ID: 1175818909

View in Genome Browser
Species Human (GRCh38)
Location 20:61897977-61897999
Sequence GACGGATGACCCTGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175818896_1175818909 27 Left 1175818896 20:61897927-61897949 CCACTGCTTTGGTCAGGCCGGCG 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1175818909 20:61897977-61897999 GACGGATGACCCTGGCAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1175818900_1175818909 10 Left 1175818900 20:61897944-61897966 CCGGCGGGGTGACATGCTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1175818909 20:61897977-61897999 GACGGATGACCCTGGCAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175818909 Original CRISPR GACGGATGACCCTGGCAGGG AGG Intronic
900310151 1:2029599-2029621 GGCTGATGCCCGTGGCAGGGAGG - Exonic
902089907 1:13894730-13894752 GACGGATACCCCAGGAAGGGGGG - Intergenic
903059143 1:20657355-20657377 GAAGGACGATCCTGGCAGCGGGG + Intronic
906673236 1:47675524-47675546 GGTGCAGGACCCTGGCAGGGAGG + Intergenic
908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG + Intergenic
914241125 1:145853851-145853873 GACTGCTGACCCTGACAGTGAGG - Exonic
916826310 1:168445184-168445206 GAAAGATGACCCTGGTGGGGTGG + Intergenic
917259140 1:173148369-173148391 GACTGAAGACCCTGGTTGGGAGG + Intergenic
917789468 1:178490300-178490322 GACGGATGAGACAGGCAAGGAGG - Intergenic
919817123 1:201448591-201448613 AGCGGCTGACCCTGGCATGGGGG + Intergenic
920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG + Intronic
1063573003 10:7233841-7233863 GTCCCATGGCCCTGGCAGGGAGG + Intronic
1067217929 10:44317942-44317964 AACGGGTGACCCTGGCTGGGAGG + Intergenic
1067338258 10:45381124-45381146 GAAGCAGGAGCCTGGCAGGGAGG + Intronic
1069969382 10:72152912-72152934 GAATGATGATCCTGGCATGGTGG - Exonic
1072047046 10:91667288-91667310 CACGGATGACCTTGGCCAGGGGG + Intergenic
1075069380 10:119310679-119310701 GAGGGAAGCCCCAGGCAGGGCGG + Intronic
1076744155 10:132504399-132504421 GTGGGATGACCCTGTCTGGGAGG - Intergenic
1077530680 11:3093411-3093433 CCAGGATGTCCCTGGCAGGGAGG - Intronic
1080400525 11:31931179-31931201 GAGAGATGAAGCTGGCAGGGAGG - Intronic
1081752895 11:45524683-45524705 GCAGGATGGCCCTGGCTGGGCGG - Intergenic
1085310188 11:75511652-75511674 GAAGCATGGCCCTGGCTGGGTGG - Intronic
1087232619 11:95683260-95683282 GTAGGATGAGCCTGGCATGGTGG - Intergenic
1087832115 11:102830640-102830662 GACCAATCACCATGGCAGGGAGG - Intergenic
1091777950 12:3196964-3196986 CACGGAGGGCCCTCGCAGGGTGG - Intronic
1091958757 12:4672528-4672550 GACGTATGAGCTTGGGAGGGAGG + Intronic
1092070588 12:5628265-5628287 GTCAGATGACCCAGGCAGGGAGG - Intronic
1094404217 12:30097741-30097763 GTCTGAAGACCCTGGCAAGGTGG - Intergenic
1104643321 12:130481034-130481056 GAAAGAGGAGCCTGGCAGGGGGG + Intronic
1105292344 13:19061026-19061048 GAAGGATCAGCCCGGCAGGGTGG - Intergenic
1106479012 13:30123063-30123085 GACGGCTGTCCTTGGCAGGGTGG - Intergenic
1116069528 14:40026105-40026127 TAAGGATGACCCTGGGAAGGAGG + Intergenic
1122029131 14:98899807-98899829 GAGTGATGACCCTCGCAGTGTGG + Intergenic
1123036060 14:105472437-105472459 GACAGAGGACCCTAGCAGGGTGG - Intergenic
1123430119 15:20207769-20207791 CATGTATGACCCAGGCAGGGCGG - Intergenic
1125595999 15:40886451-40886473 GAGGGATGACAGTAGCAGGGAGG + Intergenic
1126479209 15:49099344-49099366 GAGGGATGTGCCTGGCAGGTTGG + Intergenic
1129683549 15:77671780-77671802 GAGTCTTGACCCTGGCAGGGTGG + Intronic
1130374602 15:83317465-83317487 TATGGATGACCCTGGCAGTAAGG - Intergenic
1131244088 15:90774884-90774906 AAGGGATGACCCTGACAAGGTGG + Intronic
1132365200 15:101251820-101251842 GCCGGAGGACGCGGGCAGGGCGG - Exonic
1133174764 16:4005916-4005938 GACAGCGGACCCGGGCAGGGAGG - Intronic
1137387067 16:48051516-48051538 GAGGGATGTCCCTGACATGGGGG + Intergenic
1141732176 16:85830028-85830050 GAGAAATGGCCCTGGCAGGGAGG - Intergenic
1142557954 17:792365-792387 GAAGCATCATCCTGGCAGGGAGG + Exonic
1142817171 17:2435680-2435702 GAAGGAAGACTCTGGCAGGGGGG + Intronic
1143673187 17:8411188-8411210 GGCAGGTTACCCTGGCAGGGTGG + Intergenic
1144679067 17:17180838-17180860 CAGAGATGACCCTGGCAGTGAGG + Intronic
1146717642 17:35099838-35099860 GAGCCATGACCCTGGCTGGGAGG - Intronic
1147521403 17:41177013-41177035 GAAGAATGACCCTGGGAAGGAGG + Intergenic
1148835703 17:50464708-50464730 GAAGGATGATCCTGGGAGGGTGG + Exonic
1149016420 17:51913719-51913741 AAGGGATGACCCTGGGAGGCTGG + Intronic
1150791251 17:68201404-68201426 GACAGATGACCCTGGCTGCCAGG + Intergenic
1152149174 17:78588448-78588470 GGCTGGTGGCCCTGGCAGGGAGG - Intergenic
1152694157 17:81735361-81735383 GGTGGATGCCCCTGGAAGGGTGG - Intergenic
1153836534 18:8969181-8969203 GAAGGAAGCCCCCGGCAGGGTGG + Intergenic
1154126772 18:11698702-11698724 GACGGATGAGACTGGAATGGTGG + Intronic
1154129017 18:11719913-11719935 GACAGATGTCCCTGGGAGGTTGG + Intronic
1155422735 18:25672749-25672771 GAGTGAGGACCCTGGAAGGGAGG - Intergenic
1157159419 18:45299747-45299769 GACGGATGTGCCGGGCACGGTGG - Intronic
1157281857 18:46351518-46351540 GAGGGAGGACAATGGCAGGGCGG - Intronic
1157618291 18:49000953-49000975 GACTAATGAGCCTGGCACGGTGG - Intergenic
1158560144 18:58506609-58506631 AACGGCTGACCCTGGAAGGCAGG - Intronic
1161199919 19:3008904-3008926 GACGGATGACCCTCGGAGATGGG + Exonic
1161589168 19:5121062-5121084 CACGGCTGCCCCTGGCAGGTGGG - Intronic
1161593762 19:5141010-5141032 GACAGATCAGTCTGGCAGGGTGG + Intronic
1161724328 19:5919499-5919521 GGCTGATGACCCAGGCAGAGGGG + Intronic
1162590111 19:11585896-11585918 CACGGATGACCTTGGCCGGAGGG - Intronic
1165070137 19:33251063-33251085 GGCTGAGGACCCTTGCAGGGTGG - Intergenic
1167174949 19:47859138-47859160 AACGGAGGGTCCTGGCAGGGTGG + Intergenic
1168719781 19:58548649-58548671 GAGAGAGGACCCAGGCAGGGGGG + Intronic
929782287 2:44964887-44964909 GGCGGCTGAGCCAGGCAGGGAGG - Intergenic
930380329 2:50620052-50620074 GACTGGTGACCCTGGAAGGTCGG + Exonic
931230670 2:60372048-60372070 GACCGAGGACCCTGGCAGGAAGG - Intergenic
933721912 2:85402378-85402400 GACGGAAGACCCTGGCCCAGGGG - Intronic
933759158 2:85662322-85662344 GACGGAGGACTCAGGCAGAGGGG + Intronic
935815354 2:106842320-106842342 GAAGGCAGAGCCTGGCAGGGAGG + Intronic
940859449 2:158757135-158757157 GACAGATGGCCCTGGGGGGGCGG + Intergenic
944094737 2:195953363-195953385 GTCTGTTGACCCTGGCTGGGAGG + Intronic
945251507 2:207769299-207769321 GACGGAGGACCCAGGCTGGCTGG - Exonic
948479682 2:238241445-238241467 GAGGGGTGGCCCTGGCAGGATGG + Intergenic
1168810831 20:703585-703607 GATGGTGGACCATGGCAGGGTGG - Intergenic
1173361029 20:42344537-42344559 GAGGGATGACCATGACAGAGTGG + Intronic
1174207418 20:48850802-48850824 GAAGGGTGCTCCTGGCAGGGAGG - Intergenic
1175264204 20:57692669-57692691 GCCGGGTGCCACTGGCAGGGCGG + Intronic
1175302364 20:57951855-57951877 GAAGGCTGACCTAGGCAGGGAGG - Intergenic
1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG + Intronic
1175735357 20:61382407-61382429 CATGGAAGACCCTGGCATGGGGG + Intronic
1175818909 20:61897977-61897999 GACGGATGACCCTGGCAGGGAGG + Intronic
1176409001 21:6437602-6437624 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1179440346 21:41388961-41388983 GAAGGATGACTCTGCCATGGTGG - Intronic
1179684494 21:43045924-43045946 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1181079395 22:20403887-20403909 GAGAGGTGACCCTGGCAAGGTGG - Intronic
1183549081 22:38470693-38470715 GAGGGCTGCCCCTGGCAGTGGGG + Intronic
1183978226 22:41525378-41525400 GACGGGGGGCCCTGGCAGGGTGG - Intronic
1184391843 22:44207404-44207426 GACGGGTGAGGCTGGCGGGGAGG + Exonic
1185168413 22:49276613-49276635 GAAGGAAGACCCTGGATGGGTGG - Intergenic
953732877 3:45465094-45465116 GAGGGAGAATCCTGGCAGGGAGG - Intronic
954100693 3:48370328-48370350 CACGGAGCACCCTGGCAAGGTGG + Intergenic
954791168 3:53134665-53134687 GTCAGATTTCCCTGGCAGGGAGG - Intergenic
961053138 3:123764523-123764545 GAGGGAAGACCATCGCAGGGTGG + Intronic
968653555 4:1769294-1769316 GACAGAGGACTCTGGCAGGCGGG - Intergenic
969599476 4:8167407-8167429 GAGGGAGGCCCCTGGCAGGCAGG - Intergenic
973770094 4:54198411-54198433 GATGGACAACCCGGGCAGGGAGG - Intronic
976223006 4:82773191-82773213 CACTGAGGACCCAGGCAGGGAGG - Intronic
979670478 4:123355781-123355803 GATGGATTACCCTGGCACAGTGG - Intergenic
985627889 5:999466-999488 GCCGGATGTCCAAGGCAGGGAGG + Intergenic
985725317 5:1513057-1513079 GAGGGAGGGCCCAGGCAGGGTGG + Intronic
988498308 5:31763242-31763264 GACTGTGGCCCCTGGCAGGGAGG - Intronic
997630010 5:135360292-135360314 GAGGGAGGACCCTGGCAGCTGGG - Intronic
998152049 5:139763139-139763161 GAGGAATAACCCTGGCAGGAGGG + Intergenic
998341612 5:141422703-141422725 GACGGATGACACTGTCCAGGGGG + Exonic
999394708 5:151220095-151220117 GAAGGTTGACGCGGGCAGGGTGG - Intronic
1004001751 6:11602715-11602737 GAAGGGTGGCCCTGGGAGGGAGG - Intergenic
1007098659 6:39229647-39229669 GGCGGCTGACCCTGGGAGCGCGG - Intergenic
1010389782 6:75323670-75323692 GACTGATTGCTCTGGCAGGGTGG - Intronic
1011236769 6:85227235-85227257 GACAGATGGCCGTGGTAGGGTGG - Intergenic
1013457154 6:110340466-110340488 GATGGACCACTCTGGCAGGGAGG - Intronic
1015832603 6:137386464-137386486 GAGGGATGACCATGTGAGGGAGG + Intergenic
1017746908 6:157455392-157455414 GAAGGGTGACGCTGGCATGGGGG + Intronic
1018923291 6:168190313-168190335 GGCGGCTGACCCTTGCAGGCAGG - Intergenic
1020241171 7:6396291-6396313 GCTGGCTGACCCTGGCTGGGAGG - Intronic
1025708927 7:63890476-63890498 GGGGGCTGACCCTGGCAGGTGGG + Intergenic
1026378673 7:69777147-69777169 TCCAGATGACCCTGGCAGTGTGG + Intronic
1026574903 7:71564010-71564032 GACATATCACCCTGGCAGGGTGG - Intronic
1030326886 7:108229412-108229434 GATGGATTAACCAGGCAGGGTGG - Intronic
1030676750 7:112392638-112392660 GACGGAGGAGCCGGGCACGGTGG - Intergenic
1032061348 7:128727813-128727835 GAAGGATTAGCCTGGCAGGAAGG - Intronic
1033051397 7:138007469-138007491 GAGGGGTGGCCCTGGGAGGGTGG - Intronic
1036608540 8:10329644-10329666 GACACATGACACTGGCAGGTTGG - Intronic
1039191286 8:34978704-34978726 GATGGAGCACCCTGGGAGGGTGG - Intergenic
1041574578 8:59379525-59379547 GATGGAGAACTCTGGCAGGGAGG + Intergenic
1044553268 8:93535426-93535448 GAGGGATGAGCCTGGAAAGGTGG - Intergenic
1044721978 8:95159827-95159849 GAAGGATGTCCATGGCAGTGCGG - Intergenic
1048095561 8:131288799-131288821 GATTCATGACCCAGGCAGGGTGG + Intergenic
1049420735 8:142515405-142515427 GACTGATGAGCCAGGCGGGGAGG + Intronic
1049420802 8:142515707-142515729 GACTGATGAGCCAGGCTGGGAGG + Intronic
1054159826 9:61666031-61666053 GCCTCATGACCCTGGCAGAGAGG - Intergenic
1055645185 9:78356454-78356476 GGCCCATGTCCCTGGCAGGGCGG + Intergenic
1055805345 9:80086971-80086993 GCCGGGAGACACTGGCAGGGTGG + Intergenic
1061529554 9:131199464-131199486 GACAGAAAACACTGGCAGGGCGG - Intronic
1062614023 9:137387962-137387984 GACAGATGGCCCTGGCCAGGAGG + Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1191123206 X:56927033-56927055 GACTGAAGACCCTGGTCGGGAGG + Intergenic
1192923874 X:75735436-75735458 GACTGAAGGCCCTGGCAGAGTGG + Intergenic
1193266925 X:79482803-79482825 GTCTGTTGACCCTTGCAGGGAGG - Intergenic
1194055722 X:89128691-89128713 GACTGAAGACCCTGGTAGAGTGG + Intergenic
1199035880 X:143050620-143050642 GACTGAAGACTCTGGTAGGGTGG + Intergenic
1199557061 X:149120988-149121010 TACGGATGAAGCTGGGAGGGGGG - Intergenic
1201495148 Y:14584680-14584702 GACGGATGCCTCTGGCAGTTTGG + Intronic