ID: 1175820107

View in Genome Browser
Species Human (GRCh38)
Location 20:61904502-61904524
Sequence ACCGTGTCCCCCTGGTCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175820099_1175820107 30 Left 1175820099 20:61904449-61904471 CCTGCCTGGGCTGGAGTCCTCAC 0: 1
1: 0
2: 5
3: 50
4: 328
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1175820103_1175820107 5 Left 1175820103 20:61904474-61904496 CCACCAGCCAGAAGTCAGCTTTG 0: 1
1: 0
2: 1
3: 11
4: 244
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1175820100_1175820107 26 Left 1175820100 20:61904453-61904475 CCTGGGCTGGAGTCCTCACGCCC 0: 1
1: 0
2: 1
3: 20
4: 281
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1175820101_1175820107 13 Left 1175820101 20:61904466-61904488 CCTCACGCCCACCAGCCAGAAGT 0: 1
1: 0
2: 1
3: 25
4: 215
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1175820105_1175820107 -2 Left 1175820105 20:61904481-61904503 CCAGAAGTCAGCTTTGTCTGCAC 0: 1
1: 0
2: 3
3: 14
4: 181
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1175820102_1175820107 6 Left 1175820102 20:61904473-61904495 CCCACCAGCCAGAAGTCAGCTTT 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1175820104_1175820107 2 Left 1175820104 20:61904477-61904499 CCAGCCAGAAGTCAGCTTTGTCT 0: 1
1: 0
2: 1
3: 25
4: 196
Right 1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175820107 Original CRISPR ACCGTGTCCCCCTGGTCTCT CGG Intronic
900379301 1:2375930-2375952 ACCGTGCCACCCTGGGCTCTGGG + Intronic
900580217 1:3405071-3405093 ACCGTGTCCCCCAGGTCAGAAGG + Intronic
903006178 1:20300428-20300450 ACGGGGTCCCTCTGGGCTCTGGG - Intronic
903808612 1:26022269-26022291 GCCGTGTCCCCCTGCCCTCCTGG - Exonic
904883280 1:33716505-33716527 AACCTGACCCTCTGGTCTCTTGG - Intronic
915285254 1:154848140-154848162 ACCGTGCCATCCTGTTCTCTGGG + Intronic
921193032 1:212726553-212726575 CCCCTGTCCACCTTGTCTCTGGG + Intronic
1062973864 10:1669002-1669024 ACCGTCTCCCCTTGGCCCCTGGG + Intronic
1064315010 10:14247179-14247201 ACAGTCTCCCACTGGTCTTTGGG - Intronic
1064730404 10:18325270-18325292 ACCTTGTCCTCCTGGGCTCAAGG + Intronic
1066626078 10:37407025-37407047 AGCCTGTGCCCCTGGTCTGTGGG - Intergenic
1072427014 10:95338160-95338182 ACCGTGTCACCCTGAACTCAAGG + Intronic
1073357659 10:102869913-102869935 ACCCTGTCCCCCGGGACTCCTGG + Intronic
1077201018 11:1307608-1307630 ACCATGCCCCCCTGCTCTCCAGG + Intronic
1078255133 11:9652345-9652367 ACTGGGTCCCCCTGGTCACTGGG - Intergenic
1083772416 11:64875699-64875721 CCCGTGGGCCCCTGGTCACTGGG - Intronic
1088231341 11:107676593-107676615 TCAGAGTCCCCCTGGTCCCTAGG + Intergenic
1089386799 11:118073764-118073786 AGCGAGTTCCCCTGGCCTCTGGG + Intergenic
1089644557 11:119870065-119870087 ACCATGACACCCTTGTCTCTTGG + Intergenic
1090244211 11:125204137-125204159 ACCCTGTTCACCTGGTCACTGGG - Intronic
1102776379 12:115523169-115523191 ACCTTGACCACCTGGGCTCTGGG - Intergenic
1108322853 13:49304099-49304121 ACACTGTCAGCCTGGTCTCTGGG + Intergenic
1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG + Intergenic
1113607634 13:111621990-111622012 CACGTGTCCCCCTCGTCCCTAGG + Intronic
1115380548 14:32733259-32733281 ACAGTGCCATCCTGGTCTCTGGG - Intronic
1118107893 14:62681312-62681334 ACGATGACCCCCTGGTATCTAGG - Intergenic
1120824853 14:88945777-88945799 ACCGTGTCCTCCCTGTGTCTGGG - Intergenic
1123148597 14:106158698-106158720 CCTGTGTCCACCTGGTCTCATGG + Intergenic
1124018693 15:25900922-25900944 ACCGTTTCCCTCTGTTCTCTAGG + Intergenic
1124230008 15:27936313-27936335 ACCTTAACCCCCTGGTCACTCGG - Intronic
1124906368 15:33872447-33872469 ACCATGTACACATGGTCTCTGGG - Intronic
1125979842 15:43990049-43990071 ACCGTCACGCCCTGGTGTCTGGG + Intronic
1131893995 15:97006144-97006166 ACACTTTCCCCCTGGTTTCTTGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1134209037 16:12260576-12260598 TCCATGTCCTCCTGGTCTCTTGG + Intronic
1135046763 16:19162338-19162360 TCCCTGTCCACCTGGTCACTTGG + Intronic
1138683671 16:58706031-58706053 ACAGTGTCCCCATGGTTGCTGGG - Intergenic
1140616169 16:76667167-76667189 ACCATGTCCTCCTGGGCTCAAGG + Intergenic
1142161253 16:88558755-88558777 CCCATGTCCCCCTGTACTCTGGG + Intergenic
1144462352 17:15468278-15468300 ACTGTGTCCTCCTGGCATCTTGG - Intronic
1151530754 17:74703279-74703301 CTCATGTCTCCCTGGTCTCTAGG + Intronic
1152223405 17:79081707-79081729 GCCCTGTCCCTCTGGGCTCTAGG + Intronic
1152564373 17:81093552-81093574 ACGGAGCCCCCATGGTCTCTGGG - Intronic
1162791307 19:13064406-13064428 AGCTTGTCCCCCTAGACTCTGGG - Intronic
1165710852 19:38009805-38009827 ACCCTGTCCTCCTGGTCACTGGG - Intronic
1166517701 19:43459871-43459893 ACTGTGTCCCACTTGTCTGTAGG - Intergenic
932121037 2:69100400-69100422 ACCGTCTCCCCCTGGCCTAGGGG + Intronic
933834438 2:86233886-86233908 CCCCTGTCCCCCAGATCTCTGGG - Intronic
936248890 2:110852200-110852222 ACCGTGTCGCCCTGGCCTGGTGG + Intronic
938140226 2:128789407-128789429 GACTTGTCCCCCTGGGCTCTGGG - Intergenic
938644363 2:133315958-133315980 TCCGTAGCCCCATGGTCTCTTGG - Intronic
946816266 2:223581902-223581924 ACCATCTCACTCTGGTCTCTGGG + Intergenic
947149329 2:227098718-227098740 ACCTGGTCCCCCAGGTCTCTTGG - Exonic
947827970 2:233118913-233118935 ACCCTGGCTCCCTGGCCTCTGGG + Intronic
948468173 2:238162038-238162060 ACCCTGTGCCCCTAGTCCCTGGG - Intronic
1171794890 20:29559035-29559057 ACCTGGGCCCCCTGATCTCTCGG + Intergenic
1171853564 20:30325230-30325252 ACCTGGGCCCCCTGATCTCTCGG - Intergenic
1173472225 20:43332870-43332892 ACTGTGTCCCACTGGTCTCTTGG + Intergenic
1173699789 20:45059004-45059026 ACAGTGTCCCCCTTGTCAATGGG + Intronic
1174130994 20:48343211-48343233 CTCGTGTCCACCTGGTCCCTGGG - Intergenic
1175519107 20:59588399-59588421 GCCCCGTCCCCCTGGTCCCTGGG + Intronic
1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG + Intronic
1177477724 21:21645327-21645349 CCCGTATCCCCATTGTCTCTAGG + Intergenic
1180355809 22:11838559-11838581 GCCGTGACCTCCTGGGCTCTGGG - Intergenic
1180960919 22:19761918-19761940 AACTTGTTCCCCTTGTCTCTTGG - Intronic
1182108193 22:27704243-27704265 ACCGGGTCCCCTGGGTTTCTGGG - Intergenic
1182163570 22:28148783-28148805 AACTAGTCTCCCTGGTCTCTGGG + Intronic
1184647274 22:45903209-45903231 ACCGAGTCCCCCTGGCTTCTGGG - Intergenic
1184775038 22:46618858-46618880 ACCGTGTCCACCAGCTGTCTGGG - Intronic
1185249521 22:49792895-49792917 AGCGGGTCCCCATGGTCTCAGGG - Intronic
954039937 3:47877812-47877834 ACAGAGTCCCTTTGGTCTCTAGG - Intronic
968952512 4:3702295-3702317 CCCGTGGCCCCCAGGTCTCAGGG + Intergenic
974806194 4:66883311-66883333 ACTGTGTCCCCATTGTATCTTGG + Intergenic
979351685 4:119650824-119650846 TCCCTTTCCCCCTGGTCTCTGGG + Intergenic
984305771 4:177988495-177988517 ACCCCCTCCCCTTGGTCTCTTGG - Intronic
990765570 5:59178370-59178392 TCTGTGTCCCCCTTGTCCCTAGG + Intronic
991954903 5:71984895-71984917 ACTGTGGCCCCCTGGCTTCTGGG - Intergenic
996815213 5:127566635-127566657 ACCATGTTCCTCTGGGCTCTGGG - Intergenic
997658105 5:135570028-135570050 CCCGAGTCCCCCTGGCATCTTGG + Intergenic
999259249 5:150227945-150227967 CCTGTGTGTCCCTGGTCTCTGGG + Intronic
1002981520 6:2143039-2143061 ACTGTTTCCCACTGGTCTGTAGG + Intronic
1004991753 6:21146358-21146380 ACCCTTTCCTCCTGGGCTCTGGG - Intronic
1006188063 6:32191662-32191684 ACCCAGGCCTCCTGGTCTCTTGG - Intronic
1006227708 6:32554411-32554433 ACCCGGTCTCCCTGGGCTCTAGG - Intronic
1006276516 6:33008739-33008761 TCCCTATCCCCTTGGTCTCTGGG - Intronic
1017132404 6:151118926-151118948 TCCGTGTCCTCTTGGACTCTTGG - Intergenic
1019304698 7:327701-327723 TCGGTGTCAGCCTGGTCTCTGGG + Intergenic
1020316519 7:6909274-6909296 AGGGTCTCCGCCTGGTCTCTTGG - Intergenic
1023142291 7:37113587-37113609 ACCAGGTACCTCTGGTCTCTGGG - Intronic
1024526881 7:50356852-50356874 ACCGTCCCACCCTGGTCTCCAGG - Intronic
1026872400 7:73861104-73861126 ACCGGGTCCCCATGGTAACTTGG + Intergenic
1029116146 7:98238290-98238312 CCTGTCTCCCCCTGGCCTCTGGG + Intronic
1031882273 7:127210729-127210751 CCAGTGTTCCCCTGGTGTCTTGG - Intronic
1034200671 7:149281441-149281463 ACCCTGTCCCCCAGGTCACTCGG - Intronic
1035061901 7:156075476-156075498 CCCGTGTCCCCTTGTTCTGTGGG + Intergenic
1035828059 8:2665438-2665460 ACCTTGTCCACCAGGTCTCAGGG - Intergenic
1037415520 8:18645629-18645651 ACTGTGTCACGCTGGACTCTTGG - Intronic
1038068131 8:23984518-23984540 ACCCTGGCGCCCTGGTCTCCAGG - Intergenic
1038455829 8:27671291-27671313 CCAGGGTCCCCCTGGTCTCCCGG + Exonic
1048884180 8:138895972-138895994 GCCATTTCCCCCTGGTTTCTTGG - Intronic
1053390543 9:37732237-37732259 ACTGTGTCCCCTCGTTCTCTCGG - Intronic
1055582463 9:77721521-77721543 AAAGTGTCCCTCTTGTCTCTTGG - Intronic
1055623517 9:78150001-78150023 ACCCTGTGCCAGTGGTCTCTGGG - Intergenic
1060979896 9:127785932-127785954 TCCGGCTCCCCCTGGCCTCTCGG + Intronic
1061477884 9:130881098-130881120 CCCGTGTCCTGGTGGTCTCTGGG + Intronic
1061902226 9:133678759-133678781 ACCGTCTTCCCTGGGTCTCTGGG + Intronic
1062273522 9:135720401-135720423 ACCGAGTCACCCAGGTCTCAAGG - Intronic
1186452875 X:9687881-9687903 CCCGTGGCCCCCTGGTTGCTGGG + Intronic
1186797554 X:13061795-13061817 CCTGTGTCCCCATTGTCTCTAGG - Intergenic
1190094346 X:47466960-47466982 CCCCTTTCCCCCAGGTCTCTGGG - Intronic
1190395237 X:49975645-49975667 TCCATGTCCCCATAGTCTCTTGG + Intronic
1190860244 X:54337981-54338003 ACCTTGTCCTCCTGGGCTCAAGG - Intronic
1191615906 X:63168933-63168955 ACCCTGTCCCCCTTCTCTCAGGG - Intergenic
1191620392 X:63209990-63210012 ACCCTGTCCCCCTTCTCTCAGGG + Intergenic
1196104529 X:111882230-111882252 AGAGTATCCCCCTGGTTTCTTGG + Intronic
1197893817 X:131289711-131289733 ACTGTGTGCCCCTGGGCCCTGGG + Intronic
1201799060 Y:17934408-17934430 ATGGTGTCCCACTGGTTTCTAGG - Intergenic
1201802493 Y:17971548-17971570 ATGGTGTCCCACTGGTTTCTAGG + Intergenic