ID: 1175847000

View in Genome Browser
Species Human (GRCh38)
Location 20:62064788-62064810
Sequence CGGCTGCGGCGCCGGCGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 0, 2: 15, 3: 228, 4: 932}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175847000_1175847008 -7 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847008 20:62064804-62064826 GCAGCCGCCGCGCCGGGCCCGGG 0: 1
1: 0
2: 4
3: 112
4: 1212
1175847000_1175847010 -3 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847010 20:62064808-62064830 CCGCCGCGCCGGGCCCGGGTTGG 0: 1
1: 0
2: 5
3: 52
4: 456
1175847000_1175847026 30 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847026 20:62064841-62064863 CCGCGGGGCCCCCGGCGGCCGGG 0: 1
1: 0
2: 7
3: 63
4: 540
1175847000_1175847015 13 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847015 20:62064824-62064846 GGGTTGGCCGCTGACCCCCGCGG 0: 1
1: 0
2: 2
3: 5
4: 86
1175847000_1175847017 15 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847017 20:62064826-62064848 GTTGGCCGCTGACCCCCGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1175847000_1175847016 14 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847016 20:62064825-62064847 GGTTGGCCGCTGACCCCCGCGGG 0: 1
1: 0
2: 1
3: 5
4: 82
1175847000_1175847007 -8 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG 0: 1
1: 1
2: 13
3: 82
4: 753
1175847000_1175847019 22 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847019 20:62064833-62064855 GCTGACCCCCGCGGGGCCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 265
1175847000_1175847020 25 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847020 20:62064836-62064858 GACCCCCGCGGGGCCCCCGGCGG 0: 1
1: 0
2: 0
3: 25
4: 237
1175847000_1175847024 29 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847024 20:62064840-62064862 CCCGCGGGGCCCCCGGCGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175847000 Original CRISPR CGGCTGCGGCGCCGGCGCCG GGG (reversed) Exonic