ID: 1175840847

View in Genome Browser
Species Human (GRCh38)
Location 20:62026284-62026306
Sequence TCACGTCCCTGTGTTGCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175840847_1175840848 -8 Left 1175840847 20:62026284-62026306 CCGTGAGCAACACAGGGACGTGA No data
Right 1175840848 20:62026299-62026321 GGACGTGAGTGTGCTGTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175840847 Original CRISPR TCACGTCCCTGTGTTGCTCA CGG (reversed) Intronic