGG + Intergenic
1172632287 20:36386468-36386490 AAGAAAAGAGGGATGGGGGAGGG + Intronic
1172745060 20:37200651-37200673 GTGAATATAGGGAGGGTGTGAGG - Intronic
1172939121 20:38642656-38642678 GAGAATAAATGGGTGGTGGAAGG - Intronic
1172980902 20:38940763-38940785 GTGATTAGAGGCATTGTGGCAGG + Intronic
1173295459 20:41751603-41751625 GTGAACAGTAGGATGGAGGAGGG - Intergenic
1173465023 20:43274009-43274031 GTGAATGGGCGGATGGTGGAGGG + Intergenic
1173848333 20:46201891-46201913 ATGAATGGAGGGATGGTTGGGGG - Intronic
1174261835 20:49301698-49301720 GGGAAGAGAGGGATGGGGCAGGG - Intergenic
1174279725 20:49430467-49430489 GTGGATGGATGGATGATGGATGG - Intronic
1174306805 20:49619219-49619241 TTGGATAGATGGATGATGGATGG + Intergenic
1175362240 20:58421732-58421754 GGGAAGAGAGGGAGGGTTGATGG + Intronic
1175369941 20:58481527-58481549 GAGGAGAGAGGGATGGAGGATGG + Intronic
1175530694 20:59672741-59672763 ATGAGGAGAGAGATGGTGGAGGG - Intronic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1175687982 20:61045209-61045231 ATGAATAGACGGAGGATGGATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175779196 20:61671649-61671671 GTGAATGGATGGATAATGGATGG + Intronic
1175779199 20:61671660-61671682 GATAATGGATGGATGGTGGATGG + Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175780302 20:61678032-61678054 GTAGATAGATGGATGATGGATGG + Intronic
1175781017 20:61682136-61682158 GTGGATAGAGGGTAGATGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175799020 20:61790468-61790490 ATGAATGGAAGGATGGTGGGTGG - Intronic
1175799056 20:61790661-61790683 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799084 20:61790824-61790846 ATGAATGGATGGATGGTGGGTGG - Intronic
1175817248 20:61889681-61889703 GTGGATAGTTGGATGATGGATGG + Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817313 20:61890032-61890054 GTGGATAGTTGGATGATGGATGG + Intronic
1175817344 20:61890199-61890221 ATGGATAGATGGATGTTGGATGG + Intronic
1175817364 20:61890310-61890332 ATGGATAGATGGATGATGGATGG + Intronic
1175817856 20:61892990-61893012 GTGAGTAGAGGGATGGTGGATGG + Intronic
1175817877 20:61893073-61893095 GTGAGTAGAGGGATGCTGGATGG + Intronic
1175817897 20:61893152-61893174 GTGAATAGAGGGATGGTGGTTGG + Intronic
1175817916 20:61893227-61893249 GTGACCACAGGGATGGTGGATGG + Intronic
1175817939 20:61893310-61893332 GTGAATAGAGTGATGGTGGTTGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175817979 20:61893472-61893494 ATGAGTAGAGGGATGGTGGATGG + Intronic
1175817992 20:61893523-61893545 GCGAATAGAGAGATGGTGGATGG + Intronic
1175817998 20:61893550-61893572 ATGAATAGAGGGATTGTGGGTGG + Intronic
1175818014 20:61893604-61893626 GCAGATAGAGGGATAGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1175984050 20:62755406-62755428 ATGGATGGAGGGATGATGGATGG - Intronic
1177465478 21:21473772-21473794 GTGATTAGAGGCAAGGTGTAAGG - Intronic
1178083476 21:29089868-29089890 GGGAAGAGAGGGAGGGAGGAAGG + Intronic
1178092275 21:29176871-29176893 GTGAAGGGAGGCATGGTGCAGGG + Intergenic
1178280886 21:31281816-31281838 ATGGATAGAGTGATAGTGGATGG + Intronic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178478706 21:32960058-32960080 GAAAATAGAGGGAAGGTGGGAGG - Intergenic
1179125936 21:38590644-38590666 ATGAATACATGGATGATGGATGG - Intronic
1179474764 21:41636106-41636128 ATGAATGGATGGATGATGGATGG - Intergenic
1179539335 21:42074018-42074040 GTGCACACAGGGATGGTGAAGGG - Intronic
1179549151 21:42132379-42132401 GTGGATGGATGGATGATGGATGG - Intronic
1179567526 21:42258453-42258475 ATGCATTGAGGGATGGAGGAAGG - Intronic
1179623672 21:42634921-42634943 ATGGATAGAAGGATGATGGATGG - Intergenic
1179623728 21:42635361-42635383 ATGGATAGAAGGATGATGGATGG - Intergenic
1179623740 21:42635467-42635489 ATGGATAGAAGGATGATGGATGG - Intergenic
1180024906 21:45155579-45155601 GTGAGTGGATGGATGATGGATGG - Intronic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181528301 22:23502347-23502369 GAGGATGGAGGGATGGGGGATGG - Intergenic
1181528500 22:23502912-23502934 GTGGATGGAGGGATGGGGGATGG - Intergenic
1181528530 22:23502989-23503011 ATGGATGGAGGGATGGGGGATGG - Intergenic
1181537035 22:23551731-23551753 GAGAATGGAGGGAGGATGGATGG - Intergenic
1181592312 22:23893069-23893091 GGGAATAAAGGGATAGTGAAAGG + Intronic
1181824873 22:25507028-25507050 ATGAATAAAAGGATGGGGGATGG - Intergenic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1182039109 22:27222533-27222555 GTGGATAGATGGAGAGTGGATGG + Intergenic
1182099741 22:27649441-27649463 GTGGATGGATGGATGGTGGAAGG + Intergenic
1182753976 22:32663871-32663893 GTCAAGAGAGAGATAGTGGAAGG + Intronic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183106489 22:35618792-35618814 ATGAATGGAGGGATGATGGGTGG - Intronic
1183166256 22:36149188-36149210 GTGGACAGAGGGAGGTTGGAGGG + Intronic
1183177289 22:36233287-36233309 GTGTACAGAGGGAGGCTGGAGGG + Intronic
1183209726 22:36443396-36443418 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303947 22:37072043-37072065 GTGGATGGATGGATGATGGATGG + Intronic
1183304000 22:37072326-37072348 ATGAATGGATGGATGATGGATGG + Intronic
1183304039 22:37072546-37072568 ATGAATGGATGGATGATGGATGG + Intronic
1183304081 22:37072753-37072775 ATGGATAGATGGATGATGGATGG + Intronic
1183304095 22:37072825-37072847 ATGGATAGACGGATGATGGATGG + Intronic
1183304123 22:37072984-37073006 ATGGATAGATGGATGATGGATGG + Intronic
1183304137 22:37073048-37073070 GTGGATGGATGGATGATGGATGG + Intronic
1183304143 22:37073079-37073101 ATGGATAGACGGATGATGGATGG + Intronic
1183358236 22:37370611-37370633 GTGGAGAGAGGGAGGGAGGAAGG + Exonic
1183983346 22:41555465-41555487 GTGAATGGATGGATGGCTGAGGG + Intergenic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293136 22:43508809-43508831 ATGGATGGAGGGATGGGGGATGG - Intergenic
1184293170 22:43508919-43508941 GGGGATGGAGGGATGGGGGATGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293369 22:43509593-43509615 GTGAATAGAGGGATGATGGATGG - Intergenic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410462 22:44323191-44323213 GTGGACAGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410543 22:44323556-44323578 GTGGATGGATGGATGGTGGATGG - Intergenic
1184460829 22:44636927-44636949 ATGGATAGATGGATGATGGATGG + Intergenic
1184460851 22:44637034-44637056 ATGGATAGATGGATGATGGATGG + Intergenic
1184460874 22:44637133-44637155 ATGGATAGATGGATGATGGATGG + Intergenic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
1184731222 22:46372173-46372195 GTGAGTAGATGGATGGGTGAGGG - Intronic
1184731229 22:46372201-46372223 GTGAGTAGATGGATGGTTGGAGG - Intronic
1185018853 22:48361712-48361734 ATGGATAGATGGATGATGGATGG + Intergenic
1185027171 22:48421564-48421586 GTGGATAGATGGATGGGTGAAGG + Intergenic
1185076745 22:48687265-48687287 GTGGATGAATGGATGGTGGACGG + Intronic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185108528 22:48887713-48887735 GTGAATAGATAGATGGTGTGTGG - Intergenic
1185108605 22:48888127-48888149 GTGGATGGATGGATGGGGGATGG - Intergenic
1185165588 22:49260426-49260448 ATGAATGGATGGATGATGGATGG - Intergenic
1185193338 22:49452610-49452632 GTGAATGGATGGATGATGGTGGG + Intronic
1185193379 22:49452813-49452835 GTGAGTCGATGGATGGTGGAAGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196831 22:49476927-49476949 GTGGGTGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185196856 22:49477062-49477084 GTGGATGGATGGATGATGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196904 22:49477250-49477272 GTGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196939 22:49477411-49477433 GTGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196969 22:49477521-49477543 TTGGATGGATGGATGGTGGATGG + Intronic
1185196980 22:49477563-49477585 TTGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
1185224369 22:49644459-49644481 GTGGATAGGTGGATAGTGGATGG + Intronic
1185411155 22:50683754-50683776 GTGGAGAGGGGGGTGGTGGAGGG + Intergenic
1185411169 22:50683782-50683804 GTGGAGAGGGGGGTGGTGGAGGG + Intergenic
949591596 3:5499986-5500008 GTGAACAGCAGGATGGGGGAGGG + Intergenic
950025774 3:9819072-9819094 GTGGATGGATGGCTGGTGGATGG - Intronic
951196394 3:19828154-19828176 GGGAATAGAGGAATGGAGGAAGG - Intergenic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
952196058 3:31076262-31076284 GTGAAAAGCAGGATGGTGGGTGG + Intergenic
952307671 3:32160312-32160334 GTGAATGGATGGATGATGGGTGG + Intronic
952307705 3:32160431-32160453 GTGAATGGATGGATGATGGGTGG + Intronic
952307735 3:32160537-32160559 GTGAATGGATGGATGATGGGTGG + Intronic
952344860 3:32473898-32473920 GTAAAGGGAGGGATGGAGGATGG - Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
956103543 3:65793131-65793153 GGGAAGACAGGGATGTTGGAAGG + Intronic
956740628 3:72272953-72272975 AAGAGTAGAGGGATGGAGGAAGG + Intergenic
957174173 3:76784283-76784305 CTGACTAGAGGGATTCTGGAGGG + Intronic
959306189 3:104669517-104669539 GTGAAAAGAGGCATGGAGGTAGG + Intergenic
960026638 3:113018598-113018620 GTGAAAAGAGGGATGAGGAAAGG + Intronic
960570665 3:119182256-119182278 GTGAACAGAGGGAAGGTGGAAGG + Intronic
960721733 3:120631078-120631100 GAGAATAGAGGGTGGGAGGAGGG + Intronic
961048011 3:123722526-123722548 GGGCCTAGAGGGATGGGGGAGGG + Intronic
961055443 3:123784554-123784576 GAAAGTAGAGGGATGGTGAATGG - Intronic
962203061 3:133415798-133415820 GTGAATAGAGGGGAGGTGGTAGG - Intronic
962203127 3:133416068-133416090 GTGAGTAGAGGGAAGATGGCAGG - Intronic
962261642 3:133912959-133912981 GTGGATAGAAGGATGATCGATGG + Intergenic
962679983 3:137789034-137789056 TGGAATGGAGGGATAGTGGAAGG - Intergenic
964586166 3:158305151-158305173 GTGAAAGGAGGGATTGGGGAAGG - Intronic
964858756 3:161176629-161176651 GTGAGAACAGTGATGGTGGATGG + Intronic
967042660 3:185707821-185707843 TTGAGGAGAGGGATGGTGGAAGG - Intronic
967568494 3:190999701-190999723 GTGAAGGGAGGGAGGGAGGAAGG + Intergenic
967852313 3:194091400-194091422 GTGACTCATGGGATGGTGGAAGG - Intergenic
968392739 4:206009-206031 GTGAAGGGAGGGTTTGTGGAGGG + Intergenic
968594525 4:1475458-1475480 GGGAATGGATGGATGGTGGGTGG + Intergenic
968910327 4:3474044-3474066 GGGAATAGAGGGAGGGGAGAGGG + Intronic
968924797 4:3541562-3541584 GGGAATAGATGGATGCTGAATGG + Intergenic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969088626 4:4675428-4675450 GTGGATAGATGGATGATGGGTGG - Intergenic
969109322 4:4832200-4832222 GTCAATTTAGGGAAGGTGGAAGG - Intergenic
969140935 4:5070918-5070940 GAAAATGGAGGAATGGTGGATGG + Intronic
969378356 4:6778159-6778181 GTAAATAGAGCGATGAGGGAAGG + Intergenic
969424819 4:7118049-7118071 ATGGATAGATGGATGGTGGGTGG + Intergenic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510540 4:7615057-7615079 GTAGACAGAGAGATGGTGGATGG - Intronic
969510728 4:7616338-7616360 ATGAATAGGTGGATGGTGGATGG - Intronic
969510863 4:7617151-7617173 TTGGATAGATGGATGGTGGATGG - Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969612210 4:8233712-8233734 GTGAATGGATGGATAATGGAAGG - Intronic
969612221 4:8233770-8233792 GTGAATGGATGGATAATGGAAGG - Intronic
969612236 4:8233847-8233869 GTGAATGGATGGATGATGGAAGG - Intronic
969612290 4:8234175-8234197 ATGAATGGATGGATGATGGATGG - Intronic
969612299 4:8234216-8234238 GTGAATGGATGGATGATGGAAGG - Intronic
969624392 4:8294955-8294977 GTAAATGGATGGATGATGGATGG - Intronic
970064300 4:12074355-12074377 ATGAATAGAGGGATGGTGTAAGG - Intergenic
970322963 4:14893726-14893748 GTGAAGAGAGACATGGTGGGGGG - Intergenic
970507464 4:16745912-16745934 CTGAATAGTGGGATGGTAAAGGG + Intronic
971294868 4:25379089-25379111 CTGGAAAGAGGGGTGGTGGATGG + Intronic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971965646 4:33552101-33552123 GGGAATAGGGAGATGGGGGAGGG - Intergenic
975734551 4:77368460-77368482 GGGAAGAGAGGGAGGGTGTAAGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976324466 4:83755139-83755161 TTGAATGGAGGGATGGGTGAAGG - Intergenic
977811241 4:101358137-101358159 GGATATAGAGGGATGGTGCAAGG + Intergenic
980643933 4:135617220-135617242 GTGAATAGTGGTGTGGTGGATGG - Intergenic
981616890 4:146651825-146651847 GAGAAAAGAGGGAGGGGGGAGGG - Intergenic
981837171 4:149067470-149067492 GGGAATAGAGGGAGGGAGGGAGG + Intergenic
981988217 4:150883566-150883588 TTAAAAAGAGAGATGGTGGAAGG - Intronic
982435438 4:155379392-155379414 GGAATTAGAGGGAAGGTGGAAGG - Intergenic
982765487 4:159343133-159343155 GGGAATAGAGGGATTATGGGAGG - Exonic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
983080175 4:163375564-163375586 GAGAATAGAGGGTTGAAGGAGGG - Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
984473230 4:180203778-180203800 GTGCTTAGATGGATGGTGGAGGG + Intergenic
984599043 4:181705108-181705130 GTGGGTAGAGGGATGGGGAATGG + Intergenic
985090693 4:186359966-186359988 GTATATAGAGAGATGGTGGAAGG + Intergenic
985709151 5:1418595-1418617 GTGGATGGATGGATGATGGATGG - Intronic
985958044 5:3278990-3279012 AGGAATGGAGGGATGGTGGGAGG - Intergenic
986051435 5:4094103-4094125 CAGAATAGAGGGGTGGGGGAGGG + Intergenic
986072879 5:4304430-4304452 ATGAATAGATGGATGATGGATGG - Intergenic
987005098 5:13702722-13702744 GTGATGAGAGGGATGGAGGGTGG + Intronic
987445379 5:18011260-18011282 GTGAAGAGAAGAAGGGTGGATGG - Intergenic
990041947 5:51387274-51387296 GGGAAAAGAGAGATGGGGGAAGG + Intronic
990631581 5:57676122-57676144 ATAAATAGAGGGATGGGGGAGGG + Intergenic
990634025 5:57703371-57703393 GAGGAGAGAGGGAGGGTGGAAGG - Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
992377550 5:76203301-76203323 GTGGATAGAGGGATAATGGGTGG + Intronic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
993144143 5:84072839-84072861 AAGAATGGAGGGATGGTGGAGGG + Intronic
995167778 5:109066900-109066922 GTGATCAGAGGGATGGTAGCAGG + Intronic
995688664 5:114799242-114799264 AGGAATAGAGGGAAGGAGGAGGG + Intergenic
996332681 5:122348360-122348382 TTGAATAGTGGGATGGTAAAAGG + Intronic
996876259 5:128243601-128243623 GTGGATAGATGGATGATGGATGG + Intergenic
996876287 5:128243722-128243744 GTAAGTAGATGGATGATGGATGG + Intergenic
997203728 5:132028576-132028598 AATAATTGAGGGATGGTGGAGGG + Intergenic
997823528 5:137086621-137086643 GTGGATGCAGGAATGGTGGAGGG - Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998384715 5:141750138-141750160 GGGAACAGGGAGATGGTGGAGGG + Intergenic
998622723 5:143812411-143812433 GTGAAAACAGGGATGGCGGAAGG + Intronic
999246094 5:150155570-150155592 GAGAACAGAGGGATGGAGGAAGG + Exonic
999267562 5:150276782-150276804 GTGGATGGAGGGATAGAGGAAGG + Intronic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
1000319547 5:160123240-160123262 GTGATTGGATGGATGGTTGATGG + Intergenic
1000397261 5:160788834-160788856 GTGGATGGATGGATGGTGGATGG - Intronic
1000673992 5:164098031-164098053 TTGAATGAAGGGTTGGTGGATGG + Intergenic
1000982625 5:167832701-167832723 GGGAAAGGAGGGATGGAGGAAGG + Intronic
1001147556 5:169198033-169198055 ATGCATAGATGGATGGTGGTTGG - Intronic
1001422550 5:171598812-171598834 GTGGATAGGTGGATGGTAGATGG + Intergenic
1001646256 5:173284368-173284390 ACGAATAGATGGATGGTGGATGG - Intergenic
1001751444 5:174134584-174134606 GTGAATGGATGGATGATGGATGG - Intronic
1001865678 5:175103026-175103048 ATGGATAGATGGATGATGGATGG + Intergenic
1002210470 5:177595887-177595909 GTGAGTTGAGGGTGGGTGGAGGG + Exonic
1002259069 5:177981849-177981871 GTGGACACATGGATGGTGGATGG + Intergenic
1002298643 5:178245531-178245553 GTGAATGGATGGATGGGTGATGG - Intronic
1003972550 6:11313138-11313160 ATGAATAGATGGATGGTTGGTGG + Intronic
1003972566 6:11313236-11313258 ATGAATAGATAGATGGTGGGTGG + Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1005607855 6:27493342-27493364 TAGAAGAGAGGGATGGAGGAAGG - Intergenic
1005889350 6:30123957-30123979 GGGAGTAGATGGGTGGTGGAGGG + Intergenic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1007226834 6:40321057-40321079 GGGAAGAGAGGGAGGGAGGAGGG + Intergenic
1007759024 6:44121364-44121386 GGGAAGAGAGGGTGGGTGGAAGG + Intronic
1008097471 6:47353785-47353807 GTGAATAAAGGTATGGATGATGG - Intergenic
1008422134 6:51313636-51313658 ATGAATGGATGGATGATGGATGG - Intergenic
1008811944 6:55513067-55513089 GTGATGAGAGGTATGGGGGAGGG - Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1012115619 6:95294087-95294109 GGGATGAGAGGCATGGTGGAGGG + Intergenic
1012222335 6:96664120-96664142 GAGAAGAGAGGGAGGGTGGGGGG + Intergenic
1013990593 6:116250841-116250863 GGGAAAAGGGTGATGGTGGATGG + Exonic
1014432892 6:121390414-121390436 GTGTCTAGTGGGATGTTGGAGGG - Intergenic
1014963888 6:127722430-127722452 GAGAATTGAGGGTTAGTGGAGGG - Intronic
1015160705 6:130149711-130149733 GAGATTAGAGGGTGGGTGGAAGG + Intronic
1015805380 6:137102975-137102997 GTGAGAAGAGAGATGGTAGAGGG + Intergenic
1018207603 6:161450173-161450195 GTGAAGAGGGGGAAGGTGTATGG + Intronic
1018868270 6:167761833-167761855 GTGGATGGAGGGATGGGGGGAGG - Intergenic
1019057976 6:169236539-169236561 GTGGATAGAGTGAGTGTGGATGG - Intronic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019326858 7:442743-442765 GTGGAAGGACGGATGGTGGATGG + Intergenic
1019327014 7:443489-443511 GTGGATGGATGAATGGTGGATGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327040 7:443600-443622 GTGTATGGAGGGATGGAGAATGG + Intergenic
1019327048 7:443633-443655 GTGGATGGATGGATGGTGGATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019345576 7:528580-528602 ATGAATAGACAGATGATGGATGG + Intergenic
1019345607 7:528802-528824 ATGAATAGACAGATGATGGATGG + Intergenic
1019510482 7:1415197-1415219 GTGAATGGAGGGAGGGAGGGAGG + Intergenic
1019555833 7:1630894-1630916 ATAAATGGATGGATGGTGGATGG - Intergenic
1019567197 7:1690201-1690223 GTGAATGGATGGATAGTTGATGG + Intronic
1019914699 7:4125219-4125241 ATGGATAGATGGATGATGGATGG + Intronic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1022440045 7:30425885-30425907 GTGAACAGAGGGATGGCAGCTGG - Intronic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1023116446 7:36867196-36867218 ATGGATAGATGGATGATGGATGG - Intronic
1023314403 7:38920478-38920500 GTGAAAAGAAGGATGGGGAAAGG + Intronic
1023447918 7:40251218-40251240 GTGAAGAGAGGGAAGATGGAAGG - Intronic
1023457142 7:40352453-40352475 GAGAGTAGAGGGAAGGAGGAGGG - Intronic
1023597853 7:41851657-41851679 GTGAATAAAGGGTTGGTTGTAGG - Intergenic
1023754959 7:43407794-43407816 ATGAATGGAGGGAAGGAGGAGGG - Intronic
1024030298 7:45455040-45455062 GGGAGTAGGGGGATGGGGGAGGG - Intergenic
1024364749 7:48508105-48508127 GTGTATGGAGGGATGGAGGGGGG + Intronic
1025120103 7:56294618-56294640 ATGAATGGATGGATGGTTGATGG + Intergenic
1025120123 7:56294731-56294753 ATGAATGGATGGATAGTGGATGG + Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025120134 7:56294787-56294809 ATGAATGGATGAATGGTGGATGG + Intergenic
1026078930 7:67199930-67199952 GAGAAGAGAGGGAGGGAGGATGG + Intronic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026203569 7:68235926-68235948 ATGAATGGATGCATGGTGGATGG + Intergenic
1026275189 7:68870221-68870243 ATGGATAGATGGATGATGGATGG + Intergenic
1026275213 7:68870372-68870394 ATGAATGGATGGATGATGGATGG + Intergenic
1026492149 7:70872200-70872222 GGGAAGGGAGGGAGGGTGGAAGG + Intergenic
1026697890 7:72612009-72612031 GAGAAGAGAGGGAGGGAGGATGG - Intronic
1026866887 7:73829615-73829637 GAAGATAGAGGGAGGGTGGAGGG - Exonic
1027191104 7:75995872-75995894 GTGGATAGGGAGATGGGGGAGGG + Intergenic
1027382956 7:77631094-77631116 GTGAAGAGATGGCTGTTGGAAGG - Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1027588526 7:80088544-80088566 GTGAAAAGCGGGATGTTGGGGGG + Intergenic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028751844 7:94391782-94391804 GAGAGTAGAGGGATGGAAGAAGG - Intergenic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1029745435 7:102513428-102513450 GGGGAAAGAGGGATGGGGGAAGG + Intronic
1029763374 7:102612407-102612429 GGGGAAAGAGGGATGGGGGAAGG + Intronic
1030601929 7:111602581-111602603 GAGAATGGAGGAATGGAGGAGGG + Intergenic
1030807583 7:113936616-113936638 GTGAATGCAGGCATGGAGGAAGG - Intronic
1031280053 7:119787828-119787850 GGGTAGTGAGGGATGGTGGAGGG + Intergenic
1031787001 7:126045659-126045681 GGGTATAGAGGGATGGTTTAGGG - Intergenic
1031828723 7:126599952-126599974 ATGAATGGATGAATGGTGGATGG + Intronic
1031871352 7:127092009-127092031 ATGACTAGTGGGATGGTGGGGGG - Intronic
1032417450 7:131747323-131747345 GTGTATGGAGGGGTGGGGGATGG + Intergenic
1033064974 7:138145779-138145801 GTGAAGCGGGGGCTGGTGGAGGG + Intergenic
1033379440 7:140799591-140799613 GGGAATAGAAGCATGGTGAAAGG - Intronic
1033654256 7:143362497-143362519 GCGAGGAGAGGGATGGGGGAGGG + Intronic
1034462950 7:151208477-151208499 GTGAAGAGAGGAATGGTGTTAGG - Intronic
1034883607 7:154780840-154780862 ATGAATAGATGGATGGGTGATGG + Intronic
1034883631 7:154780968-154780990 ATGAATAGATGGATGGTTGATGG + Intronic
1034883636 7:154780995-154781017 GTGAATGGATGGATGATGGGTGG + Intronic
1035278874 7:157765105-157765127 GTGAGTGGATGGATGGGGGAAGG - Intronic
1035288644 7:157822822-157822844 ATGGATAGATGGATAGTGGATGG - Intronic
1035523738 8:295484-295506 ATAAATAGATGGATGATGGATGG - Intergenic
1036788494 8:11703117-11703139 CAGATTAGAGGGATGGGGGAAGG - Intronic
1037353293 8:17988376-17988398 GTGTATAGTGTGATGGTGGTAGG - Intronic
1037547965 8:19941642-19941664 GTGAGTAGAGTGAAAGTGGAGGG - Intronic
1037567244 8:20128105-20128127 GGGAAAAGAGGGATGGAGGGAGG + Intergenic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037922134 8:22814880-22814902 GTGAACCGGGGGGTGGTGGAGGG + Intronic
1038325129 8:26567231-26567253 ATGGATAGATGGATGATGGATGG - Intronic
1038390598 8:27196812-27196834 GTGGTTAGAGGGCTGGGGGAGGG - Intergenic
1038476558 8:27872544-27872566 GTGAATCCGGGGATGGAGGAGGG + Intronic
1038476935 8:27875202-27875224 GTGAAGAGAGGGAGGGAGGGAGG - Intronic
1039040211 8:33400501-33400523 GTGGATAGACGGATGAAGGAAGG + Intronic
1039732448 8:40294428-40294450 GTGAAAAGAGGGAAAGAGGAAGG + Intergenic
1039793626 8:40894485-40894507 GTGAATGGAGGAAGGGAGGAAGG + Intronic
1040302435 8:46194991-46195013 GTGAAAACAGGGATGCTGGGTGG + Intergenic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1041953617 8:63533151-63533173 GGGAAAAGAGGGAAGGAGGAGGG - Intergenic
1042884811 8:73536677-73536699 GTCAATAGAGGCATGGTGGAAGG + Intronic
1042955345 8:74244321-74244343 GTGAACATAGGGGTGGTGGGGGG + Intronic
1042990859 8:74638137-74638159 GTTATCAGAGGGATGGTTGATGG + Intronic
1043270322 8:78325095-78325117 TTGAGTATAGGGATGGTGGGGGG + Intergenic
1044297803 8:90548663-90548685 GAGAATAGAAGGATGGTTGCTGG + Intergenic
1045394730 8:101749681-101749703 CTGAATAGAGGGTAGGGGGAAGG - Intronic
1045612280 8:103859564-103859586 TTGAAAAGAGGGTAGGTGGATGG + Intronic
1045930025 8:107611361-107611383 TTGAGGAGAGGGATTGTGGATGG + Intergenic
1047228846 8:122978991-122979013 ATGAATAGACGGATGATGGATGG + Intergenic
1047306780 8:123659071-123659093 ATGGATAGATGGATGATGGATGG - Intergenic
1047306789 8:123659120-123659142 GTGGATAGATGGATGATGGATGG - Intergenic
1047306801 8:123659187-123659209 ATGGATAGATGGATGATGGATGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048296970 8:133221535-133221557 ATGAATAGGTGGATGATGGATGG + Intronic
1048979765 8:139697005-139697027 GTGGACGGATGGATGGTGGATGG + Intronic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048979802 8:139697172-139697194 GTGGACAGATGGATGGTGGATGG + Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989302 8:139751990-139752012 ATGGATAGATGGATGGTAGACGG - Intronic
1048989360 8:139752292-139752314 GTGGATGGATGGATGGTAGATGG - Intronic
1048989398 8:139752456-139752478 TTGGATAGATGGATGGTAGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1048989430 8:139752618-139752640 ATGGATAGATGGATGGTAGATGG - Intronic
1048989536 8:139753140-139753162 GTGGATGGGTGGATGGTGGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1048989576 8:139753312-139753334 GTGGATGGGTGGATGGTGGATGG - Intronic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049042168 8:140120758-140120780 ATGAATGGATGGATGTTGGATGG - Intronic
1049179708 8:141216029-141216051 GCGAGGGGAGGGATGGTGGAGGG - Intronic
1049364285 8:142229221-142229243 GTGGATGGATGGATGATGGATGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG + Intronic
1049428492 8:142548479-142548501 GGGGATGGATGGATGGTGGATGG + Intergenic
1049428495 8:142548494-142548516 GTGGATGGATGAATGGTGGATGG + Intergenic
1049428499 8:142548509-142548531 GTGGATGGATGGATGGTGGATGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049464985 8:142746985-142747007 GTGGATGGATGGATGGTGGATGG + Intergenic
1049474926 8:142792728-142792750 GTGAATGGATGAATGGAGGATGG - Intergenic
1050437704 9:5628181-5628203 CTGAATAGAAGGAGGGTTGAGGG - Intergenic
1050857368 9:10377038-10377060 GGTAATAGAGGGTGGGTGGAAGG - Intronic
1051181128 9:14412985-14413007 GTGATTTGAGGGAAGGAGGAGGG - Intergenic
1051182889 9:14429598-14429620 GAGAATTGAGGGATGATGAAGGG - Intergenic
1052433298 9:28394452-28394474 GAGAAAAGAGGGAGGCTGGAAGG - Intronic
1052617528 9:30860816-30860838 GTGGATAGATGGGTGATGGATGG + Intergenic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054145341 9:61557396-61557418 GGGAATAGATGGATGCTGAATGG - Intergenic
1054188275 9:61969583-61969605 GGGAATAGATGGATGCTGAATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054465097 9:65488549-65488571 GGGAATAGATGGATGCTGAATGG - Intergenic
1054650239 9:67618993-67619015 GGGAATAGATGGATGCTGAATGG - Intergenic
1054709014 9:68492359-68492381 GTGATGAGAGGGCTGCTGGAGGG - Intronic
1056124645 9:83523141-83523163 GTGAATGGATGGAGGATGGATGG + Intronic
1056181328 9:84085839-84085861 GTAAATAAAGGGATTGTGGCAGG - Intergenic
1056418488 9:86400844-86400866 GTGATTACAGGTGTGGTGGAGGG + Intergenic
1057000925 9:91508653-91508675 GTGCATACAGTGAAGGTGGATGG + Intergenic
1057181133 9:93031085-93031107 GTGGATGAAGGGATGATGGATGG + Intronic
1058643442 9:107108826-107108848 GTAAGTAGAGGGCTGGTGGTAGG - Intergenic
1059249706 9:112877600-112877622 GTTAATGGATGGATGGTAGAGGG - Intronic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059498567 9:114731047-114731069 GTGGATCGATGGATGGTAGAAGG - Intergenic
1061085786 9:128397426-128397448 GAGAATAGGGGGAGGGGGGATGG + Intergenic
1061255724 9:129453542-129453564 GGAGATGGAGGGATGGTGGATGG + Intergenic
1061255785 9:129453713-129453735 GGGAATGGAGGGATGGGGGATGG + Intergenic
1061255798 9:129453751-129453773 GGGAATGGAGGGATGGGGGATGG + Intergenic
1061255835 9:129453856-129453878 GGGGATGGAGGGATGGAGGATGG + Intergenic
1061417482 9:130454941-130454963 ATGGATAGATGGATGATGGATGG - Intronic
1061417491 9:130454991-130455013 GTGAATGGATGGATGGATGATGG - Intronic
1061417498 9:130455025-130455047 ATGAATGGATGGATGATGGATGG - Intronic
1061417513 9:130455109-130455131 ATGAATAAATGGATGATGGATGG - Intronic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061584455 9:131556932-131556954 GAGGCTAGAGAGATGGTGGATGG - Intergenic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950588 9:133933778-133933800 ATGGATGGACGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061980956 9:134103395-134103417 GTGGATGGATGGATGCTGGATGG - Intergenic
1061980970 9:134103458-134103480 GTGGATGGATGGATGGTGGATGG - Intergenic
1061980976 9:134103480-134103502 GTGGATGGATGGATGCTGGATGG - Intergenic
1061981016 9:134103675-134103697 ATGAATGGACGGATGCTGGAAGG - Intergenic
1061981029 9:134103735-134103757 ATGGATAGATGGATGCTGGAAGG - Intergenic
1061981051 9:134103842-134103864 ATGGATAGATGGATGCTGGATGG - Intergenic
1061981081 9:134103991-134104013 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092322 9:134684956-134684978 ATTAATGGATGGATGGTGGATGG - Intronic
1062092328 9:134684987-134685009 ATTAATGGATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092349 9:134685080-134685102 GTGGATGGATGGATGGTGGGTGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092387 9:134685247-134685269 CTTAATGGATGGATGGTGGATGG - Intronic
1062092395 9:134685286-134685308 GTGGATGGATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092419 9:134685391-134685413 ATTAATGGATGGATGGTGGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092464 9:134685599-134685621 GTGGATGGATGGATGATGGATGG - Intronic
1062092467 9:134685614-134685636 GTGGATGGATGGATGGTGGATGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062201249 9:135303981-135304003 GTGAATGGTTGGATGGTGGGTGG + Intergenic
1062201296 9:135304213-135304235 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201322 9:135304337-135304359 GTGGATAGATGGATGATGGAGGG + Intergenic
1062201333 9:135304390-135304412 GTGGATAGATGAATGATGGAGGG + Intergenic
1062201344 9:135304439-135304461 ATGGATAGATGGATGATGGAGGG + Intergenic
1062201359 9:135304496-135304518 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201373 9:135304549-135304571 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201395 9:135304648-135304670 GTGGATAGATGGATGATGGAGGG + Intergenic
1062217059 9:135394893-135394915 GTGGATGGATGGGTGGTGGATGG + Intergenic
1062247722 9:135578049-135578071 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247791 9:135578395-135578417 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247860 9:135578741-135578763 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062649860 9:137569898-137569920 GTGAGTGGATGGATGGTGGGTGG - Intronic
1185497529 X:566570-566592 GTAGATGGATGGATGGTGGATGG + Intergenic
1185498262 X:575578-575600 GTGAATGGAGAGATGATAGATGG - Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1187289997 X:17943844-17943866 GATAATATAGGGATGGGGGAGGG - Intergenic
1187323537 X:18264902-18264924 GGGAATGGAGGGATTTTGGAAGG - Intronic
1187716774 X:22110597-22110619 CTGCATAGAGGGAGGGGGGAGGG - Intronic
1187898816 X:24008665-24008687 GAGAATTCAGGGATGGAGGATGG - Intronic
1188974800 X:36660354-36660376 GAGAATAGAAGGATGGTGACCGG + Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1193699410 X:84743571-84743593 GTGTGTATAGGGATGGTGTATGG - Intergenic
1195029110 X:100909192-100909214 GTGAGGAGAAGGATGGTAGAGGG - Intergenic
1196729195 X:118924061-118924083 GAGAGTAGAAGGATGGTGGCCGG - Intergenic
1198495056 X:137183950-137183972 GTGTATAGAGGGGTGGTGGTGGG - Intergenic
1199679497 X:150215348-150215370 GGGAAGAGAGGGAGGGGGGATGG + Intergenic
1200776509 Y:7174679-7174701 GAGAAAAGTGGCATGGTGGAGGG - Intergenic
1201650536 Y:16280000-16280022 GGGAATGGAGGGAAGGAGGAGGG - Intergenic