ID: 1175844639

View in Genome Browser
Species Human (GRCh38)
Location 20:62051996-62052018
Sequence TTGTGGTTGTGGAGGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175844639_1175844650 29 Left 1175844639 20:62051996-62052018 CCATGTCACCTCCACAACCACAA 0: 1
1: 0
2: 2
3: 32
4: 380
Right 1175844650 20:62052048-62052070 CCCTTCTGCGTCCTGCACCGTGG No data
1175844639_1175844645 -2 Left 1175844639 20:62051996-62052018 CCATGTCACCTCCACAACCACAA 0: 1
1: 0
2: 2
3: 32
4: 380
Right 1175844645 20:62052017-62052039 AAGGAAGAGAGATGACAGGAAGG 0: 1
1: 0
2: 15
3: 159
4: 1614
1175844639_1175844644 -6 Left 1175844639 20:62051996-62052018 CCATGTCACCTCCACAACCACAA 0: 1
1: 0
2: 2
3: 32
4: 380
Right 1175844644 20:62052013-62052035 CCACAAGGAAGAGAGATGACAGG 0: 1
1: 1
2: 0
3: 17
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175844639 Original CRISPR TTGTGGTTGTGGAGGTGACA TGG (reversed) Intronic
900534335 1:3169597-3169619 TCTTTGTTGAGGAGGTGACAGGG - Intronic
901003926 1:6162599-6162621 ATGTGGTCGTGGTGGTGTCAGGG - Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
902447603 1:16476901-16476923 TTGTGGTTGTGCAGCCAACAGGG + Intergenic
902467503 1:16627116-16627138 TTGTGGTTGTGCAGCAGACAGGG + Intergenic
902507078 1:16945613-16945635 TTGTGGTTGTGCAGCAGACAGGG - Intronic
902515620 1:16987983-16988005 GTGTGGTTGGAGAGGTGGCAAGG - Intronic
902894396 1:19468849-19468871 TTGTTGAAGTGGAGGTGAGAGGG - Intronic
902976659 1:20093414-20093436 TTGTGGTTTTAGTGGAGACAGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904031585 1:27536710-27536732 TTGGGGTGTTGGGGGTGACAAGG + Intronic
904517165 1:31065513-31065535 GAGTGGTTGTGGGGGTGAGAAGG - Intronic
904783964 1:32971763-32971785 CTGTGGTATTGGAGGTGCCAAGG - Intergenic
906291474 1:44622340-44622362 TTGGGGTGATGGAGCTGACAGGG - Intronic
908083782 1:60608822-60608844 TTGTGCTTGTGCTGGGGACATGG - Intergenic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
909859145 1:80582763-80582785 TTTTTTTTGTGGGGGTGACATGG - Intergenic
911232811 1:95378563-95378585 ATGGGGCTGTGAAGGTGACAGGG + Intergenic
911380474 1:97107437-97107459 ATGAGGTAGGGGAGGTGACATGG + Intronic
911423160 1:97671760-97671782 CTGTGTTTGTGTGGGTGACAGGG + Intronic
911436622 1:97867931-97867953 TTGTGTGTTTGCAGGTGACATGG + Intronic
911759224 1:101597569-101597591 TTGTGTATGTGCAGGTCACAGGG + Intergenic
912272229 1:108223222-108223244 TTGTGTTCTTGGTGGTGACATGG + Intergenic
913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914018701 1:143844984-143845006 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914657254 1:149753187-149753209 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
915084017 1:153372243-153372265 TGGTGGTAATGGTGGTGACAAGG - Intergenic
915088732 1:153406525-153406547 TTCTGGGTGTGCAGGTGTCAGGG - Intergenic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
916776863 1:167975723-167975745 TTGTTGTTGTTGTGGAGACAGGG + Intronic
917117626 1:171618434-171618456 TTGCTGTTGTGGGGATGACAAGG + Intergenic
918965869 1:191347152-191347174 TTGTGTTTGTGTAGATGACTAGG - Intergenic
919134546 1:193491414-193491436 ATTTGGTGGTGGGGGTGACAAGG - Intergenic
919339688 1:196288515-196288537 TTGTGAATGAGGAGGTGGCATGG + Intronic
919964640 1:202510362-202510384 TTCTGGATAAGGAGGTGACATGG + Intronic
920279727 1:204833757-204833779 TTGGAGTCATGGAGGTGACATGG + Intronic
922808396 1:228402233-228402255 TTGTCTTTGAGGAGGGGACAGGG - Intronic
924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG + Intergenic
1063284438 10:4669754-4669776 TTGTTGTTGTTGTGGAGACAGGG + Intergenic
1063685290 10:8231226-8231248 TTTTGCTGGTGCAGGTGACAGGG + Intergenic
1064664124 10:17632196-17632218 TTGTGTTTGTGACAGTGACAGGG + Intergenic
1065665503 10:28056080-28056102 TTGTGGTTGTTGTTGAGACAGGG + Intronic
1065967220 10:30780066-30780088 TTTTGGATGTAGAGTTGACAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066344156 10:34566121-34566143 TGTTGGTTGTGGTGGTAACAGGG - Intronic
1066467573 10:35667209-35667231 TGGTGGTGGTGGTGGTGATAGGG - Intergenic
1067100124 10:43328972-43328994 TTGTATTTTTGGAGGAGACAGGG + Intergenic
1067291962 10:44950186-44950208 TTCTGGTCTTGGAGGTGGCACGG - Intergenic
1067717133 10:48698350-48698372 TTGTGGCTGTGGCAGTGACAAGG + Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1069277606 10:66612120-66612142 TTGTGATGATGGAGGTGAAAGGG - Intronic
1069438620 10:68407622-68407644 TTGTGTTTGTGAAGGTGAATGGG - Intergenic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070286291 10:75086227-75086249 TTGTGTTTTTGGTGGAGACAGGG + Intergenic
1072143894 10:92616009-92616031 TTGTATTTGTGGTGGAGACAGGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1074104835 10:110381522-110381544 TTGTGTTGGTGGAGGTGATGGGG + Intergenic
1074390088 10:113049862-113049884 TTGTGCTGGTGGAGGAGAGATGG + Intronic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1075068155 10:119303545-119303567 TAGTGGTTGTGGGGGAGTCACGG + Intronic
1075597129 10:123740180-123740202 ATGTAGTTGTGAAGATGACAAGG + Intronic
1075922809 10:126227074-126227096 TAGTGATGGTGGTGGTGACAGGG - Intronic
1076763355 10:132616606-132616628 TTGGGGTTGCAGTGGTGACATGG + Intronic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077106362 11:844173-844195 TGGTGGCTGTGGAGGTGAGGGGG + Intronic
1077131831 11:976864-976886 TGGTGGTTTTGGTGGTGAGAAGG + Intronic
1077176095 11:1191471-1191493 TTGTGCTTGTGGTGGGAACAGGG - Intronic
1077611814 11:3647985-3648007 ATGTGTTTGTGCAGGTCACAGGG - Intronic
1078096710 11:8301862-8301884 TTGTTGTGGAGGAGGTGCCAGGG - Intergenic
1078735698 11:14018549-14018571 TTGGGAATGTGGAGTTGACATGG + Intronic
1078758948 11:14236274-14236296 TTTTGGAAGTGGAGTTGACAGGG + Intronic
1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG + Intergenic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1087741096 11:101888029-101888051 TTGTGGTTGAGGGGGTGGCCTGG - Intergenic
1088686162 11:112286140-112286162 TGCTGCTTGTGGAGGTGACATGG + Intergenic
1088904218 11:114142080-114142102 TTGGGCTTCTGGAGGTGACTTGG + Intronic
1088950891 11:114568757-114568779 TGGTGGTGATGGAGGTGACTAGG - Intergenic
1089952854 11:122546367-122546389 CTGTTCTGGTGGAGGTGACAAGG + Intergenic
1090012075 11:123054106-123054128 TTGTGGTTTTGGTAGAGACAGGG - Intergenic
1091193114 11:133710752-133710774 TGGTGGTGGTGGAGTTGAGAAGG - Intergenic
1091548136 12:1518300-1518322 TGGTGGAGGTGGAGGTGACGGGG - Intergenic
1092771507 12:11901141-11901163 TTGTTGTTGTGGTTGAGACAAGG - Intergenic
1093995006 12:25631402-25631424 TTGTTCTGGTGGAGGTGGCAAGG - Intronic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095049319 12:37542636-37542658 TTATGCTCGTGGAGGTGGCATGG + Intergenic
1095093360 12:38128074-38128096 TCTTGGTTTTTGAGGTGACAAGG - Intergenic
1095370002 12:41455929-41455951 ATGTGGTGGTTGAGGGGACAGGG - Intronic
1097183399 12:57183751-57183773 TGGAGGTGGAGGAGGTGACATGG - Intronic
1097626682 12:62010328-62010350 TTGTATTTTTGGAGGAGACAGGG + Intronic
1098006066 12:65998291-65998313 TGGTGGCTGTGGGGCTGACAAGG - Intergenic
1098745985 12:74237243-74237265 TTGTGGTTCTTGATGTGACAGGG - Intergenic
1099398187 12:82168311-82168333 TGGTGGTGGTGGTGGTGATAAGG - Intergenic
1099979283 12:89580443-89580465 TTGTCATCGTGTAGGTGACAAGG - Intergenic
1100949231 12:99827110-99827132 TTTTTGTTGTGGGGGTGGCAGGG - Intronic
1101115668 12:101529156-101529178 TTGTCGTTGTTGGGGGGACAGGG + Intergenic
1103737305 12:123068789-123068811 TTGGGGTGGTGGAGGTGCCTGGG - Intronic
1104277711 12:127344928-127344950 TGGGGGTTCTGGAGGTGTCAAGG - Intergenic
1105396720 13:20043502-20043524 TGGTGGTGGTGGTGGTGGCAGGG + Intronic
1105830133 13:24156925-24156947 TGTTGGTTGTGAAGGTGGCAGGG - Intronic
1107040290 13:35940750-35940772 TTGCTGTGGTGGAGGTGAGAGGG - Intronic
1107810826 13:44198281-44198303 TTCTGGTTGTCAAGGAGACAGGG - Intergenic
1108120313 13:47178754-47178776 ATGTAGTAGTGGAAGTGACAAGG + Intergenic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1109013110 13:56975249-56975271 TTGTGGCTGTGGAATGGACAAGG + Intergenic
1109207543 13:59498899-59498921 TGGTGGTTGTGGAGGGGATTGGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114618256 14:24079912-24079934 TGGTGGTGGTGGTGGTGAGAGGG + Intergenic
1115783241 14:36794593-36794615 TTGTGTTTTTGGTGGAGACAGGG - Intronic
1116346760 14:43803547-43803569 TTGTTCTGATGGAGGTGACAGGG - Intergenic
1116351627 14:43871080-43871102 TATTGGTAGTGGTGGTGACAGGG - Intergenic
1118285976 14:64473258-64473280 TTGAGGTGGAGGAGGTGGCAGGG - Exonic
1119409876 14:74423874-74423896 TGGTGGTGGTGGTGGTGGCAGGG + Intronic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1120865469 14:89292376-89292398 AAGAGGTTGTGGTGGTGACATGG - Intronic
1120912591 14:89681136-89681158 TGGTGGTTTTGCAGGTGACGTGG - Intergenic
1121016535 14:90552571-90552593 TTGTGGATCTGGAGGTGAAGTGG - Intronic
1122109876 14:99491666-99491688 TTCTGGTGGGGAAGGTGACATGG - Intronic
1122226039 14:100280441-100280463 TTTTGGTAGTGGAGTTGAGAGGG + Exonic
1122606033 14:102948192-102948214 GGGTGGGCGTGGAGGTGACAGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123922901 15:25083060-25083082 ATGTGAATGTGAAGGTGACATGG + Intergenic
1124156254 15:27227316-27227338 TTCTGTTTTTGGAGGAGACAGGG - Intronic
1125249478 15:37683106-37683128 CTGTCTTTGAGGAGGTGACATGG + Intergenic
1126178968 15:45766214-45766236 TTGTGGTCATGGAGGTATCAAGG - Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128004813 15:64228842-64228864 TTGTAGTTGTGGTAGAGACAGGG - Intronic
1129123978 15:73422095-73422117 AAGTGGTGGTGGAGGTGAGAAGG + Intergenic
1129228962 15:74185953-74185975 TTGAGATTCTGGTGGTGACACGG - Intronic
1130356027 15:83131083-83131105 TTGTGGTGGTGGGAGAGACAGGG - Exonic
1131078226 15:89512601-89512623 TTGTGGATTTGGAAGTGTCAGGG + Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132702543 16:1228294-1228316 TTCTGGTTGTGGATGTCACTGGG - Intronic
1132705781 16:1242574-1242596 TTCTGGTTGTGGATGTCACTGGG + Intergenic
1132845424 16:1998969-1998991 TTGTGGTGGTGGTGGTGGCGGGG + Exonic
1133259395 16:4538492-4538514 TTGTGGTGGGGGGGGTGACCGGG - Intronic
1133840232 16:9401535-9401557 TGGTGATGATGGAGGTGACAAGG - Intergenic
1136472334 16:30489415-30489437 TTCTGGTTGTTGAGGTCAGATGG + Intronic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138338454 16:56270999-56271021 TCTGAGTTGTGGAGGTGACAAGG - Intronic
1140252928 16:73310257-73310279 TGGTGGTGGTGGTGGTGAAATGG + Intergenic
1140836807 16:78802074-78802096 TTGTCATTGTGAAAGTGACAAGG + Intronic
1141495346 16:84405911-84405933 TTGTTGTTGTTGTGGAGACAAGG - Intronic
1141842225 16:86580283-86580305 TTGAAGTTGTGGAGGTGCCGGGG + Exonic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1143639051 17:8185039-8185061 TTGTATTTTTGGTGGTGACAGGG - Intergenic
1143685773 17:8514516-8514538 GTGGGGCTGAGGAGGTGACAGGG - Intronic
1145087492 17:19954778-19954800 TTGTGGTTGGCCAGGTGCCATGG - Intronic
1146675247 17:34768845-34768867 GTGTGGTGGTGCAGGTGAGAGGG - Intergenic
1146715827 17:35086311-35086333 TTGTGTTTTTGGTGGAGACAGGG - Intronic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1146921462 17:36715420-36715442 TTCTGTGTGTGGAGGTGGCAAGG + Intergenic
1147023576 17:37560264-37560286 TTATGGTTCTGGAGATTACAAGG - Intronic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148446550 17:47741333-47741355 TTGTAGTGGTGGTGGTGACGGGG + Intronic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1151689226 17:75670950-75670972 TCTGGGTAGTGGAGGTGACATGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151990742 17:77572454-77572476 TTTTGGGTGTGGAGCTGACCAGG - Intergenic
1153572081 18:6483453-6483475 TTGTATTTTTGGAGGAGACAGGG + Intergenic
1153763743 18:8355546-8355568 ATTTGGGTGTGGAAGTGACAAGG + Intronic
1154450596 18:14473036-14473058 TTCTGGTTTTGGAGGGGCCAAGG - Intergenic
1155298322 18:24405975-24405997 TCGTCTGTGTGGAGGTGACATGG + Intergenic
1156038075 18:32788606-32788628 TTGTGATTCAGGAGGTGCCAAGG - Intergenic
1156378237 18:36533496-36533518 TTGTGGTGCTGTAGGTGGCATGG + Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1156650964 18:39226991-39227013 TTGTGGTTGTGGGAGGGACCTGG + Intergenic
1157124119 18:44938671-44938693 TTGTGGCTGGGGTGGAGACACGG + Intronic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1158631470 18:59118821-59118843 TTGAGGGTGTGGGGGTGGCAGGG - Intergenic
1159362968 18:67429266-67429288 TTGTTGTTGTGGGGGTGGTAAGG + Intergenic
1159679109 18:71325482-71325504 TTGTGATTATGAAGGTGACGTGG + Intergenic
1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG + Intergenic
1161488093 19:4546504-4546526 TTGGGGTTGTGTAAGTGACTTGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162385709 19:10359393-10359415 ATGTGGCTGGGGAGGTGTCAGGG + Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163203722 19:15787259-15787281 TGGTGGTGGTGGTGGTGTCAGGG + Intergenic
1164203971 19:23042462-23042484 TTGTGTTTTTAGAGGAGACAGGG - Intergenic
1164830167 19:31314139-31314161 TTCTGGTTGTCTAGGGGACAAGG - Intronic
1165353565 19:35290752-35290774 TGGTGGTGGTCGGGGTGACAAGG - Intergenic
1165737815 19:38188190-38188212 TGGTGGTGGTGGTGGTGACAGGG + Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166815778 19:45544620-45544642 TTGTGTTTTTGGTGGAGACAAGG - Intronic
1166822408 19:45588577-45588599 TGGTGGTTGTGGATTTAACAAGG - Intronic
1168050298 19:53824767-53824789 TTGTGGTTTTAGAAGAGACAGGG + Intergenic
1168339390 19:55614702-55614724 TGGTGCTGGTGGAGGTGACTGGG - Exonic
925095023 2:1191420-1191442 TATTGGTTTTGGAGGAGACAAGG + Intronic
927208881 2:20626744-20626766 TTGTGGTGCTGGAGGTGAGGTGG + Intronic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
928933790 2:36652934-36652956 TTGTTGGTGTGGATGTGAGACGG + Intergenic
929456617 2:42070724-42070746 TTGTGTTTTTGGTAGTGACAGGG - Intergenic
930022522 2:47009900-47009922 TTTTGGTGGTGGGGGGGACAGGG + Intronic
930122206 2:47769422-47769444 TTGGGGCTGTTGAGGAGACAGGG + Intronic
931392465 2:61855466-61855488 TGGTGGTGGTGGTGGTGAGACGG - Intergenic
933409828 2:81910720-81910742 TTGTGATTGCGGAGGCGACTGGG + Intergenic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
934279243 2:91597140-91597162 TTGTGTTTGTGGTAGAGACAGGG + Intergenic
934897809 2:98133660-98133682 TTTTGCTTGTGGAATTGACAAGG + Intronic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG + Intergenic
936364282 2:111837910-111837932 TTGTAGTTTTGGTGGAGACAGGG - Intronic
936831590 2:116654176-116654198 TTGTGGTGGTGGTGGCCACAGGG + Intergenic
938100231 2:128493349-128493371 TGGTGGCTGTGAAGGTTACATGG - Intergenic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
939849949 2:147292459-147292481 TTTGGGGTGTGGAGGTGGCAGGG - Intergenic
939917545 2:148065947-148065969 TTCGGGTTGAGGAGGAGACAAGG + Intronic
940105088 2:150090399-150090421 CTGTGGTTGTGGGAGTGAAAAGG - Intergenic
940156937 2:150667141-150667163 TTGTTCTAGTGGAGGTGGCAGGG - Intergenic
941373166 2:164692909-164692931 TTGTGTTTCTGGAAGTCACATGG + Intronic
942861018 2:180612205-180612227 ATGTGCTTCTGGAGGAGACAGGG + Intergenic
944153677 2:196589442-196589464 TTGAGATTGTGCAGGTGACCTGG - Intronic
944303251 2:198149100-198149122 TTCTGGGAGTGGAGGTGGCAAGG + Intronic
944418014 2:199498108-199498130 TTGTGTGTGTGCATGTGACAGGG + Intergenic
945307851 2:208276051-208276073 GTGGGGTTGGGGAAGTGACAGGG + Intronic
945653606 2:212595960-212595982 TTGGGGTTGTGGTGGTGTTAGGG - Intergenic
946664771 2:222037073-222037095 GTGTGGTAGTGGTGGTGAAAAGG - Intergenic
947395379 2:229681549-229681571 TTTTGGTGGTGTGGGTGACAAGG - Intronic
947871005 2:233438006-233438028 TTGTGAATGTGGAGGTCAGATGG + Intronic
948047396 2:234954309-234954331 TTGTTGTTGTGGGGGTGGCATGG - Intronic
948238478 2:236408571-236408593 ATGTGGGTGTGGCAGTGACATGG + Intronic
1168745568 20:236878-236900 TTTTGGTTGGGGAGGGGACAGGG - Intergenic
1169717638 20:8638333-8638355 TTGAGATTGTAGAGGTGACAGGG + Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171543846 20:25986136-25986158 TTATGCTCGTGGAGGTGGCACGG + Intergenic
1171951011 20:31422203-31422225 TTCTGGTTGTCAAGGTCACAGGG - Intergenic
1172489797 20:35326857-35326879 TTGTGTCTGTGCAGTTGACATGG - Intronic
1172890305 20:38259803-38259825 GTGTGGTGGTGGTGGTGGCAGGG - Intronic
1173160647 20:40649696-40649718 TGGTTGTTGGGGAGATGACATGG + Intergenic
1173679773 20:44869844-44869866 TTGTGGTTTTTGTGGAGACAGGG - Intergenic
1174451802 20:50625242-50625264 TTGTAGTTTTGGTGGAGACAGGG + Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176445599 21:6817346-6817368 TTCTGGTTTTGGAGGGGCCAAGG + Intergenic
1176823766 21:13682379-13682401 TTCTGGTTTTGGAGGGGCCAAGG + Intergenic
1179188787 21:39106337-39106359 CTGTGGTTGTGCAGCTCACATGG + Intergenic
1179228570 21:39479203-39479225 TGGTGGTGGTGGAGGTGGTAAGG + Intronic
1179630101 21:42672441-42672463 TGGTGGTTGTGGTTGTGGCATGG + Intronic
1180004824 21:45015500-45015522 TGGGGGCTGTGGGGGTGACAAGG - Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1182109028 22:27709927-27709949 TTGTGGTTGTGGAAGAGCAAAGG - Intergenic
1183139227 22:35920535-35920557 TTTTGGTTGAGAAGGGGACATGG - Intronic
1183194735 22:36345573-36345595 GTGTGTCTGTGGGGGTGACATGG - Intronic
1184267818 22:43359143-43359165 TGCAGGTTGTGGAGGTGCCATGG + Intergenic
949353204 3:3147253-3147275 TAGAGGTTTTGAAGGTGACAGGG + Intronic
950212697 3:11135761-11135783 TTGTGGGTGGGGTGGAGACAGGG - Intergenic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
951576784 3:24122637-24122659 TTATGGTTGTGGAGGTGGGGTGG - Exonic
952072347 3:29653131-29653153 TTGTGGTGGTGGTGGCGCCATGG + Intronic
952988794 3:38812859-38812881 TTGTGGTTTTGGTAGAGACAGGG - Intergenic
953215367 3:40913250-40913272 TTTTTGCTGTGGAGGTAACAAGG + Intergenic
953306951 3:41840546-41840568 TTGTATTTTTGGAGGAGACAGGG + Intronic
953409447 3:42681905-42681927 TTGTGGTGGTGGTGGTTTCACGG + Intergenic
953574225 3:44100024-44100046 TTATGGTTGTGTAGGTAACAGGG + Intergenic
953921764 3:46956807-46956829 GGGTGGGTGTGGTGGTGACAGGG - Intronic
954929232 3:54266486-54266508 TTATGGTTGTGGAGAACACAGGG + Intronic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
955584303 3:60459871-60459893 TTGGGGTTGGGGAGGTGAGCAGG + Intronic
955916043 3:63909391-63909413 ATGTGTGTGTGGAGATGACAAGG - Intronic
958098992 3:88984580-88984602 TTGTTCTTGTGGAGGTAGCAGGG - Intergenic
958928888 3:100188040-100188062 TTCTGTTTGTGGAGGGGCCATGG - Intronic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
959997329 3:112693730-112693752 TTGTGCTGGTGGAGGTGGCAGGG - Intergenic
960712397 3:120544547-120544569 TTGTTCTAGTGGAGGTGGCAGGG + Intergenic
961346673 3:126267783-126267805 TTGTGGCTGTGGCCGGGACAGGG + Intergenic
961512046 3:127409203-127409225 TGGCAGTGGTGGAGGTGACAGGG - Intergenic
961531652 3:127543846-127543868 TTTTGGAGGTGGAGGTGGCAGGG + Intergenic
964296459 3:155239586-155239608 TGGTGGTAGTGGTGGTGGCATGG + Intergenic
964925497 3:161951627-161951649 TTGTGGTTGAGCAGGAGGCAGGG + Intergenic
965262175 3:166500945-166500967 ATGTGGATGTGCAGGTCACAGGG + Intergenic
966779046 3:183567820-183567842 TTGTAATTCTGGAGGTGAGATGG - Intergenic
967451112 3:189624307-189624329 TTATGGGGGTGGGGGTGACAGGG - Intergenic
969280897 4:6170254-6170276 TGGTGGTGGTGGTGGTGAGAAGG - Intronic
969280917 4:6170341-6170363 TGGTGGTGGTGGTGGTGAGAAGG - Intronic
969529794 4:7724308-7724330 TGGTGGTGGTGGTGGTGATAGGG + Intronic
971371456 4:26022698-26022720 TTGGGGTTGTAGGGGGGACAGGG + Intergenic
971446833 4:26759544-26759566 TTGATGTGGTGGTGGTGACATGG - Intergenic
973227495 4:47802490-47802512 TGGTGGTTGTGGTGGCCACAGGG + Intronic
975167142 4:71189087-71189109 TTGTAGGAGTGGGGGTGACAAGG + Intronic
975956383 4:79845015-79845037 TTGAGGTTGTGGGGGTGGGAAGG + Intergenic
976561064 4:86501864-86501886 TTGTGGTTTAGTAGGTTACATGG + Intronic
976689702 4:87855794-87855816 TGGTGGTGGTGGTGGTGACGGGG - Intergenic
977675776 4:99745213-99745235 GTGTGGTTGTGTGGGTGTCAAGG - Intergenic
978135328 4:105250852-105250874 TTGTGTTTTTGGTGGAGACAGGG + Intronic
979749386 4:124258682-124258704 TTGTGGTTGTGGATGGGGCTGGG + Intergenic
979852860 4:125594482-125594504 TTGTGGTTGTGCCGGACACATGG + Intergenic
979923161 4:126525963-126525985 TTGTGGTAATGCAGGTGATATGG - Intergenic
980916106 4:139034575-139034597 TTGTGGTGGTGGTGGTGAAAGGG + Intronic
981298062 4:143156037-143156059 TTGTGGTGGTGGTGGGCACAGGG - Intergenic
984442308 4:179787816-179787838 TTTTGGTGGTAGAGCTGACAGGG - Intergenic
985081713 4:186272185-186272207 TTGCGGTTTTGGTGGTGGCAGGG - Intronic
985200153 4:187476280-187476302 TTGTGTGTGTGGTGGTGGCAGGG - Intergenic
985396070 4:189545607-189545629 TTGTAGAGGTGGAGGTGGCAGGG + Intergenic
986231220 5:5866350-5866372 TTGTTGTTGTTGTGGAGACAAGG + Intergenic
986756370 5:10840099-10840121 TTGTGGTGGTGGTGGCTACAGGG + Intergenic
987214864 5:15724419-15724441 TTGTGGTGGCGGTGGTTACAGGG - Intronic
989033941 5:37150067-37150089 TTGGGGAGGTGGAGGTGACTTGG - Intronic
989554620 5:42778869-42778891 TTTTGGTTTTAGAGGTTACAGGG - Intronic
990029158 5:51235177-51235199 TTCTGTTTGTGGTGATGACAGGG + Intergenic
991612950 5:68467357-68467379 TTGTGTTTCTGGTGGTGGCAAGG + Intergenic
993308317 5:86296768-86296790 TTGTGTTCTTGGTGGTGACATGG - Intergenic
993536416 5:89092240-89092262 TAGTGTAAGTGGAGGTGACAAGG - Intergenic
993653296 5:90548221-90548243 TTGAGGTTTGGGAGGAGACAAGG - Intronic
994429304 5:99636166-99636188 TTGTGGATTTGGAGGTGAAGAGG + Intergenic
995955370 5:117770191-117770213 TTGTTCTGGTGGAGGTGGCAGGG - Intergenic
996363657 5:122677392-122677414 TTGTGTTTTTGGTGGAGACAGGG + Intergenic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997843787 5:137267131-137267153 TTGTGTTTTGGGAGGTGAAAAGG - Intronic
999744062 5:154578240-154578262 TTGTGTTTGTGTTGGTGAAAAGG - Intergenic
1000944340 5:167401936-167401958 TGTTGGTTGGGGAGGTGACATGG - Intronic
1002192030 5:177483414-177483436 TTGTGGCACTGGAGGTGAAAGGG + Exonic
1003786261 6:9490400-9490422 TTATGGTTGTGGCGTTAACAAGG - Intergenic
1004880515 6:20002822-20002844 TCATGGTGGTGGAGGTGAAAGGG - Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1005948329 6:30611791-30611813 TTGTATTTGTGGAGGTTCCAGGG - Intronic
1006613751 6:35311292-35311314 TGGTGGCTGTGGAGATGCCAGGG + Intronic
1006808299 6:36803225-36803247 CCGTGGTAGTCGAGGTGACAAGG - Intronic
1007317328 6:40999965-40999987 TTGGGGTGGTGGAGGTGGGATGG - Intergenic
1007674582 6:43582532-43582554 TGGTGGTGGTGGTGGTGACAGGG + Intronic
1008042758 6:46819202-46819224 GTGGGTTTGTGGAGGTGAGAAGG + Intronic
1009392648 6:63163521-63163543 TTGTATTTCTGGAGGAGACAGGG + Intergenic
1009779754 6:68255354-68255376 TTGCTCTGGTGGAGGTGACAGGG + Intergenic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1011149382 6:84253318-84253340 TTGTATTTTTGGAGGAGACAGGG + Intergenic
1012240047 6:96860908-96860930 ATGAGGTTTTGGAGGGGACAGGG + Intergenic
1012999149 6:106004610-106004632 TTTTGCTTGTGGAGGTGTAATGG + Intergenic
1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG + Intergenic
1015630553 6:135228089-135228111 TTCAGGTTTTGGAGGTCACATGG - Intergenic
1015873907 6:137803393-137803415 TTCTGGATTTGGAGGTGATATGG + Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016251670 6:142049775-142049797 TTGTAGTGGTGGTGGTCACAGGG + Intergenic
1017025875 6:150180027-150180049 TTGTGGTTTTGGTAGAGACAGGG - Intronic
1017047393 6:150360047-150360069 TGGTGTTGGTGGAAGTGACATGG - Intergenic
1017285298 6:152667879-152667901 TTGTGCATGTGGTGGTGCCAGGG + Intergenic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1019650211 7:2152780-2152802 TTATGGATGTGGAAGGGACAGGG + Intronic
1020386289 7:7606598-7606620 TTATAGTTGTGAAGGTGACAGGG - Intronic
1020809423 7:12833376-12833398 ATGAGGTTTTGGAGGTGCCAGGG - Intergenic
1022448655 7:30493309-30493331 TGGTGTTGGTGGAGGTCACATGG - Intergenic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024695482 7:51852408-51852430 TTGTGCTGGTGGTGGTGATATGG + Intergenic
1025284364 7:57650239-57650261 TTATGCACGTGGAGGTGACATGG - Intergenic
1025295221 7:57771215-57771237 TTGTGCTCGTGGAGGTGGCACGG + Intergenic
1025923733 7:65939336-65939358 TGGTGGTCGTGGAGGTGATTTGG + Intronic
1026082033 7:67230483-67230505 TTGTGTTTGAGGAGGGTACAAGG - Intronic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1026695033 7:72583506-72583528 TTGTGTTTGAGGAGGGTACAAGG + Intronic
1026807868 7:73438998-73439020 TTGTCTCTGGGGAGGTGACATGG - Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1028935930 7:96464063-96464085 TTTTGGATGCGGAGGTGAAAGGG - Intergenic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1030264264 7:107602483-107602505 TTGAGGGTGTTAAGGTGACAAGG + Intronic
1030751006 7:113232686-113232708 TTGTGGTTGTGGGTGGGTCAGGG + Intergenic
1030968502 7:116024140-116024162 TAGTAGTTGTAGAGGTAACATGG - Intronic
1032729414 7:134623311-134623333 TTGGGTTTGTGGATGTGTCATGG - Intergenic
1033510674 7:142057354-142057376 TAGTGGTGGTGATGGTGACAAGG + Intronic
1035035449 7:155891420-155891442 TGGTGGTTGTGGTGGTGAGGTGG + Intergenic
1035126600 7:156612262-156612284 TTTTGGATGTCAAGGTGACAGGG - Intergenic
1035983623 8:4401596-4401618 TTGTGGTGACCGAGGTGACAGGG - Intronic
1037556726 8:20032187-20032209 TGGTGGTTATGAGGGTGACATGG - Intergenic
1040899264 8:52402105-52402127 TTGTGGCAGTGGTGGTGGCATGG + Intronic
1042590913 8:70397968-70397990 TTTTGGTTGGGGAGGTGGGAGGG - Intronic
1046046569 8:108972473-108972495 TGGTGGTGGTGGTGGTGTCAGGG + Intergenic
1046305982 8:112367610-112367632 TTGTGGTTGTGTAGATGAAATGG - Intronic
1047131042 8:122019721-122019743 TTGAGGTTGTGTAGGTTACTTGG - Intergenic
1049030257 8:140030919-140030941 TGGTGGTGGTGGTGGTTACATGG + Intronic
1049247432 8:141570302-141570324 TTGTGGAGGGAGAGGTGACATGG + Intergenic
1049433940 8:142577623-142577645 TTGTGGGAGCCGAGGTGACAAGG + Intergenic
1049684910 8:143935473-143935495 TTCTGGGTGTGGGGGTGGCAGGG - Intronic
1051609826 9:18950346-18950368 TGGTGGTGGTGGTGGTGAAAGGG - Intronic
1052258960 9:26492128-26492150 TTGTATTTTTGGAGGAGACAGGG + Intergenic
1052763919 9:32620836-32620858 TGGTGGTTGTGAAGGGCACATGG - Intergenic
1053143653 9:35697611-35697633 TTGGGGTTGGGGAGGGGACAGGG + Exonic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053247870 9:36550002-36550024 TTGTATTTATGGAGGAGACAGGG + Intergenic
1055454094 9:76456966-76456988 TTTTGTTTGTGTATGTGACAGGG - Intronic
1056715950 9:89028192-89028214 TTGTGTGTGTGGAGGTGATGTGG - Intronic
1057802736 9:98199896-98199918 TAGTGGTGGTGGAAGTGGCAAGG + Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059923954 9:119187387-119187409 TTGTGGCAGTGGTGGTGGCAAGG - Intronic
1061962733 9:133996621-133996643 ATGTGGGTGGGGAGGTGACGAGG + Intergenic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1062315045 9:135962997-135963019 TGGTGACTGTGGAGGGGACAGGG + Intergenic
1062437433 9:136552768-136552790 TTGTGGTGGTGCAGCAGACATGG + Intergenic
1062672037 9:137716559-137716581 TGGTGGTGGTGGTGGTGCCATGG + Intronic
1203523596 Un_GL000213v1:67179-67201 TTCTGGTTTTGGAGGGGCCAAGG - Intergenic
1186142741 X:6593986-6594008 TTTTGGTGGAGGAGGTGACAGGG - Intergenic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1188457834 X:30387571-30387593 TAGTGTTGGTGGGGGTGACAAGG - Intergenic
1188827489 X:34853740-34853762 TTGTGTTTTTGGTGGAGACAGGG + Intergenic
1190073342 X:47296906-47296928 TAGTGGTTGTCAAGGAGACAGGG - Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1194112544 X:89853363-89853385 TTGTGTTCTTGCAGGTGACACGG - Intergenic
1195129903 X:101841384-101841406 TGGTGGTGGTGGTGGTGACAGGG + Intronic
1195176321 X:102318400-102318422 TGGTGGTGGTGGTGGTGACAGGG - Intronic
1195182543 X:102368693-102368715 TGGTGGTGGTGGTGGTGACAGGG + Intronic
1195202225 X:102563145-102563167 TGGTGGTGGTAGTGGTGACAGGG - Intergenic
1197518962 X:127473430-127473452 CTGTTCTGGTGGAGGTGACAGGG - Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1198595242 X:138228990-138229012 TTGTGTGTGTGGAGGTGAAGAGG - Intergenic
1199106005 X:143869197-143869219 TTGTGGTTGTGGTGGTGATAAGG - Intergenic
1200465196 Y:3508175-3508197 TTGTGTTCTTGCAGGTGACACGG - Intergenic
1201624112 Y:15995058-15995080 TTTTGGTAGGGGAGGTAACAGGG - Intergenic
1202300271 Y:23406200-23406222 TTCTGGATACGGAGGTGACATGG + Intergenic
1202570540 Y:26264398-26264420 TTCTGGATACGGAGGTGACATGG - Intergenic