ID: 1175825607

View in Genome Browser
Species Human (GRCh38)
Location 20:61934879-61934901
Sequence CTTGCAAAGGGGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175825607_1175825613 12 Left 1175825607 20:61934879-61934901 CCTTCCATCTTCCCCTTTGCAAG 0: 1
1: 1
2: 1
3: 36
4: 365
Right 1175825613 20:61934914-61934936 CATCGCTTACAATGTCGCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1175825607_1175825612 11 Left 1175825607 20:61934879-61934901 CCTTCCATCTTCCCCTTTGCAAG 0: 1
1: 1
2: 1
3: 36
4: 365
Right 1175825612 20:61934913-61934935 ACATCGCTTACAATGTCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175825607 Original CRISPR CTTGCAAAGGGGAAGATGGA AGG (reversed) Intronic
900828871 1:4949639-4949661 CATGGAAATGGGAAGCTGGAAGG - Intergenic
901182268 1:7349952-7349974 CTGGCAGAAGGGAAGAGGGATGG + Intronic
901565688 1:10112957-10112979 CTTGCAAGGCGGCAGATGGGGGG - Intronic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
902688800 1:18096781-18096803 ATTGCAAGGGGGCAGCTGGAGGG + Intergenic
903239571 1:21974001-21974023 CCCGCAAGAGGGAAGATGGAGGG - Intergenic
903243379 1:21998928-21998950 CCCGCAAGAGGGAAGATGGAGGG - Intergenic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903673608 1:25051061-25051083 CTAGCAAAGAGGATGAGGGAAGG - Intergenic
903743987 1:25574418-25574440 CTTGCAAGCGGGCAGATGGAAGG + Intergenic
904009462 1:27381511-27381533 CTGGCAATGGGGAGGAGGGATGG + Intronic
904373214 1:30063871-30063893 CTTGCAAAGAATAAGATGGAAGG + Intergenic
905109342 1:35583832-35583854 CTTGAAAATGGCAAGAGGGATGG - Intronic
905616946 1:39408283-39408305 CTTGAGAAGGGGGAGAGGGAAGG + Intronic
905908726 1:41639258-41639280 CTGGCAAAGGGGTGGATGGGAGG + Intronic
906474321 1:46157831-46157853 CTTTCAGAAGGGAAGATAGAAGG - Intronic
909354098 1:74687186-74687208 CTTGCATAGGAGAAGCCGGATGG - Intergenic
909800896 1:79806192-79806214 CTGGAAGAGGGGAATATGGAGGG + Intergenic
910060115 1:83080732-83080754 CTTACATGGTGGAAGATGGAAGG + Intergenic
911048732 1:93651369-93651391 CTGGCAGATGGGAAGCTGGATGG + Intronic
912513231 1:110202227-110202249 CTTGCAATGAGGGAGAGGGAAGG + Intergenic
912626019 1:111204769-111204791 GTTGCAAAGGGAGAGGTGGAGGG - Intronic
912932037 1:113972843-113972865 CTTGCTAAGAGGCAGAAGGAGGG + Intronic
913187609 1:116383660-116383682 CTTTCAGTAGGGAAGATGGAAGG + Intronic
915652454 1:157326042-157326064 CTTCCAATAGGGAAGATGAAGGG + Intergenic
915741036 1:158118499-158118521 CTCGAAGAGGGGAAGATGGGTGG - Intergenic
916281422 1:163055420-163055442 CTTGTAAAGGGAGAGAAGGAAGG + Intergenic
916555451 1:165890737-165890759 CTGGCAGAGAGGGAGATGGAGGG + Intronic
917958998 1:180127773-180127795 TTAGCAAAGGGGAAGATGGCAGG + Intergenic
918209691 1:182339888-182339910 CTTCCAAAGAGGAAGATGTATGG - Intergenic
919491843 1:198213722-198213744 CTTTCAAGGGGAAAGAAGGAAGG - Intronic
922843748 1:228666201-228666223 CTTGGAAAGGCTAAGGTGGATGG - Intergenic
924220833 1:241873792-241873814 GTTGGAAAGGGTAAGAAGGAAGG + Intronic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1064349904 10:14567299-14567321 TTTGCAAAGGGGCAGTGGGAAGG + Intronic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1066073149 10:31841922-31841944 TTTGCAAAGGGTAAGGTAGAGGG + Intronic
1067018506 10:42775335-42775357 CTTTCCAAGAGGAAGAGGGAAGG + Intergenic
1068698949 10:59999869-59999891 TTTGCAAAGTGGAAGAAGGAGGG - Intergenic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1070739561 10:78893792-78893814 CTTGCATATGGGAGGAAGGATGG + Intergenic
1071151614 10:82641973-82641995 CTTGGAAAGGGGGAGGTTGAGGG - Intronic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071465749 10:85938148-85938170 CTTGCCAGGGGGAATCTGGATGG + Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1073116640 10:101095259-101095281 CTTGGAGATGGGAGGATGGAAGG - Intronic
1073499832 10:103926406-103926428 CTTGCAAAGATGAAGAGGGCAGG + Intergenic
1073812964 10:107171379-107171401 CTTGCAAAGATGCAGATTGATGG - Intergenic
1075685735 10:124364126-124364148 CTGGCAAAGGGGTAGAGGGGTGG - Intergenic
1075931488 10:126300397-126300419 TTTGGTAAGGGGAAGAAGGAAGG - Intronic
1076238176 10:128882000-128882022 CTCGCCAATGGGAAGACGGAAGG + Intergenic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1076566124 10:131400666-131400688 AGTGCAAAGGGGAGGGTGGAGGG + Intergenic
1076866316 10:133168047-133168069 GTTCCAAAGTGGAAGAGGGAAGG - Intronic
1077388655 11:2288695-2288717 CTTACAGAGGGGAAGTGGGATGG - Intergenic
1079502586 11:21118284-21118306 TTTACAATGGGGAATATGGATGG + Intronic
1079590893 11:22181295-22181317 CTTCTTAAGGGGAAGATAGAGGG - Intergenic
1080852460 11:36081676-36081698 CTGGCACAGGGGAAGAAGGTTGG - Exonic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1082626397 11:55491954-55491976 CTTGCAAACAGGAAGATGCAGGG - Intergenic
1083051606 11:59782048-59782070 GTTGCATGGGGTAAGATGGAAGG - Intronic
1083055563 11:59815947-59815969 CTTCCAACAGGGAAGATGAAGGG - Intergenic
1084764981 11:71302312-71302334 CTCGCACAGGGGATGCTGGAGGG - Intergenic
1086225338 11:84501481-84501503 CTTGAACCCGGGAAGATGGACGG + Intronic
1086532638 11:87803796-87803818 CGTGAAAAGGAGAAGATGGAAGG + Intergenic
1088095847 11:106100676-106100698 CCTGGAAAGGGAAAGATGAAGGG - Intergenic
1088507614 11:110541769-110541791 CATGGAAATGGGAGGATGGAGGG - Intergenic
1088558408 11:111086829-111086851 CATGCAATGAGGAGGATGGAAGG + Intergenic
1088754605 11:112875592-112875614 CTGGCAGAGGGGAAGATGCCAGG + Intergenic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089226308 11:116925331-116925353 CTTGCAAGAGGGAAGCAGGAGGG + Intronic
1089633541 11:119797879-119797901 CTTCCCAAAGGGAAGATGGCTGG - Intergenic
1089768907 11:120788649-120788671 CCTGCAAAAAGGCAGATGGAGGG - Intronic
1090922778 11:131221583-131221605 CTCGCAAATGGGAGAATGGAAGG + Intergenic
1091105937 11:132919971-132919993 CTTGCCAGGGGCTAGATGGAAGG + Intronic
1091127554 11:133114625-133114647 ATTGGATAGGGGAAAATGGAGGG - Intronic
1091226799 11:133962005-133962027 TTTGGAGAGGGCAAGATGGATGG - Intergenic
1091601592 12:1921259-1921281 CTTGGAAAGGGGTGGATGTAGGG - Intergenic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091849069 12:3680500-3680522 CATGCAAAGGAGGAGAGGGATGG - Intronic
1093823031 12:23645233-23645255 CTTGAAAATGTGCAGATGGAGGG + Intronic
1094080442 12:26528856-26528878 GTTGTAAAGGGGAAGATGAAAGG - Intronic
1094488495 12:30943707-30943729 CTTGGAATGGGGCAGCTGGAAGG - Intronic
1094731354 12:33179867-33179889 TTTGCACAGGGGAAGGGGGAGGG - Intergenic
1095199804 12:39370226-39370248 CTTGCCAAAGAGAAGATTGAAGG - Exonic
1096498460 12:52051769-52051791 CCTGCAAAGTGGAAGCTGTAGGG + Intronic
1097042584 12:56164569-56164591 CTACCAAATGGGATGATGGATGG + Exonic
1098074259 12:66710660-66710682 CTTGCAAAGTGCATGATGGGCGG - Intronic
1098217683 12:68237291-68237313 ATTGCAAAGGGGAAGAAAAAAGG + Intergenic
1099278962 12:80617952-80617974 CCTGTAAAAGGGAAGATGAAAGG - Intronic
1099812000 12:87595086-87595108 ATTGAAGAGGGGAAGAGGGACGG - Intergenic
1100054140 12:90488915-90488937 GTTGCAATGGGAAAGAGGGATGG - Intergenic
1100356223 12:93833258-93833280 TTTGCAGATGGGAAGATAGATGG + Intronic
1101292668 12:103387528-103387550 CTTGCCAAGGGGAAGAGGAGTGG + Intronic
1102215845 12:111160889-111160911 CCTGCCATGGGGAAGATGCAGGG + Intronic
1102259622 12:111436257-111436279 CTTGCAAGGAGCAGGATGGAAGG - Intronic
1102686064 12:114725596-114725618 CTTGCCAAGGGGGAGACAGAGGG + Intergenic
1103277007 12:119720551-119720573 CATGAAAAGGTGAAAATGGAAGG - Exonic
1103888105 12:124217744-124217766 CTTGCAAAGTGGAAAAATGACGG + Intronic
1103970390 12:124667175-124667197 CCTGGAAAGGGGAACATGGAAGG + Intergenic
1103978163 12:124717320-124717342 CTTGCAGAGGTGAAGAAGGTAGG + Intergenic
1107255490 13:38421222-38421244 CTTGAAAAATGGAAGATGAAGGG - Intergenic
1108481868 13:50880997-50881019 CTTGCAGAGTGGAGGATAGATGG + Intergenic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1109330003 13:60917883-60917905 CTTGCATCAGGGAAGAGGGAGGG + Intergenic
1111551812 13:89822337-89822359 CTTGCAAAGAGGAAAATGTGAGG + Intergenic
1111742576 13:92222246-92222268 GTTAAAAAGGGGAAGATGGGAGG + Intronic
1112081077 13:95971308-95971330 AATGCAAAGAGGAAGATGAATGG - Intronic
1112159961 13:96856771-96856793 ATTTCAGAGTGGAAGATGGAGGG - Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1112430312 13:99345343-99345365 ATTGCACAGTGTAAGATGGACGG + Intronic
1112542315 13:100327221-100327243 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1115329765 14:32183904-32183926 CTTGAAAAGAGAGAGATGGATGG + Intergenic
1116808454 14:49516263-49516285 CTTGCTTAGGGGAAGATGAGCGG - Intergenic
1117019930 14:51559715-51559737 CTTGATTAGGGAAAGATGGATGG - Intronic
1117611043 14:57483834-57483856 CATGCAATGGGGAACGTGGAGGG + Intronic
1119473780 14:74915353-74915375 CTTCCATTTGGGAAGATGGAAGG + Intronic
1124668492 15:31615887-31615909 CTGGCACAGGGGCAGATGGGAGG + Intronic
1126070114 15:44858791-44858813 CTTGCAGAGAGGAAAATGGGTGG + Intergenic
1126087919 15:45026302-45026324 CTTGCAGAGAGGAAAATGGGTGG - Intronic
1126222343 15:46228993-46229015 GATGCAAAGGGGAAAATGGAAGG - Intergenic
1127373591 15:58362335-58362357 CTCACATAGGAGAAGATGGAAGG + Intronic
1127528298 15:59816124-59816146 CATGCAAGGGTGGAGATGGAAGG + Intergenic
1128714541 15:69898141-69898163 CTTGCAAAGTGGAAGAGGCTGGG - Intergenic
1128767046 15:70257666-70257688 TTTGAAAAGAGGAAGATGGAAGG - Intergenic
1129087382 15:73109470-73109492 TTTGCAGGGAGGAAGATGGAGGG + Intronic
1129333980 15:74841701-74841723 CTTGTGAAGGGGCAGAGGGAAGG - Intronic
1130229430 15:82085495-82085517 CTTGCAAAGTGGCAGAAGGCTGG + Intergenic
1131037445 15:89232607-89232629 CTTGCAAGGTGGAAGGTGCAAGG - Intergenic
1131115130 15:89790762-89790784 CTTCCAAATGGGAAAAGGGACGG + Intronic
1132367379 15:101267351-101267373 ATTGCAAAGGCGTAGATGCAGGG - Intergenic
1135493990 16:22935701-22935723 CTTGCTCTGGGGAAGATGTATGG - Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1136710520 16:32233517-32233539 GCTGCCAAGGGGCAGATGGATGG + Intergenic
1136757391 16:32695894-32695916 GCTGCCAAGGGGCAGATGGATGG - Intergenic
1136810716 16:33174481-33174503 GCTGCCAAGGGGCAGATGGATGG + Intergenic
1136817192 16:33284561-33284583 GCTGCCAAGGGGCAGATGGATGG + Intronic
1136823756 16:33341092-33341114 GCTGCCAAGGGGCAGATGGATGG + Intergenic
1137504333 16:49039244-49039266 CTTGCAAAGGAGAACAAAGATGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137833010 16:51562317-51562339 CTTGGATATGGGAAGAAGGAGGG + Intergenic
1138741032 16:59310396-59310418 CTTTTAAAGTGGAAAATGGAGGG + Intergenic
1139018792 16:62723204-62723226 ATTTCATAGTGGAAGATGGAAGG + Intergenic
1139180729 16:64745310-64745332 TTTTCAAATAGGAAGATGGAGGG - Intergenic
1139584397 16:67892539-67892561 ACTGAAATGGGGAAGATGGATGG + Intergenic
1140112544 16:72016306-72016328 CTGGCAAAGAGGAAGAGGAAGGG + Intronic
1140946272 16:79770871-79770893 GTTGCAAAGGGAAAGGGGGAGGG - Intergenic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1203059540 16_KI270728v1_random:956243-956265 GCTGCCAAGGGGCAGATGGATGG - Intergenic
1143682613 17:8488607-8488629 CCTGCAAAGAGGATGATGGCTGG + Intronic
1144994838 17:19260370-19260392 CTTCCAAATGTGAAGCTGGAGGG + Intronic
1145268146 17:21390297-21390319 CTTCCAAAGGTGGCGATGGAGGG + Intronic
1145995808 17:29104222-29104244 CTGGCAAATGGGTAGATGGATGG + Intronic
1146641335 17:34543958-34543980 ATTCCAAAGGGGCAAATGGAAGG - Intergenic
1146984668 17:37203834-37203856 CTGGCCAAGGGCAAGAAGGAAGG + Intronic
1147158708 17:38558681-38558703 CATGCAAAGGGGGAGCTGCATGG + Intronic
1147261481 17:39211837-39211859 CTTGCAAAGGAGCAGATGCACGG + Exonic
1147321822 17:39651232-39651254 CTTGCACAGGGGCAGAGGGATGG + Intronic
1148694738 17:49552055-49552077 CCTGCATAGGGGAAGACGGGTGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149420077 17:56502027-56502049 GCTGCAAAAGGGAAGAAGGAGGG + Intronic
1149868089 17:60161681-60161703 GTTACAAAAGGGAAGACGGAGGG - Intronic
1151848056 17:76671781-76671803 CTTGAGGTGGGGAAGATGGAAGG + Intergenic
1152927866 17:83095815-83095837 CTGGCAGAGGAGAAGATGAAGGG - Intergenic
1154333355 18:13447730-13447752 TTCGCAAAGGGAAAGAGGGATGG + Intronic
1154398681 18:14013920-14013942 GTTGCCAAGGGATAGATGGAAGG - Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1156012860 18:32514037-32514059 TTTCCAAAGGGGAAGAAGCAGGG - Intergenic
1156056529 18:33011695-33011717 CTTGCAAAGAGAAAGCAGGAAGG + Intronic
1156661990 18:39357254-39357276 ATGGCAAAGGGGAATATGGGGGG - Intergenic
1156872533 18:41963341-41963363 CTTGCAAAGGTGGTGATCGATGG + Intronic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158768399 18:60484614-60484636 CCTCCATAGGGGATGATGGAGGG - Intergenic
1159397584 18:67883135-67883157 GTTGTAAAGGGCAAAATGGATGG + Intergenic
1161717164 19:5882538-5882560 CTGGCAGATGGGAAGCTGGAAGG - Intronic
1163053026 19:14699272-14699294 CATGCAAATGGTAAGATGCACGG + Exonic
1164714837 19:30383964-30383986 CTGGCAGAGTGGAAGAAGGAAGG - Intronic
1164928691 19:32154152-32154174 CTTGCAGAGGCCAAGGTGGATGG - Intergenic
1166612715 19:44213192-44213214 TTTGCAAAGAGGAGGAAGGAGGG + Exonic
1166614667 19:44232558-44232580 CTTACAAAAGGGAAGAAAGAGGG - Intronic
1166691099 19:44821494-44821516 CTTGCAAGGGGGCGGATGGGGGG - Intergenic
1167291399 19:48627217-48627239 CATGCAAAGGGGAAGAGGATAGG - Intronic
1167500302 19:49842823-49842845 CTTGCAAAGGAGCAGGTGGTAGG + Intergenic
1167785941 19:51636375-51636397 CTTCCAAAGGGGAAAACTGAAGG + Intronic
925523792 2:4777296-4777318 CTAGAAAAGGGAAAAATGGAAGG - Intergenic
925885233 2:8389820-8389842 CTGGCAAAGGAGAGGATGGCTGG + Intergenic
928723360 2:34144917-34144939 ATGGCAAAGGGAAAGATGAATGG - Intergenic
928758148 2:34550225-34550247 AGTGCAAGGGGGAAGAGGGAAGG - Intergenic
928934900 2:36665635-36665657 CCAGCCAATGGGAAGATGGAGGG - Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930712177 2:54559310-54559332 ATAGCAAAGGGGAGGAGGGAGGG + Intronic
931185493 2:59947122-59947144 GCAGGAAAGGGGAAGATGGATGG - Intergenic
931832805 2:66070115-66070137 CTTGCAATGTGGTAGCTGGAGGG + Intergenic
931868471 2:66435279-66435301 CTTGCAAAGAGGGAGAGAGAGGG + Intronic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
933912741 2:86957719-86957741 ATTGTGAAGGTGAAGATGGATGG + Exonic
934010254 2:87812171-87812193 ATTGTGAAGGTGAAGATGGATGG - Exonic
935132913 2:100274746-100274768 ATGGCAAAGGCGAAGATGGGCGG - Exonic
935736195 2:106108414-106108436 CTTGAAGTGGGGGAGATGGAAGG - Intronic
935773818 2:106452891-106452913 ATTGTGAAGGTGAAGATGGATGG - Exonic
935906245 2:107843022-107843044 ATTGTGAAGGTGAAGATGGATGG + Exonic
935992712 2:108735545-108735567 ATTGTGAAGGTGAAGATGGATGG + Exonic
936128028 2:109808187-109808209 ATTGTGAAGGTGAAGATGGATGG + Exonic
936216669 2:110563298-110563320 ATTGTGAAGGTGAAGATGGATGG - Exonic
936425808 2:112417879-112417901 ATTGTGAAGGTGAAGATGGATGG - Exonic
936632477 2:114218497-114218519 CTTGGAGATGTGAAGATGGAGGG + Intergenic
937589889 2:123600166-123600188 CTTACACAGTGGAAGATGCAAGG - Intergenic
939305893 2:140410918-140410940 CTAGCAAAGGGGGAGGTGAAAGG + Intronic
940091755 2:149927682-149927704 GTTGCAAAAGGCAAGATGTAGGG + Intergenic
940130940 2:150381004-150381026 CTGGCTAAGTGGAAGATAGATGG - Intergenic
941413298 2:165187086-165187108 GAAGCAAAGGGGAAGATGTAAGG - Intronic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
944427265 2:199596162-199596184 CTTATAAAGAGGAAGATGGGAGG + Intergenic
945291187 2:208129142-208129164 CTTGCAAATGGGAAGCTGGTTGG - Intronic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
1169310271 20:4532133-4532155 CTTGCAAAGAAGAGGATGGAAGG - Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1170926432 20:20728812-20728834 CTGGCAAAGGGGAGGAAGAATGG - Intergenic
1170957407 20:20993845-20993867 CTTGCAGGAGGGAAGAAGGATGG + Intergenic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1173401304 20:42728409-42728431 CTTGCAAGGGGGGAGAGGTAAGG + Intronic
1174416734 20:50372556-50372578 AATGCCAAGGGGAAGATGGAGGG + Intergenic
1175011179 20:55738326-55738348 CTCGGAAGGGGGAAGATGGAGGG + Intergenic
1175131448 20:56792703-56792725 CTTGCGAAGGGGAGGCAGGAGGG + Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176190888 20:63809113-63809135 CCTGCGAAGGGGAACGTGGAAGG - Intronic
1176367538 21:6043075-6043097 CCTCCAAAGGGGAAGAATGATGG - Intergenic
1177317991 21:19485420-19485442 CTTGCTAAGGGGAAAGGGGAAGG - Intergenic
1178526857 21:33337435-33337457 CTTGGACAGGGGAACATGGTTGG - Intronic
1179755981 21:43495467-43495489 CCTCCAAAGGGGAAGAATGATGG + Intergenic
1180199534 21:46216035-46216057 CCTGCCATGGGGAAGAAGGAGGG - Intronic
1182687079 22:32129448-32129470 CTTCCAAGGGAGAAGATGAAGGG - Intergenic
1183733926 22:39633129-39633151 ATTGGAGAGAGGAAGATGGAAGG - Intronic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184677225 22:46050351-46050373 CCTGTGAAGGGGAAGAAGGATGG - Exonic
1184781287 22:46650951-46650973 CGAGGAGAGGGGAAGATGGAAGG - Intronic
949815461 3:8053366-8053388 CAAGCAAAGGGGAAGGTGCATGG - Intergenic
950293467 3:11807045-11807067 CCTGAGAAGGGGAACATGGAAGG - Intronic
951159181 3:19395736-19395758 CTTGTAAAGGGAAGGATGGTAGG - Intronic
951280625 3:20744738-20744760 ATTGTAAAGGAGAGGATGGAGGG - Intergenic
951422952 3:22509645-22509667 CTTGCAAAAGGGACGATGTGTGG - Intergenic
952073527 3:29668953-29668975 CTGGCAAAGGGGAAAATGATGGG - Intronic
952491455 3:33877977-33877999 CCTGCAGAGGGGATGATGGCTGG + Intergenic
953097588 3:39793865-39793887 CTTGAAAGGGGGAAGAAGAAGGG + Intergenic
953150291 3:40318463-40318485 CTTGCTTAGTGGAGGATGGAGGG - Intergenic
953300285 3:41767663-41767685 CTAGCAAAGATGAAAATGGATGG + Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953332036 3:42061794-42061816 CATGCAGATGGGTAGATGGATGG - Intronic
953417025 3:42728391-42728413 CTTGCACAGGGGAGGGTGGGGGG - Intronic
954425053 3:50438790-50438812 AGGGCAAGGGGGAAGATGGAAGG + Intronic
954885296 3:53868115-53868137 TTTCCAAAGGTAAAGATGGAAGG - Exonic
955237908 3:57156121-57156143 ACTGCAACGGGGAAGAAGGATGG + Intronic
955974763 3:64469242-64469264 CTGGGAAAGAGGAAGATGGCAGG + Intergenic
956973286 3:74551633-74551655 GTTGCCAAGGGTTAGATGGATGG - Intergenic
958927149 3:100171341-100171363 CTTGAAAGGGGGAAGAGGGGGGG - Intronic
959372411 3:105544290-105544312 CTTTGATAGGGGAAGATGTAAGG - Intronic
959847247 3:111048123-111048145 CTTGCTAAGAGGAAGACTGAAGG - Intergenic
960363062 3:116737195-116737217 CTTGAAAAGGAGAAGAGGCAAGG + Intronic
960456971 3:117884228-117884250 CAGGCAATGGGGAAGATTGATGG + Intergenic
960556717 3:119038119-119038141 TTTGCAAAGGGGGAGGGGGAGGG - Intronic
961098098 3:124174988-124175010 CTTCCAAAGGGGCAGCTGGCAGG + Intronic
961816183 3:129551631-129551653 GATGCAAAGGGGCTGATGGAGGG + Intergenic
963527553 3:146433443-146433465 CTTGCACAGTAGAAGAAGGAAGG + Exonic
963967572 3:151389839-151389861 TTTATAAAGGAGAAGATGGAAGG - Intronic
964358208 3:155869925-155869947 GTTGCCAAGGGGTAGGTGGAGGG + Intergenic
964392556 3:156212806-156212828 CATGGAAAGGGCAAGAGGGAAGG + Intronic
966569212 3:181422177-181422199 CTTTTATGGGGGAAGATGGAGGG - Intergenic
966828063 3:183982131-183982153 CTTCCAAAGGGGAGGCAGGAGGG + Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968513268 4:1004468-1004490 ATTGCAAAGGGGGTGATGGGAGG - Exonic
968518091 4:1023253-1023275 CTTTCAAAGGGGACGATGACCGG + Intronic
968623914 4:1618040-1618062 CGTGAAGATGGGAAGATGGAGGG + Intronic
969202948 4:5620195-5620217 CTTGCACAAGGGAAGGTGCAAGG - Intronic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
971504009 4:27347083-27347105 CTGACACAGGGGAAAATGGAAGG - Intergenic
972737041 4:41852707-41852729 GTGGAAAAGGGGAAGATGAATGG + Intergenic
973605593 4:52584198-52584220 CTTCCACAGTGGAAGATGGAAGG - Intergenic
975743046 4:77449256-77449278 ATTACAAAGGGGAAAATGGCAGG - Intergenic
975844197 4:78507732-78507754 TCTGGAAAGGGGATGATGGAAGG - Intronic
978105060 4:104892363-104892385 CAAGCAAAGGGGAAAATGGAAGG + Intergenic
978503955 4:109436728-109436750 CCTTCAAAGGGGATGATGGGTGG - Intronic
978725271 4:111962235-111962257 ATTGAGAAGGGGAAGATGGTGGG - Intergenic
980657679 4:135811391-135811413 CCTGTAAAGGGGATGATTGAAGG - Intergenic
981292975 4:143097907-143097929 CACGCAAAGGGGAAGAGGGCAGG - Intergenic
982806485 4:159771955-159771977 ATGGCACAGGGAAAGATGGAAGG - Intergenic
983914885 4:173281513-173281535 CTTCCAGTGGGGAACATGGATGG - Intronic
983952532 4:173659491-173659513 TTTGCAAATGGGAATATAGAAGG + Intergenic
984173771 4:176391145-176391167 CTGGAAAAGGGCAAGATGCAGGG - Intergenic
984779781 4:183514656-183514678 CTTGCAAAGGGGAACAGAGATGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
986403771 5:7405574-7405596 CTTGCAAAGAGCAAGAGGAAAGG + Intronic
986501130 5:8401032-8401054 CTTGAGCAGGTGAAGATGGATGG + Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
987536816 5:19200241-19200263 GTTGCAGAGGGGAAGAGGGTTGG - Intergenic
993030991 5:82705607-82705629 TTTGCTAAGGGAAAGATAGATGG - Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
997871334 5:137507633-137507655 GTTGCAAAGGGGCAGGTGGAAGG - Intronic
998217994 5:140252063-140252085 CTTACAAATGGGAAAATAGAGGG - Intronic
999254754 5:150204131-150204153 CTTGCAAAGAGGAAGATGGAGGG - Intronic
999265623 5:150265064-150265086 TTTGAGAAGGGGGAGATGGAGGG - Intronic
1000543055 5:162565383-162565405 ATTGCAAAAGGGAAGATGAATGG - Intergenic
1001425122 5:171617818-171617840 CTTGCTCAAGGGGAGATGGAAGG + Intergenic
1003409531 6:5850629-5850651 GGTGCAAACGGGAAGAAGGAAGG + Intergenic
1003700949 6:8464543-8464565 CTCACATGGGGGAAGATGGAAGG - Intergenic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1003968952 6:11280212-11280234 CATGCCAAGGGGAAGATGTATGG + Intronic
1004533201 6:16473850-16473872 ATAGCATAGGAGAAGATGGAAGG - Intronic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1005508978 6:26495127-26495149 CTTGCATATGTGAAGGTGGAGGG - Intergenic
1007334368 6:41141767-41141789 AATGCAAGGGGGAAGATGAAGGG - Intergenic
1007598536 6:43066923-43066945 CTTCCAAAGGGAAGGAGGGAAGG + Intronic
1007697681 6:43744116-43744138 CCTGGAAAGGGGAAGAAGCATGG - Intergenic
1008384867 6:50877314-50877336 CAAGCAAAGAGGAAGAAGGAGGG - Intergenic
1010193675 6:73219064-73219086 CTTGGAAAGGGGAACATTGCTGG - Intronic
1010291183 6:74139968-74139990 GTTGGAAAGGGGAAGAATGATGG - Intergenic
1010379952 6:75212855-75212877 CATGCAAAGAGAAAGATGGCTGG + Intergenic
1011611412 6:89155079-89155101 CTTGCAATAGGGAAGATGACAGG + Intronic
1011713307 6:90077264-90077286 ATGGCAAAGGGCAAGAGGGACGG + Intronic
1011888567 6:92127955-92127977 ATGGCAAAGGGGAAGAGAGAGGG + Intergenic
1012430001 6:99154158-99154180 TTTACAAAGGGGAAGAAGGAAGG - Intergenic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014294953 6:119606692-119606714 CTGACAATGAGGAAGATGGATGG + Intergenic
1017019360 6:150127827-150127849 CTTGCAAAAAGGAAGGTGGAGGG - Intergenic
1018722621 6:166584391-166584413 CTTCCAAATGTGAACATGGAGGG + Intronic
1019609867 7:1930947-1930969 CCTGCAAAGGGTGAGATGGCAGG - Intronic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1021703933 7:23348177-23348199 CTTGCAAAGGGGAAGCAGATTGG - Intronic
1023306888 7:38839930-38839952 AATGCAAAAGGGAAGATGGAAGG + Intronic
1023466180 7:40457638-40457660 CTGGCATAGCTGAAGATGGAAGG + Intronic
1023711294 7:42995796-42995818 AATGAAAAAGGGAAGATGGATGG - Intergenic
1024202951 7:47125127-47125149 CTTGCAGAGAGGAAGGTGGGAGG - Intergenic
1024551530 7:50566400-50566422 CTTGGTAAGGGGAAGAGTGAGGG + Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1025829104 7:65034321-65034343 CTCGCAGAGGGGAATATGGCAGG - Intergenic
1026000750 7:66557854-66557876 CTAGGACAGGGGCAGATGGAGGG + Intergenic
1026102150 7:67392314-67392336 CAAGGAAAAGGGAAGATGGAGGG - Intergenic
1027455039 7:78379704-78379726 ATTGGAAAGAGAAAGATGGATGG - Intronic
1028044869 7:86105910-86105932 TTTGTAGTGGGGAAGATGGAAGG + Intergenic
1029953440 7:104611637-104611659 CTTGGAAATGAGAAGATGAAGGG - Intronic
1030370627 7:108695170-108695192 CTTGTGAAGGGGAAGATCCATGG + Intergenic
1031083208 7:117278117-117278139 CTTGTAGAAGGGAAGGTGGATGG + Exonic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1033948208 7:146749054-146749076 ATTGCAAAGAGAAAGAAGGAAGG - Intronic
1034819348 7:154202564-154202586 CTCGGAAAGGGGCAGAAGGATGG - Intronic
1035398228 7:158548931-158548953 CTTGCCAAGGAGGAGATGGGTGG - Intronic
1037652534 8:20851901-20851923 AGGGGAAAGGGGAAGATGGAGGG + Intergenic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1040433282 8:47364949-47364971 CTTGCTGTGGGGAAGACGGAGGG - Intronic
1040606551 8:48938647-48938669 CTTGCAAAAGGAAGGATTGAAGG + Intergenic
1041285358 8:56255498-56255520 CTAGGAATGGGGAAGAGGGATGG + Intergenic
1042089651 8:65144868-65144890 GTTGAAAAGAGGAAGAAGGAAGG - Intergenic
1042258874 8:66835769-66835791 CTTGCAAAACGGAAACTGGATGG + Exonic
1042818770 8:72907468-72907490 TATGCAAAGAAGAAGATGGATGG + Intronic
1043132144 8:76474574-76474596 CTTGTGAAGGTGAAGATGGCTGG + Intergenic
1043148278 8:76682289-76682311 CTTGAGAAGGGGAAGAGGGGCGG - Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043671468 8:82890400-82890422 CTTAAAAAGAAGAAGATGGAGGG - Intergenic
1045254119 8:100505437-100505459 CTTGCAAAAGGGGAGCTGGCAGG - Intergenic
1045290143 8:100825961-100825983 CATTCAAAGGGGAAGAACGAGGG + Intergenic
1045363486 8:101454290-101454312 AATGCCAAGGGGAAGATAGAAGG - Intergenic
1046795095 8:118362996-118363018 AATGCAAAATGGAAGATGGAGGG + Intronic
1046973416 8:120247683-120247705 CTTTCACCGGGGAAGATGGGGGG - Exonic
1047137748 8:122100609-122100631 CATGGAAAGGGGAAGAGAGAGGG + Intergenic
1047552179 8:125886577-125886599 CTTACAAATGGAAAGAGGGAGGG + Intergenic
1048491537 8:134898179-134898201 CTTGAAATGTGGAAGGTGGAAGG - Intergenic
1048683476 8:136873825-136873847 CTTGCAAAAAAGAAGATGAAAGG + Intergenic
1050173668 9:2848115-2848137 TTTGGGAAGGGGAAGATGTATGG - Intergenic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1050301039 9:4259341-4259363 TATGTAAAGGGGAAGGTGGAAGG - Intronic
1050978371 9:11972730-11972752 CTTGGAAAGAAGGAGATGGATGG - Intergenic
1053260196 9:36656263-36656285 CTGACAAAGTAGAAGATGGAGGG - Intronic
1056007116 9:82284713-82284735 CTTGCAGAGGGGATGATCGGTGG - Intergenic
1056146309 9:83733287-83733309 CTTGCAAAGCTGAAGATTCATGG - Intergenic
1057255089 9:93539833-93539855 CCTGCAAAGGGGCAGCTGGAGGG - Intronic
1057483516 9:95463762-95463784 CTTGGAAAGGGGAGACTGGAGGG + Intronic
1059759218 9:117322580-117322602 CATGCAAATGGGAAGACAGAAGG - Intronic
1059921322 9:119163559-119163581 GTTGCAAAGTGGAAGAAAGATGG - Intronic
1062318240 9:135978482-135978504 GCTGCTGAGGGGAAGATGGAGGG - Intergenic
1062318274 9:135978578-135978600 GCTGCTGAGGGGAAGATGGAGGG - Intergenic
1186222486 X:7364722-7364744 GTTGCCAGGGGGAAGAAGGAGGG + Intergenic
1186428494 X:9484421-9484443 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1186688326 X:11948601-11948623 CTTGGAAAGGGGAAGGGGAAGGG + Intergenic
1186748435 X:12595227-12595249 TTTCCAAAAGTGAAGATGGATGG + Intronic
1188217520 X:27497467-27497489 TTTGCCAAGGGCAAGAAGGATGG - Intergenic
1188981852 X:36733831-36733853 CTTGGAAATGGGTGGATGGATGG - Intergenic
1189681127 X:43517809-43517831 CTTGCAAAGCTGAAGATCCAGGG + Intergenic
1193184887 X:78500748-78500770 CTTGCAAGGGGGAAGATTGGTGG - Intergenic
1193232753 X:79067211-79067233 CTTACAAGGGGGATGATTGATGG + Intergenic
1193716225 X:84937402-84937424 CTTGTTAAAGGGGAGATGGAGGG + Intergenic
1193905293 X:87236758-87236780 CTTGCAGAGGGGCTGATGGGTGG - Intergenic
1194268673 X:91782933-91782955 GTTGCACAGGGCAAGAGGGAGGG + Intronic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195888799 X:109670635-109670657 CGTGCAAAGGGGAAGGGAGAGGG - Intronic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1197981209 X:132219053-132219075 CTAGCAAAGGGAAAGATAGTCGG - Intronic
1198771442 X:140135025-140135047 CTTGAAAAGGAGAGGATGGTGGG + Intergenic
1200585876 Y:5003848-5003870 GTTGCACAGGGCAAGAGGGAGGG + Intronic