ID: 1175840847 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:62026284-62026306 |
| Sequence | TCACGTCCCTGTGTTGCTCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175840847_1175840848 | -8 | Left | 1175840847 | 20:62026284-62026306 | CCGTGAGCAACACAGGGACGTGA | No data | ||
| Right | 1175840848 | 20:62026299-62026321 | GGACGTGAGTGTGCTGTCGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175840847 | Original CRISPR | TCACGTCCCTGTGTTGCTCA CGG (reversed) | Intronic | ||