ID: 1175823321 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:61923606-61923628 |
| Sequence | CCTCCAGGCGGATCAGCTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 115 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 104} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175823321_1175823334 | 22 | Left | 1175823321 | 20:61923606-61923628 | CCACAAGCTGATCCGCCTGGAGG | 0: 1 1: 0 2: 0 3: 10 4: 104 |
||
| Right | 1175823334 | 20:61923651-61923673 | GCTGACCACGTTTTCAGCTGTGG | 0: 1 1: 0 2: 1 3: 5 4: 113 |
||||
| 1175823321_1175823327 | -7 | Left | 1175823321 | 20:61923606-61923628 | CCACAAGCTGATCCGCCTGGAGG | 0: 1 1: 0 2: 0 3: 10 4: 104 |
||
| Right | 1175823327 | 20:61923622-61923644 | CTGGAGGAGGGCGTGCCCCCCGG | 0: 1 1: 0 2: 1 3: 47 4: 1102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175823321 | Original CRISPR | CCTCCAGGCGGATCAGCTTG TGG (reversed) | Exonic | ||