ID: 1175821854

View in Genome Browser
Species Human (GRCh38)
Location 20:61914257-61914279
Sequence GGGGCTTCACACACCTACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175821848_1175821854 2 Left 1175821848 20:61914232-61914254 CCCTTCTGTGGCCACACAGGTAG 0: 1
1: 0
2: 1
3: 22
4: 241
Right 1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG 0: 1
1: 0
2: 0
3: 7
4: 137
1175821849_1175821854 1 Left 1175821849 20:61914233-61914255 CCTTCTGTGGCCACACAGGTAGC 0: 1
1: 1
2: 2
3: 19
4: 255
Right 1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG 0: 1
1: 0
2: 0
3: 7
4: 137
1175821853_1175821854 -9 Left 1175821853 20:61914243-61914265 CCACACAGGTAGCTGGGGCTTCA 0: 1
1: 1
2: 103
3: 3567
4: 57610
Right 1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG 0: 1
1: 0
2: 0
3: 7
4: 137
1175821846_1175821854 5 Left 1175821846 20:61914229-61914251 CCTCCCTTCTGTGGCCACACAGG 0: 1
1: 0
2: 6
3: 44
4: 289
Right 1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175821854 Original CRISPR GGGGCTTCACACACCTACCC CGG Intronic
901849068 1:12003862-12003884 AGGGCTGCACACACGCACCCAGG - Intronic
903031363 1:20466426-20466448 GGGGCTTTCCCCACCCACCCAGG + Intergenic
903969599 1:27110001-27110023 GGGTCTTCACAGAGCTTCCCAGG - Intronic
904512958 1:31029390-31029412 GGGGCTCCCCAAACCTAACCAGG + Intronic
904869750 1:33609079-33609101 GAGCCTGCACACACCTTCCCTGG + Intronic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
906214762 1:44032058-44032080 GGGGCTGCAGACACCAACCTGGG + Intergenic
907310030 1:53533985-53534007 GGGGTTACACACACGGACCCTGG + Intronic
910463734 1:87474773-87474795 AGGCCTTCCCAGACCTACCCAGG + Intergenic
910505460 1:87945700-87945722 GTGGCTTCCTACACTTACCCTGG + Intergenic
913131277 1:115839619-115839641 GGGGCTGCACGCACCGCCCCTGG + Exonic
914358460 1:146909237-146909259 AGGACTTCCCAGACCTACCCAGG + Intergenic
914494965 1:148187770-148187792 AGGACTTCCCAGACCTACCCAGG - Intergenic
915113268 1:153578400-153578422 GGGGCCCCACACACCCACCTGGG + Intergenic
915418463 1:155760628-155760650 AGGGCTTCTCGCACCTACACGGG + Exonic
915622488 1:157094302-157094324 GGGGCTCCCCATACCTGCCCTGG - Intronic
916502810 1:165401204-165401226 GGGTCCACACACACCTGCCCAGG + Exonic
918282938 1:183023473-183023495 CGCGCTTCCCTCACCTACCCCGG - Exonic
919205800 1:194420638-194420660 AAGGGTGCACACACCTACCCAGG + Intergenic
1068246277 10:54374267-54374289 GGGGCTTGACTCCCCTGCCCAGG - Intronic
1071719700 10:88131078-88131100 GGGGCTTCCCACAACTGCCTGGG - Intergenic
1073010389 10:100354624-100354646 AGGGCTTCACTCACCTCCTCTGG - Exonic
1076343239 10:129764336-129764358 GGGGCTTCCCCCACCTCCCTCGG + Intronic
1076598974 10:131645009-131645031 GTGGCTTCACACAGTGACCCCGG + Intergenic
1079098519 11:17526631-17526653 GGGGCTTCACACAGGCTCCCAGG - Intronic
1083254671 11:61488790-61488812 GGAGCTGCACACACATTCCCAGG - Intronic
1083738983 11:64697761-64697783 GAGGCTTCACTCACCTTCCATGG + Exonic
1084062273 11:66684076-66684098 GGGCCTGCACACACCTAACTCGG + Intergenic
1084203422 11:67577136-67577158 GAGCCTTCCCACACCTACCAGGG - Intergenic
1089739950 11:120575600-120575622 TGTGCCTCACATACCTACCCAGG + Intronic
1090931127 11:131299052-131299074 GGGGCTTCTCACAAGTTCCCAGG + Intergenic
1103346395 12:120253505-120253527 GGGTCTTCCCACAACTAGCCCGG - Intronic
1104689480 12:130814515-130814537 GGGCCTGCACACTCCTGCCCAGG - Intronic
1112161783 13:96875826-96875848 AGGGCTTCAAACATCTACCTGGG - Intergenic
1113659054 13:112091855-112091877 GGGACTTCACACACATATCCAGG - Intergenic
1113715429 13:112502736-112502758 GGGGTTTCACAGTCTTACCCAGG + Intronic
1115004835 14:28468908-28468930 GGGGCTCCACACTCCTGCCATGG - Intergenic
1120156332 14:81097430-81097452 GGGGCTTCTCAAACCTTCCTGGG + Intronic
1121584854 14:95056318-95056340 GGTGCTGCACACACGCACCCTGG - Intergenic
1122167878 14:99843793-99843815 GGGTCAACACACACCTACCTGGG - Intronic
1129169469 15:73798873-73798895 GGGACCTCACACACAAACCCAGG + Intergenic
1134872942 16:17668110-17668132 AGGGCTTCCCCCACCTCCCCAGG + Intergenic
1136636046 16:31523975-31523997 GGGCCTGCTCTCACCTACCCAGG + Intergenic
1136666338 16:31816346-31816368 GGGCCTGCTCTCACCTACCCAGG + Intergenic
1137670201 16:50274233-50274255 GAGGCCTCCCACACCTACCCAGG - Intronic
1139649102 16:68353220-68353242 GGGGCTGCACACTCCTATCCGGG - Intronic
1139908274 16:70381183-70381205 GGGTCTGCACGCACCTATCCGGG + Exonic
1140633927 16:76888331-76888353 GGGGTTTCAGTCACCTAGCCTGG - Intergenic
1141424405 16:83935848-83935870 AGGGCCTCACCCACCCACCCAGG + Intronic
1141620305 16:85233839-85233861 GGGGCTCCCTACACCTCCCCAGG - Intergenic
1142213172 16:88817948-88817970 GGGGCTGCAGCCACCCACCCGGG - Intronic
1142496092 17:307037-307059 GGGGCCTCCCCCACCTCCCCAGG + Intronic
1144261653 17:13527534-13527556 GGGGCTTCACTCTCCCACCAGGG - Intronic
1144764390 17:17724861-17724883 GTGGCTTCAAACACTTCCCCTGG + Intronic
1147547412 17:41413174-41413196 AGGGCCTCACCCACCTTCCCAGG + Intergenic
1149051246 17:52308126-52308148 GGGGATTCACACCCATGCCCTGG - Intergenic
1152330052 17:79667540-79667562 GAGGCTTGCCACACCGACCCAGG - Intergenic
1155090141 18:22500584-22500606 GGGGTTTCACCCTCCTAGCCAGG - Intergenic
1157880580 18:51317708-51317730 GTGGCTTCTCACGCCTTCCCAGG + Intergenic
1159887798 18:73925712-73925734 GGGGCCTCACACGCCTTCTCAGG - Intergenic
1160629225 18:80233707-80233729 GGGGCCTCACACCCGCACCCAGG + Intronic
1160658714 19:288226-288248 GGGGCCCCACACACCTGCCTTGG + Intronic
1161044995 19:2129961-2129983 GAGGCTTCACACACCAGCCCAGG + Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163826100 19:19525801-19525823 GGGGCTGCACACAGCTGCCAGGG - Intronic
1165872879 19:38985637-38985659 GGGGTTTCACACTGTTACCCAGG - Intergenic
1165939952 19:39410042-39410064 GAGGCTTCGCACACCGACCAGGG + Intergenic
925122741 2:1432093-1432115 GGGGCTCCAGACAGCTGCCCTGG - Intronic
926153915 2:10440096-10440118 AGGGCCTCCCACACCTTCCCTGG + Exonic
927023124 2:19038387-19038409 GGGGCTTCACTCAGCCATCCTGG + Intergenic
932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG + Intergenic
933713113 2:85342272-85342294 TGGGCTTCACACACATTCCGTGG + Exonic
933809351 2:86023003-86023025 GGGGTTTCACCCAGCTACTCAGG - Exonic
935242265 2:101189118-101189140 GGGGCTTTACACGCCAAGCCTGG - Intronic
937958674 2:127438280-127438302 GGGGCTTCACAGAGCAACCAAGG + Intronic
938320385 2:130358740-130358762 GGGTCTGCACTCACCTCCCCAGG + Intronic
940768573 2:157816720-157816742 GAGGCTGCACAGACCAACCCTGG + Intronic
945140957 2:206685696-206685718 GAGCCTTCACCCACCCACCCTGG + Intronic
948776193 2:240290195-240290217 CGGGCCTCACACACCTGGCCTGG + Intergenic
948910688 2:241001024-241001046 GGGGCCTCCCACGCCCACCCAGG + Intronic
948980908 2:241494283-241494305 GGGGCTTCATCCCCCCACCCAGG + Exonic
1168832749 20:855722-855744 AGGGAGTGACACACCTACCCAGG - Intronic
1169940714 20:10934187-10934209 GTGGCTTCACCCACTTCCCCTGG + Intergenic
1170656091 20:18288805-18288827 TGGGCTTCACCCAACTCCCCTGG - Intronic
1175491137 20:59381838-59381860 AGGGCTTCCCACCCCTGCCCAGG + Intergenic
1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG + Intronic
1176077208 20:63254049-63254071 GGGGCCACACACGCCTCCCCAGG + Intronic
1180151641 21:45951267-45951289 GGGCCTGAACACACCTGCCCCGG + Intergenic
1181525911 22:23487036-23487058 GGGGCATCACAGACATTCCCGGG + Intergenic
1182704681 22:32269749-32269771 GGGGATTCACACACCCAGCTGGG - Intergenic
1183282373 22:36938485-36938507 GGGTCTCAACACACCTCCCCAGG - Exonic
1183671117 22:39273468-39273490 GGGACTTCATTCACCTATCCGGG - Intergenic
1184187573 22:42875041-42875063 GGGGTTTCACACTCTTAGCCAGG + Intronic
1184482097 22:44753681-44753703 GGGCCTTCACACTCCTCCCAAGG - Intronic
1184833801 22:47008474-47008496 GGGCCTTCTCACACCTCCCTTGG + Intronic
949857604 3:8476305-8476327 GGGGCTTCAAACACAAGCCCAGG + Intergenic
950500354 3:13359696-13359718 GGGGCCTGACACTCCTTCCCCGG - Intronic
954452390 3:50578824-50578846 GGAGCTGGACACACCTGCCCTGG + Exonic
954704594 3:52472585-52472607 TGGTCTGCACACACCTTCCCTGG + Intronic
957242164 3:77673582-77673604 TGCGCTTCACACACATTCCCTGG + Intergenic
957950371 3:87118156-87118178 GGGGCTGAACACAGTTACCCTGG - Intergenic
959708873 3:109364352-109364374 GGCCCTTCCCACAGCTACCCTGG - Intergenic
961812930 3:129532147-129532169 GGGGCTTCACATTCCCTCCCTGG - Intronic
968598189 4:1496061-1496083 GGGCCTTCCCACGCCTTCCCTGG - Intergenic
968605875 4:1535058-1535080 CGGGTTTCACCCACCTTCCCAGG + Intergenic
968654190 4:1771628-1771650 GGGTCCTCACACACCCAGCCTGG - Intergenic
972162650 4:36244742-36244764 GGGGCATTACCCACCTTCCCGGG + Intergenic
972890709 4:43553392-43553414 GGGGCTGCACACAGCAGCCCTGG - Intergenic
994992566 5:107015831-107015853 GTGGCTTCAGACATCTACTCGGG - Intergenic
998780222 5:145647777-145647799 GGGAATTCTCACCCCTACCCAGG - Intronic
998829363 5:146140612-146140634 GGGGCTTCACCCTCCTGGCCAGG - Intronic
999192622 5:149759817-149759839 GGGGCCACCCACACCCACCCTGG + Intronic
999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG + Intronic
1002572911 5:180154174-180154196 GAGGCTCCAGACACCTGCCCAGG - Intronic
1002633552 5:180596231-180596253 GGAGCTGCACTCACCTGCCCAGG - Intergenic
1011241582 6:85277217-85277239 GGGCCTTCTCTGACCTACCCAGG + Intergenic
1016777734 6:147923615-147923637 GGAGGTTCAGAAACCTACCCTGG + Intergenic
1017763007 6:157585593-157585615 AGGGCTTCACATACCAACCTTGG - Intronic
1018632886 6:165835650-165835672 GGGTCCTCTCACACCAACCCCGG - Intronic
1019005860 6:168795757-168795779 GGGGCTTTCCACACCCACCATGG + Intergenic
1019170495 6:170130845-170130867 AGGGTTCCACACCCCTACCCTGG + Intergenic
1019441763 7:1051015-1051037 GGGGCTGCGCACTCCCACCCAGG - Intronic
1025942900 7:66086813-66086835 GGAGCCTCACCCACCTCCCCAGG - Exonic
1027136131 7:75625264-75625286 GGTGCTCAATACACCTACCCAGG - Intronic
1029688999 7:102168232-102168254 GGGCCTAGACACACCCACCCAGG + Intronic
1033786746 7:144740692-144740714 GGAGCTTCACACTGTTACCCAGG - Intronic
1039814050 8:41076429-41076451 GGAGCTTCACACATCTCCACAGG - Intergenic
1040312141 8:46242247-46242269 GGGGCTTTTCACACACACCCCGG - Intergenic
1045259459 8:100559568-100559590 CGGGCTTCCCACACCTTCCGCGG - Intronic
1048970788 8:139643905-139643927 GGCTCTTCCCACACCTGCCCTGG + Intronic
1049345839 8:142138157-142138179 AGGGCTTCCCACCCCTGCCCCGG + Intergenic
1049466278 8:142752567-142752589 GGGTCTTCACACCTCCACCCTGG - Intergenic
1049593340 8:143472463-143472485 GGGGCTGCACACTCCTCCCTGGG - Intronic
1049655460 8:143795094-143795116 GGGGCTGCAGACCCCGACCCTGG + Exonic
1049706544 8:144045826-144045848 TGGGCTTCCCACAACTGCCCAGG + Intronic
1055581029 9:77706627-77706649 GAGGCTGCACATACTTACCCTGG + Intergenic
1060092443 9:120755139-120755161 GGGGTTTCACCCTCTTACCCAGG + Intronic
1060413521 9:123415302-123415324 GGGGCTGCACTCACCGACCCTGG + Intronic
1060488570 9:124065326-124065348 TGGGCTGCACACACCTGCACAGG + Intergenic
1062605990 9:137349096-137349118 GGGGCTTCACCCACCTGCCTGGG + Exonic
1186308091 X:8286849-8286871 GGGTCTTTAAGCACCTACCCAGG - Intergenic
1187968840 X:24639592-24639614 GGGGCTGGACTCAACTACCCAGG + Intronic
1193403416 X:81072807-81072829 GTGGCTTCATACACCCACTCAGG - Intergenic
1198117477 X:133558173-133558195 GGGGCTTCACATTTCTCCCCTGG - Intronic
1199356872 X:146872867-146872889 GGTGCTTCAAACACCTATCTTGG - Intergenic