ID: 1175826691

View in Genome Browser
Species Human (GRCh38)
Location 20:61940135-61940157
Sequence GGACCCACGGCGCCACGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175826691_1175826698 12 Left 1175826691 20:61940135-61940157 CCAGCTCGTGGCGCCGTGGGTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1175826698 20:61940170-61940192 GTACCTCACAACAGGCCCAGCGG 0: 1
1: 1
2: 0
3: 12
4: 193
1175826691_1175826702 15 Left 1175826691 20:61940135-61940157 CCAGCTCGTGGCGCCGTGGGTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1175826702 20:61940173-61940195 CCTCACAACAGGCCCAGCGGGGG 0: 1
1: 0
2: 0
3: 24
4: 183
1175826691_1175826697 4 Left 1175826691 20:61940135-61940157 CCAGCTCGTGGCGCCGTGGGTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1175826697 20:61940162-61940184 GAGGGACAGTACCTCACAACAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1175826691_1175826699 13 Left 1175826691 20:61940135-61940157 CCAGCTCGTGGCGCCGTGGGTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1175826699 20:61940171-61940193 TACCTCACAACAGGCCCAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175826691_1175826700 14 Left 1175826691 20:61940135-61940157 CCAGCTCGTGGCGCCGTGGGTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1175826700 20:61940172-61940194 ACCTCACAACAGGCCCAGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175826691 Original CRISPR GGACCCACGGCGCCACGAGC TGG (reversed) Exonic
900391110 1:2434348-2434370 GGCCCCACGGCACAAGGAGCTGG - Intronic
901199999 1:7461288-7461310 GGACCCCAGGGGCCACGATCTGG - Intronic
901651240 1:10744337-10744359 AGAGACACGGCACCACGAGCAGG + Intronic
909390303 1:75112526-75112548 GGACCCTCTGAGCCACGTGCGGG + Intergenic
912636190 1:111295910-111295932 GGACCCACTGAGCCAGGTGCGGG - Intronic
912743224 1:112221756-112221778 GGACCCTCGGAGCCACGTGTGGG - Intergenic
914361375 1:146938884-146938906 CGACCTGCGGCGCCAGGAGCGGG + Exonic
914491234 1:148151826-148151848 CGACCTGCGGCGCCAGGAGCGGG - Exonic
915814639 1:158953078-158953100 GGACCCTCGGAGCCAGGTGCAGG - Intronic
916663815 1:166947674-166947696 GGACCCGCGCCGGCCCGAGCGGG - Intronic
917549376 1:176008010-176008032 GGACCCTCGGAGCCAGGTGCGGG + Intronic
919377972 1:196817725-196817747 GGACCCACCGAACCAGGAGCAGG + Intergenic
919387659 1:196941762-196941784 GGACCCGCCGAGCCAGGAGCAGG + Intronic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1063387188 10:5623313-5623335 GGCCACACGGGGGCACGAGCGGG - Intergenic
1064671840 10:17722615-17722637 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1064905325 10:20339638-20339660 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1066595402 10:37044546-37044568 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1067193345 10:44091241-44091263 GGACCCACTGAGCCAGGTGCAGG - Intergenic
1068955836 10:62818107-62818129 GGAGCCACGGCGCCACGCCGTGG + Intronic
1070851847 10:79570713-79570735 GGACCCACTGAGCCATGTGCGGG - Intergenic
1071824971 10:89316421-89316443 GGACCCTCTGAGCCAGGAGCAGG - Intronic
1072059791 10:91798621-91798643 GGAGCCCCGGCCCCGCGAGCAGG - Exonic
1073578036 10:104641393-104641415 GGACCCACGTCGACAAGAGTAGG - Exonic
1074000496 10:109367577-109367599 GGACCCTCTGAGCCAGGAGCAGG - Intergenic
1074017282 10:109546620-109546642 GGACCCACTGAGCCATGTGCAGG - Intergenic
1077509172 11:2946896-2946918 GGATGCAGGGCGCCCCGAGCAGG + Intronic
1077784942 11:5373679-5373701 GGACCCTCGGAGCCATGTGCAGG - Intronic
1082666951 11:55986359-55986381 GGACCCTCGGAGCCAGGTGCGGG - Intergenic
1082951056 11:58816306-58816328 GGACCCTCTGAGCCACGCGCAGG - Intergenic
1082970498 11:59015577-59015599 GGACCCTCTGAGCCACGTGCGGG - Intronic
1087794280 11:102438942-102438964 GGACCCTCTGAGCCACGTGCAGG - Intronic
1091266661 11:134276713-134276735 GGACCCTCGGCGCCTCGGCCTGG + Intronic
1091547999 12:1517303-1517325 GGACCCACTGGGCCACTAGGGGG + Intergenic
1094832513 12:34306845-34306867 GGATCCACGGGGCCATGCGCAGG - Intergenic
1104376580 12:128268577-128268599 GGACCCGCGGCGCCGCGCGAAGG - Intronic
1104573526 12:129945977-129945999 GGACCCACGGAGCAACCAGGCGG - Intergenic
1106516864 13:30464385-30464407 GGGGCCACCGAGCCACGAGCAGG - Intronic
1106554295 13:30796918-30796940 GGAGCCATGGAGCCACAAGCTGG - Intergenic
1107162737 13:37250685-37250707 GGACCCTCCGAGCCACGTGCGGG - Intergenic
1108573378 13:51771183-51771205 GCACCCGCGGCGCCAAGAACTGG - Intronic
1110502348 13:76243204-76243226 GGACCCTCCGAGCCAGGAGCAGG - Intergenic
1110919860 13:81069880-81069902 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1111616199 13:90664322-90664344 GGACCCTCCGAGCCACGTGCGGG - Intergenic
1112233011 13:97607991-97608013 GGACCCTCGGAGCCAGGTGCGGG - Intergenic
1114627933 14:24141480-24141502 GGACCCAGGGCGCCGGGAGCCGG - Exonic
1114982934 14:28188779-28188801 GGACCCTCCGCGCCAGGTGCGGG - Intergenic
1115335405 14:32240393-32240415 GGACCCTCCGAGCCACGTGCGGG + Intergenic
1116524568 14:45888897-45888919 GGACCCTCGGAGCCAGGTGCGGG + Intergenic
1122707427 14:103629736-103629758 GGACGCGCGGCGCCGGGAGCCGG - Intronic
1123782710 15:23644008-23644030 GTGCCCACGGCCCCACCAGCAGG - Exonic
1125358416 15:38840731-38840753 GGACCCTCCGAGCCACGTGCGGG + Intergenic
1130972183 15:88741843-88741865 GGACACGCGGCCCCACGCGCGGG + Intergenic
1131929098 15:97419114-97419136 GGACCCTCCGAGCCACGTGCGGG + Intergenic
1132178329 15:99733092-99733114 GGCTCCACGGCTCCACGGGCGGG + Intronic
1137447777 16:48542331-48542353 GGACCCGCGGTGCCACTAGATGG - Exonic
1137456724 16:48623358-48623380 GGACCCAAGGCGCCCTGAGCCGG - Intergenic
1142737746 17:1912254-1912276 GGTCCCAGGGCGCCAGCAGCTGG - Intergenic
1145291038 17:21546064-21546086 GGACCCACAGCTCCAGCAGCTGG + Intronic
1146586665 17:34088827-34088849 GGACCCTCCGAGCCACGTGCGGG + Intronic
1146739924 17:35274711-35274733 GGACCCTCGGAGCCATGTGCAGG - Intergenic
1147325319 17:39667169-39667191 GAACCCACGGTGGCAGGAGCTGG + Intergenic
1152367653 17:79865922-79865944 GCACCCACGGAGCCAGCAGCTGG - Intergenic
1158458846 18:57630345-57630367 GGAGGCGCGGCGCCACGAACAGG - Intergenic
1158853062 18:61515166-61515188 GGACCCTCGGAGCCAGGTGCGGG + Intronic
1160908817 19:1465491-1465513 GGACGCACGGCACCTCGCGCAGG + Exonic
1161646453 19:5456208-5456230 CGACCCACCGTGCCACGACCTGG + Exonic
1163159780 19:15457689-15457711 GCACGCACGGCGCCTCGGGCCGG - Exonic
1164420526 19:28087990-28088012 GGACCCTCGGAGCCAGGTGCAGG - Intergenic
1164570445 19:29371016-29371038 GGCCCCATGGAGCCACCAGCAGG + Intergenic
926980236 2:18560485-18560507 GGACCCTGGGCCCCACGAACCGG + Exonic
929381419 2:41358811-41358833 GGACCCTCTGAGCCAGGAGCGGG - Intergenic
930025434 2:47026487-47026509 GGACCCAAGGCCCCGCGAGAAGG + Intronic
930208030 2:48607870-48607892 GGACCCAAGGCGCCAGCAGAGGG + Intronic
930803049 2:55462485-55462507 GGACCCACTGAGCCATGCGCGGG - Intergenic
930830880 2:55742023-55742045 GGACCCTCCGAGCCACGTGCGGG + Intergenic
931491698 2:62754774-62754796 GGACCCTCCGAGCCAGGAGCGGG + Intronic
931935847 2:67195604-67195626 GGACCCTCTGAGCCACGTGCAGG + Intergenic
932955930 2:76350967-76350989 GGACCCTCTGAGCCACGTGCGGG + Intergenic
933579029 2:84104131-84104153 GGACCCTCGGAGCCAGGTGCGGG + Intergenic
936142625 2:109953279-109953301 GGACCCACTGAGCCAGGGGCGGG - Intergenic
936179313 2:110251244-110251266 GGACCCACTGAGCCAGGGGCGGG - Intergenic
936202063 2:110418188-110418210 GGACCCACTGAGCCAGGGGCGGG + Intronic
937320661 2:120958831-120958853 GGACCCAAGGCGCCCCCAACTGG + Intronic
941896084 2:170630256-170630278 GGACCCACTGCGCCAAGTGCAGG - Intronic
943710787 2:191092896-191092918 GGACCCACCGAGCCACGTGTGGG - Intronic
945355199 2:208831908-208831930 GGACCCTCTGAGCCACGTGCGGG - Intronic
945788839 2:214278109-214278131 GGACCCACCGAGCCAGGCGCAGG + Intronic
946294479 2:218773045-218773067 GGACCCACAGAGCCAGGCGCAGG + Intergenic
948039542 2:234888727-234888749 GGACCCTCGGAGCCAGGTGCGGG - Intergenic
948235806 2:236389328-236389350 GGACCCTCGGAGCCAGGTGCCGG + Intronic
1169041762 20:2501163-2501185 GGACCCACTGAGCCAGGCGCGGG - Intronic
1175423954 20:58852804-58852826 GGGCCCCTGGCGCCAGGAGCAGG + Exonic
1175826691 20:61940135-61940157 GGACCCACGGCGCCACGAGCTGG - Exonic
1175915315 20:62423307-62423329 AGACCCACAGCCCCAGGAGCTGG - Intronic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176414615 21:6467535-6467557 GGACCCACGGCGAGGGGAGCAGG + Intergenic
1176928446 21:14779225-14779247 GGACCCACTGAGCCACGTGCAGG - Intergenic
1179690113 21:43075857-43075879 GGACCCACGGCGAGGGGAGCAGG + Exonic
1183326983 22:37199612-37199634 GGACCCGCGGCGCCCCCTGCCGG + Intergenic
1184647176 22:45902749-45902771 CGACCCACGGTGCCACGGTCGGG + Intergenic
1185271135 22:49929699-49929721 GGTCCCACAGCGCCACCTGCTGG - Intergenic
952514448 3:34090194-34090216 GGACCCTCTGAGCCACGTGCGGG + Intergenic
954497502 3:50978811-50978833 GGACCCTCCGAGCCACGTGCGGG + Intronic
954500997 3:51013958-51013980 GGACCCACTGAGCCATGCGCAGG + Intronic
955895362 3:63694250-63694272 GGACCCACCGAGCCAGGTGCGGG - Intergenic
957102966 3:75850781-75850803 GGACCCTCCGAGCCACGTGCGGG + Intergenic
959464197 3:106665633-106665655 GGACCCTCGGAGCCAGGTGCAGG - Intergenic
959723075 3:109514018-109514040 GGACCCTCCGAGCCACGTGCGGG + Intergenic
959835825 3:110917104-110917126 GGACCCTCCGAGCCACGTGCGGG + Intergenic
962177883 3:133174033-133174055 GGACCCTCTGAGCCAGGAGCGGG - Intronic
963984446 3:151575518-151575540 GGACCCACTGAGCCAGGTGCAGG + Intergenic
964126738 3:153241427-153241449 GGACCCTCTGAGCCACGTGCGGG + Intergenic
966150383 3:176861631-176861653 GGACCCTCCGAGCCAGGAGCAGG - Intergenic
966494119 3:180560248-180560270 GGACCCACTGAGCCATGTGCGGG - Intergenic
966840639 3:184084159-184084181 GCACCCACAGCTCCACTAGCTGG - Intergenic
973183321 4:47294457-47294479 GGACCCTCCGAGCCACGTGCGGG - Intronic
973347067 4:49068181-49068203 GGACCCTCCGAGCCATGAGCAGG - Intergenic
973835751 4:54807397-54807419 GGACCCACTGAGCCAGGCGCAGG - Intergenic
974470196 4:62309601-62309623 GGACCCTCTGAGCCACGTGCGGG - Intergenic
976529429 4:86135011-86135033 GGACCCTCCGAGCCACGTGCGGG - Intronic
977288661 4:95139721-95139743 GGACCCTCGGAGCCATGCGCGGG + Intronic
977897432 4:102380538-102380560 GGACCCTCTGAGCCACGTGCGGG + Intronic
981655918 4:147112279-147112301 GGACCCACTGAGCCAGGAACGGG - Intergenic
983334533 4:166375057-166375079 GGACCCACTGAGCCAGGTGCAGG + Intergenic
985627125 5:994939-994961 GTACCCACGGAGCCACTGGCAGG - Intergenic
985794765 5:1953759-1953781 GGACCCACTGAGCCAGGTGCAGG - Intergenic
989178746 5:38556273-38556295 GGAGCCGCGGAGCCCCGAGCGGG - Intronic
989345298 5:40423005-40423027 GGACCCACTGAGCCAGGTGCAGG + Intergenic
993266436 5:85732188-85732210 GGACCCACTGAGCCAGGAACGGG - Intergenic
993867586 5:93213483-93213505 GGACCCTCGGAGCCAGGTGCAGG - Intergenic
993917549 5:93761411-93761433 GGACCCTCTGAGCCACGTGCGGG - Intronic
994297992 5:98113791-98113813 GGACCCTCCGAGCCACGCGCGGG - Intergenic
994545634 5:101163178-101163200 GGACCCACTGAGCCAGGAGGGGG - Intergenic
994647948 5:102492741-102492763 GGACCCTCTGAGCCAGGAGCGGG - Intronic
999025821 5:148230939-148230961 GGACCCTCCGAGCCACGTGCAGG - Intergenic
1005263160 6:24083182-24083204 GGACCCTCGGAGCCAGGTGCGGG - Intergenic
1006171327 6:32095101-32095123 GCATCCACGGGGCCAGGAGCCGG + Intronic
1009499184 6:64390099-64390121 GGACCCTCGGAGCCAGGTGCGGG - Intronic
1010381467 6:75230675-75230697 GGAGCCATGGCGCCACTAGAGGG - Intergenic
1011373998 6:86670878-86670900 GGACCCTCGGAGCCAGGTGCGGG + Intergenic
1011711011 6:90054321-90054343 GGACCCTCTGAGCCACGTGCGGG - Intronic
1011909696 6:92421083-92421105 GGACCCACTGAGCCAGGTGCGGG - Intergenic
1012085787 6:94824501-94824523 GGACCCTCTGAGCCACGTGCCGG - Intergenic
1012776250 6:103496831-103496853 GGACCCCCGGAGCCATGTGCTGG + Intergenic
1013117813 6:107115565-107115587 GCACCCACGGCGCGCCGGGCAGG + Intergenic
1014098279 6:117482922-117482944 GGACCCGAGGCGCCAGGGGCGGG + Intronic
1015432508 6:133147746-133147768 GGACCCTCGGCGCCAGGTGCAGG + Intergenic
1016231808 6:141815154-141815176 GGACCCTCGGAGCCAGGTGCCGG - Intergenic
1016436884 6:144046990-144047012 GGACCCGCTGAGCCAGGAGCAGG + Intronic
1019755074 7:2762872-2762894 GCACCAATGGCTCCACGAGCAGG - Intronic
1019917075 7:4140410-4140432 GGACCCCCGGCCCCACGATGAGG + Intronic
1020922156 7:14279207-14279229 GGACCCTCCGAGCCACGTGCGGG - Intronic
1021359067 7:19689354-19689376 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1021373881 7:19883434-19883456 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1021661599 7:22924537-22924559 GGACCCTCGGAGCCATGTGCGGG - Intergenic
1023852545 7:44158467-44158489 GGACCCACAGCTCCACCAGCCGG - Intronic
1024015988 7:45315623-45315645 GGACCCACTGAGCCAAGTGCGGG - Intergenic
1026941331 7:74289581-74289603 GGATCCCCGGCGCCAGGAGGGGG + Exonic
1027819383 7:83024431-83024453 GGACCCTCCGAGCCACGTGCGGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029037006 7:97532900-97532922 GGACCCTCCGAGCCACGTGCGGG - Intergenic
1034432862 7:151049692-151049714 GGACCCCCAGCCCCAGGAGCAGG - Intronic
1039154554 8:34540574-34540596 GGACCCTCTGAGCCACGCGCAGG - Intergenic
1039319608 8:36413906-36413928 GGACCCTCGGAGCCAGGTGCAGG + Intergenic
1040062307 8:43114401-43114423 GGACCCTCCGAGCCACGTGCGGG + Intronic
1040403393 8:47075853-47075875 GGACCCTCTGAGCCAGGAGCGGG - Intergenic
1040439051 8:47422395-47422417 GGACCCTCCGAGCCACGTGCGGG + Intronic
1042698244 8:71581958-71581980 GGACCCTCCGAGCCACGCGCAGG - Intronic
1044007890 8:86960338-86960360 GGACCCTCTGAGCCAGGAGCGGG - Intronic
1044809072 8:96038909-96038931 GGACCCACTGAGCCAGGCGCAGG + Intergenic
1045386014 8:101671365-101671387 GGACCCTCCGAGCCACGTGCGGG - Intergenic
1047247918 8:123160674-123160696 GGACACACCGCGCCACTAGCCGG + Intergenic
1048466397 8:134667962-134667984 GGACCCACGGAGCCATGCGCGGG - Intronic
1049082987 8:140457440-140457462 GGAGCAAGGGCGCCTCGAGCAGG + Intronic
1050374173 9:4953493-4953515 GGACCCTCCGAGCCACGTGCGGG + Intergenic
1050824696 9:9931552-9931574 GGACCCTCCGAGCCACGTGCGGG - Intronic
1051005083 9:12334332-12334354 GGACCCTCCGAGCCACGTGCGGG - Intergenic
1052197217 9:25732479-25732501 GGACCCACTGAGCCAGGCGCAGG - Intergenic
1056440025 9:86611702-86611724 GGACCCTCTGAGCCACGTGCGGG + Intergenic
1058215160 9:102223573-102223595 GGACCCTCGGAGCCAGGTGCAGG + Intergenic
1058367083 9:104221101-104221123 GGACCCTCTGAGCCAGGAGCAGG + Intergenic
1058490652 9:105495291-105495313 GGACCCTCGGAGCCAGGTGCGGG + Intronic
1058904136 9:109467738-109467760 GCACCCACGCCAGCACGAGCAGG - Intronic
1060405371 9:123370413-123370435 AGACCCAGGGGGCCACCAGCTGG - Exonic
1062332731 9:136051633-136051655 GGAGCCACCGCGCCGGGAGCTGG + Intronic
1062358747 9:136177627-136177649 GGACCCAAGGCGCCCGGTGCGGG - Intergenic
1062633746 9:137479011-137479033 TGAACCACGGAGCCACGGGCAGG + Intronic
1185513068 X:677532-677554 GGACCCACGCGGCCAGCAGCCGG + Intergenic
1187116792 X:16360418-16360440 GGACCCTCTGAGCCACGTGCGGG - Intergenic
1188017642 X:25122822-25122844 GGACCCACCGAGCCATGTGCGGG + Intergenic
1192855008 X:74999809-74999831 GGACCCTCCGAGCCAGGAGCAGG + Intergenic
1194441536 X:93940081-93940103 GGACCCTCGGAGCCAGGTGCCGG - Intergenic
1194677855 X:96815320-96815342 GGACCCACCGAGCCAGGCGCGGG + Intronic
1196146715 X:112326480-112326502 GGACCCTCCGAGCCACGTGCGGG - Intergenic
1196171208 X:112590464-112590486 GGACCCTCTGAGCCACGTGCGGG - Intergenic
1198595466 X:138231060-138231082 GGACCCACTGAGCCAGGCGCAGG - Intergenic
1198615661 X:138456185-138456207 GGACCCTCTGAGCCAGGAGCGGG - Intergenic
1198819596 X:140633242-140633264 GGACCCACCGAGCCATGTGCAGG - Intergenic
1198956361 X:142136056-142136078 TGACCCACTGAGACACGAGCTGG + Intergenic
1202066269 Y:20943573-20943595 GGACCCTCCGAGCCAGGAGCAGG + Intergenic
1202072968 Y:21011578-21011600 GGACCCTCGGAGCCAGGTGCGGG + Intergenic
1202077668 Y:21053432-21053454 GGACCCTCGGAGCCAGGTGCGGG + Intergenic
1202298368 Y:23384230-23384252 GGACCCTCGGAGCCAGGTGCGGG + Intergenic
1202572441 Y:26286369-26286391 GGACCCTCGGAGCCAGGTGCGGG - Intergenic