ID: 1175819606

View in Genome Browser
Species Human (GRCh38)
Location 20:61901639-61901661
Sequence CGTCCACACCGGGCTCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175819599_1175819606 -5 Left 1175819599 20:61901621-61901643 CCTCCAATTAGATGCCCTCGTCC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 69
1175819597_1175819606 12 Left 1175819597 20:61901604-61901626 CCAGGCTTGGGCACTTCCCTCCA 0: 1
1: 0
2: 3
3: 50
4: 415
Right 1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 69
1175819598_1175819606 -4 Left 1175819598 20:61901620-61901642 CCCTCCAATTAGATGCCCTCGTC 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 69
1175819594_1175819606 29 Left 1175819594 20:61901587-61901609 CCGGCTGGGCAAGAGCACCAGGC 0: 1
1: 0
2: 0
3: 25
4: 297
Right 1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 69
1175819600_1175819606 -8 Left 1175819600 20:61901624-61901646 CCAATTAGATGCCCTCGTCCACA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175819606 Original CRISPR CGTCCACACCGGGCTCCGGC CGG Intronic
900633455 1:3650933-3650955 CCTCCACCCCTGGCTCCCGCAGG + Intronic
900641411 1:3689619-3689641 CGTCCCCACCGAGAGCCGGCAGG - Intronic
901814311 1:11785199-11785221 CATCCTCACCCAGCTCCGGCCGG + Exonic
904031268 1:27534861-27534883 CGTCCACATCGTCCTCTGGCAGG - Exonic
915273463 1:154772210-154772232 TGTCCACATCGGCCTCCGCCCGG + Exonic
916037414 1:160933550-160933572 CTTCCACACAGGGCGGCGGCTGG - Intergenic
923631002 1:235649627-235649649 CGGACACCCGGGGCTCCGGCCGG + Intronic
924415126 1:243850197-243850219 CGGCCGCACCGGGCTCCAGGAGG - Intronic
924524715 1:244835723-244835745 CGGGCTCACCGGGCTCCGGCGGG - Exonic
1063464951 10:6237022-6237044 CGGCCACACTGGCCTCCTGCAGG + Intergenic
1066452887 10:35547689-35547711 CATCCACACAGGGCTCCGGCAGG - Intronic
1067060710 10:43076792-43076814 GGTCCGCACCCGGCTCCTGCCGG + Intergenic
1073060553 10:100731047-100731069 CCTTCACTCCGGGCACCGGCGGG - Intergenic
1076063880 10:127433407-127433429 CTTCCAGACCAGGCTCCGACGGG + Exonic
1077134771 11:993037-993059 CATCCACAACAGGCTCTGGCTGG - Intronic
1085640244 11:78188792-78188814 CGTCCCCGCCGGTGTCCGGCCGG + Exonic
1087141484 11:94769039-94769061 CGGCCAGACCCGGCTCTGGCGGG + Intronic
1088810383 11:113387893-113387915 CGACCCCACCGAGCTGCGGCTGG + Exonic
1097029190 12:56079556-56079578 CCTCCAGACCCGGCGCCGGCCGG - Intergenic
1099890183 12:88580537-88580559 CGCCTACCCCGGGCTCCGGAAGG - Intronic
1103691051 12:122774632-122774654 CGCCCACACCGGGCTTCTCCGGG + Exonic
1113715295 13:112501420-112501442 TGTCCACACAGGGCACCTGCAGG + Intronic
1113842859 13:113370165-113370187 CGGCCACCCCGGGCTCCCTCAGG + Intergenic
1121781376 14:96624512-96624534 CCTCCACACAGGGCTCTGGCTGG + Intergenic
1123402593 15:20003096-20003118 GTTCCCCACCTGGCTCCGGCTGG - Intergenic
1123511931 15:21009750-21009772 GTTCCCCACCTGGCTCCGGCTGG - Intergenic
1132558784 16:584224-584246 AGTCTACACCGGCCTCCTGCTGG + Intergenic
1132813376 16:1813044-1813066 TGTTCACACGGGGCTGCGGCTGG + Intronic
1139530049 16:67538296-67538318 CTGCCCCAGCGGGCTCCGGCCGG - Intronic
1144085364 17:11803631-11803653 CGTCAGCACCGGACTCCAGCTGG - Intronic
1144782897 17:17816786-17816808 CGTCCACAGCAGGCTCTGGAGGG + Intronic
1152536124 17:80951182-80951204 CGTCCACACCCGGCTGGGCCTGG + Intronic
1160044704 18:75375902-75375924 AGTCCACACCTGGCACAGGCAGG + Intergenic
1160679684 19:407020-407042 CCTCCACACCGGGTGCTGGCGGG - Exonic
1162591938 19:11597683-11597705 CCTCCACAGCCGGTTCCGGCCGG - Intronic
1162705371 19:12551256-12551278 CTTCCACAGCCGGTTCCGGCCGG + Intronic
1165732236 19:38153159-38153181 CGTCCAGACAGGGCATCGGCAGG + Intronic
1167145513 19:47679368-47679390 GGTCCACACTGGGGGCCGGCTGG - Exonic
926190086 2:10721718-10721740 CGTCCTTACCGGGAGCCGGCGGG - Exonic
933667061 2:84971856-84971878 CGACCACACCGGGCTCTTCCGGG - Intronic
936251784 2:110873347-110873369 AGTCCACACTGGGCCCCAGCTGG - Intronic
941004380 2:160232758-160232780 TGTCCACACTGGTCTCTGGCTGG + Intronic
949058949 2:241945474-241945496 CTCCCACCGCGGGCTCCGGCTGG - Intergenic
1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG + Intronic
1175893092 20:62323911-62323933 CGAGCACACTGTGCTCCGGCTGG + Intronic
1176076712 20:63251932-63251954 CTTCCCCCCGGGGCTCCGGCAGG - Intronic
1179726917 21:43345992-43346014 CGTCCTCACTGAGCTCTGGCTGG - Intergenic
952970881 3:38649542-38649564 CGCCCACCCCGGGGCCCGGCCGG - Exonic
960577207 3:119241031-119241053 CGACCACACCGGGCGCTGGAAGG + Intronic
968445212 4:649000-649022 TGTCCACACCGGGCAGTGGCGGG + Intronic
968938563 4:3626159-3626181 AGGCCACACCAGGCCCCGGCTGG - Intergenic
969053279 4:4387154-4387176 CACCCACGCCCGGCTCCGGCAGG - Exonic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
987358200 5:17083505-17083527 CGTCCACTCCGAACTCCAGCTGG - Intronic
1005944782 6:30587355-30587377 CCACCACACTGGGCTCAGGCTGG - Intronic
1006151475 6:31992382-31992404 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006157776 6:32025120-32025142 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG + Exonic
1019167782 6:170110385-170110407 CGTCCACACCGGCTTGCAGCCGG + Intergenic
1019599666 7:1874941-1874963 CCCCCACCCCGGGCCCCGGCTGG + Intronic
1022739633 7:33109073-33109095 CGCCCGCACCAGGCTCCTGCCGG + Intronic
1034174826 7:149091492-149091514 CGGGCACCCCGGGCCCCGGCAGG + Intergenic
1034869944 7:154675186-154675208 CGTCCACACCGGGGCCTGTCCGG + Intronic
1035754676 8:2022546-2022568 CCTCCACCCTGGGCTCAGGCTGG - Intergenic
1037320194 8:17634159-17634181 CCTCCACATCGGGCTCCCCCAGG - Exonic
1038404349 8:27310696-27310718 CGGGCACACTGGGCTCTGGCAGG + Intronic
1040865909 8:52048899-52048921 CGTCCTCACATGGCTCCTGCTGG + Intergenic
1049726283 8:144148011-144148033 CGCCCACTCCGGGCCCCTGCTGG + Intronic
1054452178 9:65409177-65409199 AGGCCACACCAGGCCCCGGCTGG + Intergenic
1056774621 9:89501844-89501866 AGTCCACACCGGTCTCTGTCAGG + Intergenic
1058417030 9:104800021-104800043 CCCCCAAACCGGGCTCCTGCAGG + Intronic
1060795053 9:126507623-126507645 CGTTCACACCGGACTCGGGCAGG + Intergenic
1061409842 9:130414269-130414291 CGCCCACACCGGGCCTCTGCTGG - Intronic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1062249068 9:135585110-135585132 TGTCCACACCAGACTCCGGCCGG + Intergenic
1062635270 9:137487306-137487328 CATCCACACCGGGCCCTGGTCGG + Intronic