ID: 1175823321

View in Genome Browser
Species Human (GRCh38)
Location 20:61923606-61923628
Sequence CCTCCAGGCGGATCAGCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175823321_1175823334 22 Left 1175823321 20:61923606-61923628 CCACAAGCTGATCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1175823334 20:61923651-61923673 GCTGACCACGTTTTCAGCTGTGG 0: 1
1: 0
2: 1
3: 5
4: 113
1175823321_1175823327 -7 Left 1175823321 20:61923606-61923628 CCACAAGCTGATCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1175823327 20:61923622-61923644 CTGGAGGAGGGCGTGCCCCCCGG 0: 1
1: 0
2: 1
3: 47
4: 1102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175823321 Original CRISPR CCTCCAGGCGGATCAGCTTG TGG (reversed) Exonic