ID: 1175829197

View in Genome Browser
Species Human (GRCh38)
Location 20:61952819-61952841
Sequence ATATGTAAGAGGGAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175829197_1175829205 1 Left 1175829197 20:61952819-61952841 CCCTCCATCTCCCTCTTACATAT No data
Right 1175829205 20:61952843-61952865 GACACTTCCCATTGGATTTCGGG No data
1175829197_1175829204 0 Left 1175829197 20:61952819-61952841 CCCTCCATCTCCCTCTTACATAT No data
Right 1175829204 20:61952842-61952864 GGACACTTCCCATTGGATTTCGG No data
1175829197_1175829203 -7 Left 1175829197 20:61952819-61952841 CCCTCCATCTCCCTCTTACATAT No data
Right 1175829203 20:61952835-61952857 TACATATGGACACTTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175829197 Original CRISPR ATATGTAAGAGGGAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr