ID: 1175831399

View in Genome Browser
Species Human (GRCh38)
Location 20:61966986-61967008
Sequence TGGGTCCACCCCGAGCGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175831389_1175831399 -5 Left 1175831389 20:61966968-61966990 CCACATGACCCACCCCCCTGGGT 0: 1
1: 1
2: 14
3: 373
4: 9280
Right 1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1175831385_1175831399 10 Left 1175831385 20:61966953-61966975 CCAAGACAAGCCAGGCCACATGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1175831382_1175831399 30 Left 1175831382 20:61966933-61966955 CCCTCAGCTTGTGTCAGTGACCA 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1175831386_1175831399 0 Left 1175831386 20:61966963-61966985 CCAGGCCACATGACCCACCCCCC 0: 1
1: 0
2: 2
3: 280
4: 10285
Right 1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1175831383_1175831399 29 Left 1175831383 20:61966934-61966956 CCTCAGCTTGTGTCAGTGACCAA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175831399 Original CRISPR TGGGTCCACCCCGAGCGGGT AGG Intronic
901551358 1:9997841-9997863 TCGGCGCACCCGGAGCGGGTCGG + Intronic
902823125 1:18955758-18955780 TGGGTGCACCCCGACGGCGTGGG - Exonic
904624159 1:31792806-31792828 TGCGTCCACCCTGAGTGGGTGGG - Intronic
914883323 1:151564637-151564659 TGGGTCCCCACCGAGGAGGTGGG + Intronic
1063450280 10:6145843-6145865 TGGGACCCCCCGGTGCGGGTAGG - Intronic
1069704697 10:70451067-70451089 TGGCTCCACCCCAAGAGGCTGGG - Intergenic
1075438212 10:122460584-122460606 TGGGTCCACACTGAGCAGATGGG - Intergenic
1077392175 11:2305195-2305217 TGGGCCCACCCAGGGCTGGTTGG - Intronic
1091628524 12:2140963-2140985 AGGGCCCACCTGGAGCGGGTAGG + Intronic
1092196908 12:6555347-6555369 TGGGTGCACCCGGATGGGGTGGG - Exonic
1106358990 13:29012584-29012606 TGGGTCCAGCCCGGGCGGGGTGG + Intronic
1121279502 14:92688684-92688706 TGGGTCCACCCTGAGTGGCACGG - Exonic
1127390793 15:58503662-58503684 TGGGGCCACCCCGGGCTGGGTGG - Intronic
1127783365 15:62335296-62335318 TGGATCCACCCTGGGCCGGTGGG - Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1139649605 16:68355760-68355782 TGGGTACTCCCACAGCGGGTGGG - Exonic
1141913195 16:87075097-87075119 TGGGTCCGGACCCAGCGGGTGGG + Intergenic
1142672521 17:1493649-1493671 TGGGTCCACCCCGACCCACTGGG - Intergenic
1145018655 17:19414186-19414208 TGGGTCCAGCCCTAGTGGGGAGG - Intronic
1145059701 17:19724839-19724861 AGGGTCCACGGGGAGCGGGTGGG - Intergenic
1146665475 17:34699773-34699795 TGGGGCCATCCCAAGCTGGTGGG - Intergenic
1147135197 17:38430038-38430060 TGGGTCCACCCCAAGGTGGCTGG + Intronic
1148757428 17:49980912-49980934 TGGGTCCAGCCCGAGAGGAGTGG - Intergenic
1152128383 17:78461110-78461132 CGGGCCCCCCCCGAGAGGGTAGG - Intronic
1154160991 18:11981077-11981099 TGGGTCCGCCTCGAGCGGGGAGG + Intronic
1159594484 18:70369887-70369909 TGGGTCCACCCCTAGAGAATTGG - Intergenic
1163608390 19:18288181-18288203 TGGGTCCCCTCCGAGAGGCTGGG - Intergenic
931665911 2:64609453-64609475 TGGGGCGCCCCCGAGCGGGCGGG - Intergenic
1170821603 20:19759078-19759100 TGGGTGGACGCCGAGCTGGTGGG - Intergenic
1172014419 20:31864403-31864425 TGGCTCCATCCCAAGCGGGGAGG + Intronic
1174606835 20:51767734-51767756 CGGGTCCACCCCGGGCGGAGGGG + Intronic
1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG + Intronic
1181374313 22:22443520-22443542 TGCCTCAACCCCGAGCAGGTGGG - Intergenic
1181630515 22:24148771-24148793 GGGGTGCAGCCTGAGCGGGTGGG - Intronic
1183047263 22:35229888-35229910 TGGGTCAAGCCTGAGCGGGAGGG + Intergenic
954612970 3:51955954-51955976 TGCGGCCACCCCGAGCGTGCAGG - Exonic
969715093 4:8864506-8864528 CGGGTGCACCTCGAGCGCGTTGG - Intronic
995738463 5:115328799-115328821 TGGGTCCACCCAGCACGGCTGGG + Intergenic
1001081709 5:168672172-168672194 TGGGTGCACCTGGAGCAGGTGGG + Intronic
1002094668 5:176823850-176823872 TGGCTCCATCTCGAGGGGGTTGG + Intronic
1013353171 6:109324122-109324144 TGGGACCACCACGAGGAGGTAGG + Intergenic
1019013360 6:168861035-168861057 CGGGTCCACTCGGAGCGGGCAGG - Intergenic
1019109948 6:169701900-169701922 TGAGTCCTCCCCTAGCGGGCTGG - Intronic
1039664156 8:39504247-39504269 TGGGTACACCCTTAGCAGGTAGG + Intergenic
1049044234 8:140136822-140136844 TGGGTACAGCCCGAGCGGACAGG + Intronic
1053230183 9:36401177-36401199 TGTTTCCACCCCGAGGGGGAAGG + Intronic
1062577153 9:137214133-137214155 TGGGTCCCTCCCGTGTGGGTGGG + Intronic
1192428396 X:71096662-71096684 TGGCTCCACCTCGGGCGGCTCGG - Exonic