ID: 1175828407

View in Genome Browser
Species Human (GRCh38)
Location 20:61949545-61949567
Sequence CTGGATGGCACCATCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175828407_1175828419 13 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828419 20:61949581-61949603 GTGGAAGGTGAGGGGCAGAAAGG No data
1175828407_1175828410 -9 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828410 20:61949559-61949581 GCCATCCAGGTGTCCTCACATGG No data
1175828407_1175828414 -2 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828414 20:61949566-61949588 AGGTGTCCTCACATGGTGGAAGG No data
1175828407_1175828418 5 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828418 20:61949573-61949595 CTCACATGGTGGAAGGTGAGGGG No data
1175828407_1175828417 4 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG No data
1175828407_1175828415 3 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828415 20:61949571-61949593 TCCTCACATGGTGGAAGGTGAGG No data
1175828407_1175828412 -6 Left 1175828407 20:61949545-61949567 CCCACACAGATGGTGCCATCCAG No data
Right 1175828412 20:61949562-61949584 ATCCAGGTGTCCTCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175828407 Original CRISPR CTGGATGGCACCATCTGTGT GGG (reversed) Intergenic
No off target data available for this crispr