ID: 1175847000

View in Genome Browser
Species Human (GRCh38)
Location 20:62064788-62064810
Sequence CGGCTGCGGCGCCGGCGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 0, 2: 15, 3: 228, 4: 932}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175847000_1175847016 14 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847016 20:62064825-62064847 GGTTGGCCGCTGACCCCCGCGGG 0: 1
1: 0
2: 1
3: 5
4: 82
1175847000_1175847008 -7 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847008 20:62064804-62064826 GCAGCCGCCGCGCCGGGCCCGGG 0: 1
1: 0
2: 4
3: 112
4: 1212
1175847000_1175847017 15 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847017 20:62064826-62064848 GTTGGCCGCTGACCCCCGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1175847000_1175847026 30 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847026 20:62064841-62064863 CCGCGGGGCCCCCGGCGGCCGGG 0: 1
1: 0
2: 7
3: 63
4: 540
1175847000_1175847010 -3 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847010 20:62064808-62064830 CCGCCGCGCCGGGCCCGGGTTGG 0: 1
1: 0
2: 5
3: 52
4: 456
1175847000_1175847019 22 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847019 20:62064833-62064855 GCTGACCCCCGCGGGGCCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 265
1175847000_1175847024 29 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847024 20:62064840-62064862 CCCGCGGGGCCCCCGGCGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 397
1175847000_1175847007 -8 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG 0: 1
1: 1
2: 13
3: 82
4: 753
1175847000_1175847020 25 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847020 20:62064836-62064858 GACCCCCGCGGGGCCCCCGGCGG 0: 1
1: 0
2: 0
3: 25
4: 237
1175847000_1175847015 13 Left 1175847000 20:62064788-62064810 CCCCGGCGCCGGCGCCGCAGCCG 0: 1
1: 0
2: 15
3: 228
4: 932
Right 1175847015 20:62064824-62064846 GGGTTGGCCGCTGACCCCCGCGG 0: 1
1: 0
2: 2
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175847000 Original CRISPR CGGCTGCGGCGCCGGCGCCG GGG (reversed) Exonic
900171994 1:1273798-1273820 AGGCGGCGGCGGCGGCGCTGCGG - Exonic
900201251 1:1407600-1407622 CGGGTGCGGCGCGGGCGGGGAGG + Intergenic
900249293 1:1658913-1658935 CGGCAGCGGCGGCGGCGTAGGGG - Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900349814 1:2228939-2228961 GGGCACCGGCGCCGGCACCGCGG - Exonic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901057616 1:6455989-6456011 CGGCTGCGGCGCAGGGGCCAGGG - Intronic
901057618 1:6455995-6456017 CGGCGGCGGCTGCGGCGCAGGGG - Intronic
901332813 1:8423879-8423901 CGGGGGCGGGGCCGGGGCCGGGG - Intronic
901443399 1:9292947-9292969 AGGCGCCGGCGCCGGGGCCGGGG + Exonic
901443401 1:9292953-9292975 CGGCGCCGGGGCCGGGGCCGCGG + Exonic
901483177 1:9539851-9539873 GGGCTACGGCGCCGGCGCTCGGG + Intronic
901641316 1:10694517-10694539 CGGCCGCGGCGCCGCCTCCTCGG + Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902476745 1:16692489-16692511 CGGCTGCGGCACAGGGGCCAGGG + Intergenic
902823236 1:18956230-18956252 CGGGGGCGGCGGCGGCGGCGGGG - Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903044146 1:20553237-20553259 CGGCTGCACCGACGACGCCGTGG + Exonic
903132728 1:21290226-21290248 CGGCGGCGGCGCCAGGGTCGGGG - Intronic
903233877 1:21937357-21937379 CGGGGGCGGGGCCGGCGCTGCGG - Intergenic
903476016 1:23619639-23619661 CGGTGGCGGCGTCGGCGCGGCGG + Intronic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
903652731 1:24931273-24931295 CGGCTGCGCCGCAGGGACCGCGG + Intronic
903750176 1:25616685-25616707 CGGCTGCGGCGCGGCGGCGGCGG + Intergenic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903907290 1:26696160-26696182 CAGCTGAGCCGCCGGCGCCTCGG + Exonic
903935168 1:26890364-26890386 CGGCTGCGCCGCCCGCCCCTCGG - Intergenic
903950675 1:26994303-26994325 CGGCCGCGGCGGCCGCGGCGCGG - Exonic
904037926 1:27568698-27568720 CGGCCGCGGCGCGGGTGCCCGGG + Intronic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904479216 1:30783577-30783599 GGGCTGCGGCGGCTGAGCCGTGG - Intergenic
904500118 1:30908520-30908542 CGGCGCCGGGGCCGGGGCCGCGG - Exonic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904500123 1:30908529-30908551 CGGCCCCGGCGCCGGCCCCGTGG + Exonic
904500125 1:30908532-30908554 CGCCCACGGGGCCGGCGCCGGGG - Exonic
904641954 1:31937944-31937966 CGGCCCCCGCGCCGGCGCCGGGG - Intronic
904753945 1:32757884-32757906 AGCCTGCGGCCCCGGCCCCGGGG + Intronic
904782930 1:32964386-32964408 CGGCGGCGGCGGCGGAGCCTGGG - Exonic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
904847331 1:33430453-33430475 CGGCTGGGGAGCGGGCGCCCCGG + Intronic
904940765 1:34164061-34164083 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137091 1:35808248-35808270 CGGCGGCGGCGCCCGGCCCGGGG - Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905212775 1:36385857-36385879 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
905223407 1:36464291-36464313 CGGCCGCGGCGCGGGCCCCGCGG - Exonic
905390882 1:37634716-37634738 CGGGTGGGGCGCTGGCCCCGAGG - Exonic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906102625 1:43272860-43272882 AGGCTGTGGCGCGGGCGGCGTGG + Exonic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
906492454 1:46279019-46279041 CGGCTGGAGCGCTGGGGCCGTGG - Exonic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
906919419 1:50048192-50048214 GGGGTGCGGGGCCTGCGCCGAGG - Intronic
906960926 1:50419117-50419139 CGGCGGCGGCGGCGTCGACGCGG + Exonic
907160949 1:52368578-52368600 AGGCAGCGGCGCGGGCCCCGGGG - Intergenic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907689179 1:56645328-56645350 CGGCGGCGGCGGCGGCTACGCGG + Exonic
908129140 1:61057306-61057328 CGGCTGCGGCAGCGGAGGCGCGG + Intronic
908401219 1:63774378-63774400 CGGCGGCGGCGGCGGCTCCCAGG - Exonic
908474015 1:64470834-64470856 CGGCTTCGGCCCCGGCGCCCAGG - Exonic
908511175 1:64850973-64850995 CGTCTGCTGAGCCGGGGCCGTGG + Intronic
909001429 1:70221714-70221736 CGGCGGAGGCGGCGGCACCGAGG + Exonic
910200150 1:84690559-84690581 GGCCTGCGGCGCCGGCGCGCGGG - Intronic
910676499 1:89821378-89821400 GGGCCGCGGCGCCTGCGCCAGGG - Intronic
912915639 1:113812057-113812079 CGGCTGCGACGCCGCCGGTGAGG + Exonic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913979925 1:143498741-143498763 AGCCTGGGGCGCCGGCGCCTAGG - Intergenic
914074274 1:144324225-144324247 AGCCTGGGGCGCCGGCGCCTAGG - Intergenic
914104902 1:144642221-144642243 AGCCTGGGGCGCCGGCGCCTAGG + Intergenic
914902359 1:151717485-151717507 AGGCCGCGGAGGCGGCGCCGCGG + Intronic
914902361 1:151717488-151717510 CGCCCGCGGCGCCGCCTCCGCGG - Intronic
914911427 1:151790500-151790522 CGGCTGAAGCGCCGCCGGCGGGG - Intronic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
915463196 1:156081750-156081772 CGGCGGCGGGGCCGGCTGCGGGG + Exonic
915902358 1:159855923-159855945 CGGCTACGGCAACGGCGGCGGGG - Exonic
916651692 1:166839671-166839693 CGGCAGAGGCGGGGGCGCCGAGG + Intronic
916890255 1:169106612-169106634 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917869594 1:179229627-179229649 CGGCGGCGGCGGCGGCGTTGGGG - Intronic
918064263 1:181089090-181089112 CTGCTGCGGTGGCGGCGCCGGGG - Exonic
919678516 1:200410101-200410123 AAGCTGCGGCGCAGGCGCCCTGG - Intergenic
919712133 1:200739107-200739129 CGGCAGCGGCGACGGCGGCAGGG + Intergenic
919820545 1:201469265-201469287 CCGCTGCGGCCCCGCCCCCGGGG - Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
920528505 1:206685321-206685343 CGGCGGCGGCGGCTGCGCCGGGG - Exonic
921039535 1:211416660-211416682 AGGCAGCAGCGGCGGCGCCGGGG + Intergenic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
922287546 1:224183250-224183272 CGGCGGCGGCGGCGGCTCCCCGG - Exonic
922819065 1:228471425-228471447 CGGCTCCGGTGCCGCCTCCGTGG + Intergenic
923119606 1:230978439-230978461 CGGCTGCGGCGCGCGATCCGCGG - Intronic
923171497 1:231421628-231421650 CGGCTGCAGTGCCGCCGCCCAGG - Exonic
923506253 1:234609045-234609067 CGGCTGCGGCGTCGGCGGCTGGG + Exonic
923572513 1:235128921-235128943 CGGCTCCTGCGCCTGCGCAGTGG + Exonic
924436683 1:244048905-244048927 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
924732439 1:246724359-246724381 TGCCTGAGGCGCAGGCGCCGTGG + Exonic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
924816701 1:247448215-247448237 CGGCGGCGGCGACGGCGGCGAGG + Intronic
1063443023 10:6088961-6088983 CGGCCTCTGCGCCTGCGCCGAGG - Intergenic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064230824 10:13528595-13528617 CGGCAGCGGCAGCGGCGGCGCGG + Intronic
1064230925 10:13528889-13528911 CGGCGGCGGCGGCGGAGGCGGGG + Intronic
1065099553 10:22320713-22320735 CGGCCCAGGCTCCGGCGCCGCGG - Intronic
1065100373 10:22325586-22325608 CGGGGGCGGGGCCGGCGCGGGGG - Intronic
1065140533 10:22714656-22714678 CGGCTGCGGCGCCGCGGGCGGGG + Intergenic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464801 10:35641984-35642006 CGGCGGCGGCGGCGGCGGCTTGG - Exonic
1067071808 10:43138165-43138187 CGGCTGCCACGCAGGCCCCGCGG + Intergenic
1067972715 10:50991307-50991329 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1068204177 10:53827434-53827456 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1069403642 10:68075388-68075410 CGGCGCAGGCGCCGGTGCCGGGG - Intergenic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1070877389 10:79826386-79826408 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1070954301 10:80454342-80454364 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1071573764 10:86711629-86711651 CGGCTGCGGCCGCGGCGCTCCGG - Intronic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072189135 10:93066351-93066373 CGCCTGCCGCGGCGGCGCCCAGG + Intronic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072719499 10:97771929-97771951 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1073122655 10:101131892-101131914 CGGCAGCAGCGGCGGTGCCGGGG + Exonic
1073412176 10:103351136-103351158 AGGCTGCCGCGCCTGCGCAGTGG - Intergenic
1074121735 10:110498358-110498380 CGGCGGCGGCGTCGCGGCCGTGG + Exonic
1074503355 10:114045005-114045027 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
1074814510 10:117134343-117134365 CTGCAGCGGCGCCCGCGCCCAGG + Exonic
1075144652 10:119872763-119872785 CGGCTGCGGTGGGGCCGCCGAGG + Intronic
1075334490 10:121598458-121598480 CGGGGGCGGCGGCGGCGGCGCGG - Intronic
1075645516 10:124093496-124093518 CCTCTGCGGCTCCGGCTCCGCGG + Exonic
1075697479 10:124447611-124447633 CGGCGGCGGCGGCGGCTCGGGGG - Exonic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1075802008 10:125159900-125159922 CGGCGGCGGCGGCGGCGTCTCGG - Intronic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076722097 10:132397182-132397204 CGGCGGCGGCGGCGGGGCGGGGG + Exonic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1076890704 10:133281834-133281856 GCCCTGCGGCGCCGGCTCCGGGG - Intronic
1076985994 11:236401-236423 GGGCTGGGGCGCCGGGGGCGGGG - Exonic
1077053120 11:576600-576622 CGGCGGCCGCGCCGGCCCTGGGG + Intronic
1077253839 11:1572029-1572051 CGACGGCGGCGACGGCGACGCGG - Intergenic
1077459239 11:2700475-2700497 CTGCAGCGGCGCCGGCGGAGGGG - Intronic
1077514243 11:2992155-2992177 CGGGTCCGGCGCGGGCGCGGCGG - Intronic
1077916068 11:6612156-6612178 CGGCTCCGGCGCGGACCCCGAGG - Exonic
1077922968 11:6655473-6655495 CGGCAGCGGCGGCGGAGCCGGGG - Intronic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078334088 11:10450603-10450625 GGGCTGCGGCGCGGGCCCCGCGG + Intronic
1078474926 11:11622005-11622027 CGGCAGCGGCAGCGGCGGCGGGG + Exonic
1078498257 11:11841995-11842017 CGGCGGCGGCGGCGGAGCCCTGG + Exonic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080503768 11:32893157-32893179 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1081863618 11:46347831-46347853 CGGCGGCGGGGCAGGCACCGAGG + Intronic
1081938136 11:46918593-46918615 GGGCTGCGGCGCGGGGGGCGGGG - Exonic
1083168388 11:60906274-60906296 CCGCTGCGGCGCCCGGGCCGGGG - Intronic
1083171096 11:60924507-60924529 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1083329612 11:61891458-61891480 CGGCGGCGGAGGCGGCGCCCGGG - Exonic
1083334898 11:61916825-61916847 AGGCTGCGGGGCCGGGGCGGGGG + Intronic
1083477424 11:62923227-62923249 CGGCTGCGGCTTGGGCGGCGCGG + Intergenic
1083571365 11:63763731-63763753 CGGCTGCGGGGCGGGGGCGGAGG + Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083753701 11:64778090-64778112 CGGCTGCGGCGGCGGGTACGAGG + Exonic
1083766461 11:64843754-64843776 GGGCTGTGGCGCCGGGGCCGGGG - Intronic
1083796833 11:65021765-65021787 GGGCTGCAGCGCCGTCACCGGGG + Exonic
1083885784 11:65572867-65572889 CGTTGGCGGCGCCGGCGGCGTGG - Exonic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1084146146 11:67266409-67266431 CGGAGGCGGCGGCGGCTCCGGGG + Exonic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084284167 11:68120947-68120969 CGGCTGCGGCGGCGGGGGCTGGG + Exonic
1084973031 11:72781697-72781719 CGGCGGCGGCGCTGGCACCCCGG - Intronic
1085044013 11:73343108-73343130 CCGCTGGGGCGGGGGCGCCGGGG - Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1086064657 11:82732898-82732920 CGACTACGGCGCCGGCACGGAGG - Exonic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087172819 11:95067608-95067630 CGGCTGCGGTGTCGCCGCCTGGG - Exonic
1088480965 11:110296350-110296372 CGGCCGTGGCGCCGCCGCCAGGG - Intronic
1088653455 11:111977575-111977597 CGGCGGCGGCGGCGGCGTCTCGG - Intronic
1089543674 11:119206305-119206327 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238208 11:125164816-125164838 AGGCGGCGGCGGCGGCGCGGCGG + Intronic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090817787 11:130314447-130314469 CGGCGGCGGCGGCGGCCCGGGGG + Exonic
1091550283 12:1530969-1530991 CGGCGGCGGGGCCGTCCCCGGGG - Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091558577 12:1594153-1594175 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1091582273 12:1797116-1797138 CGGCTGCGGCCTCGGCGGGGTGG + Intronic
1092253532 12:6914546-6914568 CGGCTGCGGCTCCCGGGCGGCGG - Intronic
1092335416 12:7628724-7628746 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335432 12:7628766-7628788 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092743058 12:11649042-11649064 CGTCTGCGGCGCGGCCGCCCCGG + Intergenic
1092861837 12:12725273-12725295 CGGCCGCGGCCCCGGAGCCTCGG + Intergenic
1094041116 12:26122632-26122654 CGGCAGCGGCGGCGGCCCGGGGG - Exonic
1094041157 12:26122773-26122795 CGGCTACGGCGGCGAAGCCGAGG - Exonic
1095349143 12:41188777-41188799 CGGCTGCGGAGCCGGCGGGCAGG - Exonic
1096099026 12:48957591-48957613 CGGCTGCAGCACCGGCGGCCGGG + Intergenic
1096101233 12:48971607-48971629 CGGCGGCCGCGGCGGCGCTGGGG - Exonic
1096241333 12:49961806-49961828 CGGGCGCGGGGCCGGCGCGGGGG - Intergenic
1096786851 12:54021760-54021782 CGGCTGCGGCGCCGTGGCAGAGG - Intronic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1096983787 12:55743630-55743652 CTGCTGCAGCGGCGGCGCCTTGG - Exonic
1098105963 12:67069314-67069336 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1098550375 12:71755144-71755166 CGGCGGCGGCGGCGGGGCGGCGG + Exonic
1098893218 12:76030797-76030819 CGGCTGCGGCTGCGGCTGCGAGG + Exonic
1100391733 12:94150073-94150095 CGGCGGCGGCGGCGGCTCCCCGG - Intronic
1100830938 12:98516095-98516117 CGGCGGCGGCCCCAGAGCCGAGG - Exonic
1100830939 12:98516098-98516120 CGGCTCTGGGGCCGCCGCCGCGG + Exonic
1101592900 12:106139199-106139221 CGGCGGCGGCGGCGGCGGCCAGG + Exonic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102197199 12:111034077-111034099 CGGCGGCGGCCCCGGGGCTGGGG + Exonic
1102197409 12:111034854-111034876 CGGCGGCGGCGGCGGCCCCCGGG - Intronic
1102289263 12:111685711-111685733 CGGCTTCGGCTTCAGCGCCGCGG - Exonic
1102371015 12:112382318-112382340 CGGCGGCGGCGGCAGGGCCGGGG - Intronic
1102371018 12:112382324-112382346 CGGCGGCGGCGGCGGCGGCAGGG - Intronic
1102853952 12:116277494-116277516 AGGCGGCGGCGGCGGCTCCGGGG - Intergenic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1103120039 12:118372668-118372690 CGGCGGCGGCGCCGGGCCCGGGG - Exonic
1103407599 12:120686969-120686991 CGACTGCTGGGCCGGCGCCTGGG + Exonic
1103410841 12:120710500-120710522 CGGCCGCGGCGTCGGCGGCTGGG + Exonic
1103623582 12:122203512-122203534 CGGGTGTGGCGCCGGCGTCCTGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103764720 12:123271857-123271879 CGGCCGCCCCGCCGGCTCCGCGG - Exonic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1103828728 12:123762217-123762239 CGCCGACGGCGCCGGCGCTGGGG - Intergenic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104939032 12:132386311-132386333 CGGCTGCGGCTCCGAGGCCGGGG - Intergenic
1104977781 12:132559984-132560006 CGGGCGCGGCGCGGGCCCCGAGG - Intronic
1105378114 13:19863360-19863382 CGGCGACGGCGGCCGCGCCGCGG + Intronic
1105389142 13:19959005-19959027 CGGCGACGGCGGCCGCGCCGCGG - Intronic
1105927051 13:25018171-25018193 CGGTTGCTGCGCAGGTGCCGCGG + Intergenic
1106087649 13:26557790-26557812 CGGTCCCGCCGCCGGCGCCGGGG - Exonic
1106241999 13:27920263-27920285 CGGGTGCGGCGGCGGCGGCGGGG - Exonic
1106269460 13:28139020-28139042 CGGCTGCGGCTCCGGTCCCCGGG - Exonic
1106665487 13:31846869-31846891 CAACTACGGCGGCGGCGCCGGGG + Intergenic
1107851413 13:44576560-44576582 TGGCGGCGGCGGCGGCCCCGGGG - Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110573012 13:77026777-77026799 CCGCTGCGACGGCGGAGCCGGGG - Intronic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1112091798 13:96090812-96090834 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1112290825 13:98143124-98143146 CGGGTCCGGCGCGGGCGCAGCGG + Intronic
1112504971 13:99970092-99970114 CGGCGGCGGCGGCGCGGCCGGGG + Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1113200736 13:107866164-107866186 CGGCGGCGGCGGCGGCGGCAAGG - Exonic
1113350174 13:109521888-109521910 CGGCCGCGGAGCCCACGCCGGGG - Intergenic
1113493996 13:110713864-110713886 AGGCGGCGGGGCTGGCGCCGGGG - Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG + Exonic
1113655930 13:112067772-112067794 CGGCGGCGGCGGGGGCGCCAAGG + Exonic
1113656964 13:112073245-112073267 AGGCTGCGGGGACGGGGCCGAGG - Intergenic
1114219574 14:20684451-20684473 CTGCTGCGGCGCCAGCTCCAAGG + Exonic
1114473926 14:22981450-22981472 CGGCTACGGGGACTGCGCCGTGG - Exonic
1114483252 14:23048057-23048079 CGGCGGCGCCCCCGGCCCCGCGG - Exonic
1114490050 14:23094891-23094913 CGGATACTGCGCCTGCGCCGCGG + Exonic
1115235794 14:31207673-31207695 CGACGGCGGCGGCGGCGCGGCGG + Intronic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115754638 14:36519156-36519178 AGGCGGCGGTGACGGCGCCGTGG + Exonic
1115761311 14:36581057-36581079 CGGCGGCGGCGGCGGTGGCGAGG - Exonic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1115906691 14:38209476-38209498 CGTCCGCAGCGCCGGCCCCGGGG - Exonic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1117176685 14:53153026-53153048 AGGCGGCGGCGGCGGCGCCTGGG - Exonic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1117920793 14:60723771-60723793 CGGCGGCGGCGGCGGCGTGGTGG + Exonic
1118186544 14:63543136-63543158 CGGCGGCGGCGGCGACGACGTGG + Exonic
1118339102 14:64879833-64879855 TGGCGGCGGCGGCGGCGCAGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1118607599 14:67515085-67515107 CCGGTGCGGGGCCGGGGCCGTGG + Exonic
1118610135 14:67533328-67533350 CGGCTGCGGCGGCGGCCCGAGGG + Exonic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1120788022 14:88554719-88554741 CGGCTGCGGCGGCCGCGCGGCGG - Exonic
1121074973 14:91060398-91060420 TGGCAGCAGCGGCGGCGCCGCGG - Exonic
1121108522 14:91296389-91296411 GGGCTGCAGCGCAGGCCCCGTGG - Intronic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1121828894 14:97033282-97033304 CTGCTGCGGCCCCGGGGCGGCGG - Intergenic
1122081547 14:99270797-99270819 CGGCGGCGGCGCTGGTGGCGGGG - Intronic
1122081692 14:99271296-99271318 CGGCAGCGGCGGCAGCGGCGCGG - Intronic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221171 14:100239802-100239824 CAGCGGCGGGGCCGGCGCGGCGG + Exonic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122620963 14:103057476-103057498 AGTCTGCGGCGGCGGCGGCGGGG - Intergenic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1202899779 14_GL000194v1_random:28359-28381 CGGCGCCTGCGCCGGCGCTGTGG + Intergenic
1202928954 14_KI270725v1_random:22637-22659 CGGCGCCGGCTCCGGCGCAGAGG - Intergenic
1123423407 15:20148860-20148882 CGGCGCCGGCGCCGACGCAGAGG + Intergenic
1123684351 15:22786685-22786707 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1124500381 15:30223111-30223133 CGGCTGCGGCGCTGGCCCCGCGG - Intergenic
1124500439 15:30223290-30223312 CGGCCTCGGGGCCCGCGCCGGGG + Intergenic
1124500440 15:30223293-30223315 CGGCCCCGGCGCGGGCCCCGAGG - Intergenic
1124743192 15:32315555-32315577 CGGCTGCGGCGCTGGCCCCGCGG + Intergenic
1124922311 15:34038911-34038933 CGGCGGCGGAGGCGGCGGCGGGG - Exonic
1124983383 15:34583729-34583751 CGGCTGCCGAGCCCGCGCCCCGG + Intronic
1125200754 15:37099072-37099094 CTGCTGCGCCGCTGCCGCCGTGG - Intronic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125539581 15:40462217-40462239 CGGCGGCGACGGCGGCGGCGAGG - Exonic
1125677578 15:41511200-41511222 CGGCTTCGGGGGCGGCGGCGGGG - Exonic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1125677858 15:41512073-41512095 ATGGGGCGGCGCCGGCGCCGGGG - Intronic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1126736621 15:51737542-51737564 CGGCGGCGGCGAGGGGGCCGAGG + Exonic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127165776 15:56243817-56243839 CGGCGGCCGCGGCGGCGGCGGGG - Intergenic
1128067775 15:64775357-64775379 CGAGCGCGGCGCCGGCCCCGCGG + Exonic
1128067858 15:64775603-64775625 CGGCGGCGGCAGCGGCGGCGGGG + Intergenic
1128153541 15:65377853-65377875 CGGCCCCGGCGCCGGCCCCGCGG - Exonic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128322518 15:66703342-66703364 CGGCGGCGGTGGCGGCGACGAGG + Exonic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1128877608 15:71215073-71215095 CGACGGCGGCGGCGGCGCCCCGG + Exonic
1129082467 15:73052632-73052654 CAGCGGCGGCGACAGCGCCGCGG - Exonic
1129116413 15:73367761-73367783 CTGCTGGGGCGGCGGCGGCGAGG + Exonic
1129162238 15:73753212-73753234 CGGCCGGGGCGCGGGCGGCGCGG - Intergenic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1129893787 15:79089491-79089513 CGGCGGCGGCGCAGGGGGCGGGG + Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130411809 15:83654112-83654134 CGGCGGCGACTGCGGCGCCGCGG + Exonic
1131056708 15:89379198-89379220 CGGCTGCGGCTCCGGGGACCGGG - Intergenic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132055558 15:98648545-98648567 TGGCAGCGGCGGCGGCGGCGCGG + Intergenic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132426769 15:101724428-101724450 CGACTGCGGCGAGGGCGACGCGG + Exonic
1132641879 16:981786-981808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1132779350 16:1614310-1614332 CGGCCCCGGCCCCGGCCCCGGGG - Intronic
1132808791 16:1787921-1787943 CGCCTGCGGGGCAGGAGCCGAGG - Exonic
1132815918 16:1826551-1826573 CGGAGGCGGCGCAGGCGCTGAGG - Intronic
1132868746 16:2106235-2106257 CTGCTGCGGCGCTGTCGCCAGGG - Exonic
1133156451 16:3880136-3880158 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1134149873 16:11797189-11797211 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1134149875 16:11797195-11797217 CGGCGGCGGCGGCGGGGCCTGGG + Intronic
1134164035 16:11915853-11915875 CTGCTGCCGCGGCGACGCCGGGG - Exonic
1134441529 16:14302121-14302143 CGGCAGCGGCCCAGGCGGCGGGG - Intergenic
1135517619 16:23148953-23148975 CGGCGGCGGCGTGGGCGCGGCGG + Exonic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136129643 16:28211735-28211757 TGGCGGCGGCCCCGGCCCCGAGG + Exonic
1136365558 16:29807544-29807566 CGGCGGCGGCGCTGCCGCAGTGG + Exonic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1136498736 16:30659330-30659352 CGGGGGCGGCGCCGGCTCCCCGG + Exonic
1136536416 16:30902395-30902417 CGGCTGAGGCGGTGGCGGCGGGG - Exonic
1136933501 16:34437850-34437872 CGGCAGAGGCTCCGGCGCGGCGG - Intergenic
1136971071 16:34973964-34973986 CGGCAGAGGCTCCGGCGCGGCGG + Intergenic
1137426572 16:48385377-48385399 CGGCGGCGGCGGCGGCGGCCAGG - Intronic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1137617704 16:49856959-49856981 CGGCGGCGGCGGCTGCGCCCCGG + Intronic
1137655259 16:50153560-50153582 CGGCGGCGGCGGCGGCCCTGCGG + Intronic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1138105626 16:54285957-54285979 CGGCAGCGGCGGCAGCGCGGGGG - Exonic
1138105710 16:54286212-54286234 CGGCGGCGACGGCGGCGGCGAGG + Exonic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138450773 16:57092561-57092583 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139402925 16:66696598-66696620 CGGCGGCGGCGGCGGCGATGCGG - Exonic
1139451167 16:67029123-67029145 CGGCGGCGGCGGCGGCGGCCGGG + Intronic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139534413 16:67562686-67562708 CGGCGGCGGAGCGGGCGCCGCGG + Exonic
1139534452 16:67562810-67562832 CGGCGCCAGCGCCGCCGCCGGGG + Intronic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1139917836 16:70439126-70439148 CGGCGGCGGCGGCGGCGCTCGGG - Intronic
1139974783 16:70800938-70800960 CGGCTGCCGGGGCCGCGCCGGGG + Exonic
1140223272 16:73058774-73058796 CGGCGGCGGCTCCGGCTCCCCGG - Intronic
1140529038 16:75648247-75648269 CCGCTGCGGCTCCGGCTCCGCGG - Exonic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141079183 16:81035881-81035903 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1141608577 16:85169243-85169265 CGGCGGCGGCGGCGGGGCCCGGG - Intergenic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141608761 16:85169902-85169924 CGGCCGCCGTGGCGGCGCCGGGG + Intergenic
1141620505 16:85234743-85234765 CTGCTGCGGGGGCGGAGCCGGGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1142049936 16:87951614-87951636 GGGCTGCGGCGCGGGCGGCCCGG - Intronic
1142136215 16:88453148-88453170 CGGCTCCGCCCCCAGCGCCGCGG - Intergenic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1142399181 16:89850435-89850457 CGGCTGCGGTGCCGCCGATGAGG + Exonic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142586852 17:979430-979452 CGGCGGCGGAGCCCGAGCCGCGG - Exonic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1142631305 17:1228538-1228560 CGGCGGCAGGGCCGGCGCCCGGG - Intronic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1142855101 17:2724692-2724714 CGGCGGTGGCGCCGGGGCCCGGG + Intergenic
1142876337 17:2853777-2853799 CGGCTGCCCCGCGGGCCCCGAGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143492979 17:7294609-7294631 CGGCAGCGGGCCCGGAGCCGAGG + Intronic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143750114 17:9021685-9021707 CGGCGGCGGGGCCGGGACCGGGG + Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109998 17:12021459-12021481 CCACTGCGGCGGCGGGGCCGAGG - Intronic
1144724540 17:17495253-17495275 CGGCGGCGGCGGCGGCGACCCGG - Exonic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1144971285 17:19111263-19111285 CGGCGGTGGCGGCGGCTCCGCGG + Intergenic
1144991590 17:19237434-19237456 CGGCGGTGGCGGCGGCTCCGCGG + Exonic
1145248459 17:21284769-21284791 CGGCGGCGGCGACTGCGGCGAGG - Exonic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145795871 17:27655115-27655137 CGTCTCCGGCACCGGAGCCGGGG - Intergenic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146371097 17:32266015-32266037 CGGCGGCGGCGCGGGGACCGGGG + Intergenic
1146371112 17:32266054-32266076 GGGCTGCGGAGCGGGCGCGGAGG + Intergenic
1146716202 17:35089076-35089098 AGGCGGCGGCGGCGGCGCTGGGG - Intronic
1147139717 17:38454148-38454170 CGGCCCCGGCCCCGGCCCCGCGG - Intronic
1147486364 17:40818905-40818927 CGGCGGCGGCGGCGGCTACGGGG - Exonic
1147659992 17:42112337-42112359 CTGCTGCTGCGCCAGCGCCCTGG + Intronic
1147661909 17:42121257-42121279 GGGCTGCGCAGCCGGGGCCGGGG + Exonic
1147994587 17:44353893-44353915 CGGCTGCGGCCCCGCCCCCGGGG + Exonic
1148048721 17:44759093-44759115 CAGCTGCGGAGCCGGGGCGGGGG - Exonic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323615 17:46771441-46771463 CGGCAGCGGCGCCCGGGCCCCGG + Intronic
1148356472 17:46978941-46978963 CGGCGTGGGCGGCGGCGCCGGGG - Exonic
1148467236 17:47872503-47872525 CGGCGGCGGCGGCGGCGATGGGG + Intergenic
1148648123 17:49230737-49230759 CGGCTCCGGCTCCGGCTCCCGGG - Exonic
1148786923 17:50150100-50150122 CGGCGGCGGCGCAGGCTGCGCGG + Exonic
1149610456 17:57955129-57955151 CGGCCGCGGCCCCGGCCCAGCGG - Intronic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150561923 17:66302329-66302351 CGGCGGCGGCGGCGGCGGCCGGG - Intergenic
1150747241 17:67825786-67825808 CGGCGGTGGCGGCGGGGCCGGGG - Exonic
1150747244 17:67825792-67825814 CGGCGGCGGCGGTGGCGGCGGGG - Exonic
1150791887 17:68205748-68205770 CGGCGGCGGGGCCGGGGCAGGGG - Intergenic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1151660338 17:75515375-75515397 AGGCTGCGGGGCCCGCGCTGGGG - Intronic
1151857891 17:76736441-76736463 CGGCTGCGGCGACGCCGCCTAGG + Exonic
1152049183 17:77959081-77959103 CGGCGGCTGCGGCGGCGGCGCGG - Intergenic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152110073 17:78353043-78353065 CGGCTGCGGCCGCGGCGATGCGG + Intergenic
1152222211 17:79075062-79075084 CGGCCGCGGCGGCGGCGGCCGGG + Exonic
1152245590 17:79183159-79183181 CGGTGGCGGCGGCGGCGCAGAGG + Intronic
1152345342 17:79747739-79747761 CGGCGGTGGCGCCGGATCCGAGG - Intergenic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152751574 17:82064941-82064963 AGGCTGCTGAGCCGGCGCCACGG - Exonic
1152923834 17:83078968-83078990 CGGCAGAGGCCCCGGCGCGGCGG + Intergenic
1153935222 18:9914594-9914616 TGGCGGCGGCGGCGGCGCCAGGG - Intronic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1155152796 18:23135884-23135906 CGGCGGCTGGGCCGGCGCGGCGG - Exonic
1155392757 18:25352413-25352435 CGGCGGCGACGGCGGCGGCGCGG - Intergenic
1156446939 18:37243912-37243934 CGGCGGCGGCGGCGGCGACCCGG + Exonic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157384298 18:47248308-47248330 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1157794216 18:50559973-50559995 CTGCTGCGGCGGTGGCGCTGGGG - Intergenic
1157849137 18:51030715-51030737 CGGCGGCGGCGGCGGCGGCTGGG + Intronic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1157867202 18:51197234-51197256 CGGTGGCGGCGGCGGCGGCGGGG + Exonic
1157867213 18:51197258-51197280 CGGCTGCGGCAGGGGGGCCGGGG + Exonic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158434950 18:57428800-57428822 CGGCTGCGGCGTCGAGGCCGCGG - Intergenic
1158601938 18:58863501-58863523 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1158893525 18:61894041-61894063 CGGCGGCCGCGCCGAAGCCGTGG - Intronic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040577 18:63320040-63320062 CGGCGGCGGCGGCAGCGCGGCGG + Exonic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1160024934 18:75209236-75209258 CGGGGGCTGCGCCGGCGCCGGGG - Exonic
1160164047 18:76495099-76495121 GGGCTGCGCCGCAGGGGCCGCGG - Intronic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160539241 18:79611446-79611468 CGGCTGTGGCTACGACGCCGAGG + Intergenic
1160691046 19:460832-460854 CGGCGGCGGCGCGGGCGGCTGGG - Exonic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160719235 19:590156-590178 CGGCTGCGGAGCCGGCCCCGCGG - Exonic
1160719292 19:590334-590356 CGGCCTCGGGGCCCGCGCCGGGG + Exonic
1160719293 19:590337-590359 CGGCCCCGGCGCGGGCCCCGAGG - Exonic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160826363 19:1082273-1082295 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1160897202 19:1408340-1408362 AGGCGGCGGCGACGGCGCCCTGG - Intronic
1160907213 19:1456999-1457021 CGGCCGCGGCCTCGGTGCCGTGG - Exonic
1160921802 19:1524151-1524173 CGACTCCTGCGCCGCCGCCGCGG - Intronic
1160930585 19:1567992-1568014 CGGCGGCGGCGGCGGCGTGGGGG - Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1160967703 19:1753839-1753861 CGGCGGCGGTGGGGGCGCCGGGG + Exonic
1160967920 19:1754595-1754617 CGGCCGCTGCGCCCGCGCTGGGG - Exonic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161006768 19:1941112-1941134 CAGCCGCGGCCACGGCGCCGGGG - Intergenic
1161115577 19:2494910-2494932 CCACTGGGGCCCCGGCGCCGGGG + Intergenic
1161309357 19:3585545-3585567 CGGATCCGGCGGCGGCGGCGAGG + Exonic
1161333752 19:3700213-3700235 GGGCTGCGGGGCCGGGGCGGGGG - Intronic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161450707 19:4343862-4343884 CGGCGGCGGGGCCGGGGCGGGGG + Exonic
1161495617 19:4584370-4584392 GGGCTGCGGCCCCGGGTCCGAGG + Intergenic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161628829 19:5341079-5341101 CGGCTGCGGCGGCGGCGGGAAGG + Intergenic
1162033206 19:7926052-7926074 CGGCGGCGGCGGCGGCGGCCCGG + Exonic
1162099997 19:8333740-8333762 CGGCAGCTGAGCCGGCCCCGCGG - Exonic
1162144432 19:8605230-8605252 CGGCTGTGGCCCCCGTGCCGCGG + Exonic
1162145509 19:8610661-8610683 CAGCGGCGGCGACGGCGCGGAGG - Intronic
1162357461 19:10194923-10194945 CGGCGGCAGCGCAGGCGCCCCGG + Exonic
1162470875 19:10871493-10871515 CGGTGGCGGCGGCGGCGGCGAGG + Exonic
1162535835 19:11262466-11262488 CGGCGGCGGGGCCGGGGCCCGGG - Intronic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162547546 19:11339582-11339604 CGGCTGCGGGGTCGGGGTCGCGG - Exonic
1162582559 19:11539872-11539894 CGGCTCTGGGGCCGGCGCTGGGG - Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162760472 19:12885726-12885748 CGGTTGCAGCGCCAGCGCCTTGG + Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1163138809 19:15332498-15332520 CGGCGGCGGCGGCGGCGGCTGGG - Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163243303 19:16077031-16077053 CGACTCCGGGGCTGGCGCCGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1163720459 19:18896046-18896068 CGGCGGCGGGGCCCGCGGCGGGG - Exonic
1165204513 19:34172431-34172453 CGGCGGCAGCGGCGGCGGCGCGG - Intergenic
1165349517 19:35268502-35268524 CGGCGGCGGCGCGAGCCCCGGGG - Intergenic
1165349743 19:35269198-35269220 CGGCCCCGGCCCCGGCCCCGCGG + Intronic
1165349744 19:35269201-35269223 AGGCCGCGGGGCCGGGGCCGGGG - Intronic
1165408243 19:35643395-35643417 CGCCTTCGGAGCCGGCGGCGGGG - Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165924887 19:39320807-39320829 CGGCGGCGGGGCCGGGCCCGGGG - Intergenic
1165956953 19:39507076-39507098 CCGCTGCCGCGCCGGCTTCGCGG + Exonic
1166039332 19:40192262-40192284 CGGGTGCAGCGGGGGCGCCGGGG - Exonic
1166106739 19:40601348-40601370 GGGCTGGGGCGGCGGCGCGGCGG + Intronic
1166304253 19:41928592-41928614 AGGCGGCGGCGGCGGCGCGGGGG + Intronic
1166351309 19:42199732-42199754 CAGCTGCCGCGCCAGCGCCTGGG + Exonic
1166361247 19:42253856-42253878 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1166546994 19:43639787-43639809 CGGCGGCGGCGGCGGCACCATGG - Exonic
1166888065 19:45973475-45973497 CGGCGGCGGCTGCGGGGCCGCGG + Exonic
1167019090 19:46861081-46861103 CGGCGGCGGCTCCGGCGGCGGGG - Intergenic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1167268251 19:48493883-48493905 CGGGCGCGGCGGCGGGGCCGCGG - Exonic
1167280306 19:48563675-48563697 AGGCTGGGGCGCAGGCACCGTGG + Intronic
1167456292 19:49597933-49597955 CGGCCTCGGCCCCGGCCCCGGGG - Exonic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167505717 19:49870058-49870080 GGGCTGCGGGGACGGCGACGGGG + Exonic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167578497 19:50328972-50328994 CGGCAGCGGTGGCGGCGGCGGGG + Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
1168064075 19:53909471-53909493 CGGCTGCGGGGCCCGCGGCCCGG + Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168076352 19:53982606-53982628 CGGCGGCGGAGGCGGCGGCGGGG + Exonic
1168346801 19:55653868-55653890 CGTCTGCCGCGCCTGCGCGGCGG + Intergenic
1168414437 19:56159639-56159661 GGGCTGAGGGGCCGGCGCCTGGG + Exonic
1168685982 19:58350010-58350032 CGCCTGCGGGACCGGGGCCGGGG + Intronic
1202710760 1_KI270714v1_random:18313-18335 CGGCTGCGGCACAGGGGCCAGGG + Intergenic
925609844 2:5693339-5693361 CGGCTCGGGCGGCGGCGGCGCGG + Exonic
926035104 2:9630455-9630477 CGGGCGCGGGGCCGGGGCCGGGG + Exonic
926077319 2:9951725-9951747 CGGCTGCGGGTCCGGAGCGGCGG - Exonic
926251094 2:11155789-11155811 CAGCTGCGACGCCGGCGCGCGGG - Intronic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
928303685 2:30147842-30147864 CGGCGGCGGCGGTGGCGGCGGGG - Intronic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
928904376 2:36355479-36355501 CGGCTCTGGCCCCGGCGCCGCGG - Intergenic
929000752 2:37344969-37344991 CGGGTGGGGCGCCGGTGCCTGGG - Intronic
929778359 2:44942296-44942318 CGGCGGCGGCGGCGGCTCCAGGG + Exonic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
930529430 2:52571921-52571943 CTGCTGCAGAGGCGGCGCCGAGG - Intergenic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931869917 2:66446095-66446117 CGGCTGCGACCCCGGAGCAGAGG + Intronic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
933666715 2:84970837-84970859 CGGCGGCGGCGGCGGCGGCCAGG + Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933684724 2:85133735-85133757 AGGCGGCGGCTCCAGCGCCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933908291 2:86914936-86914958 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934882445 2:97995719-97995741 CGGCGGCGGCGCGGAAGCCGTGG + Exonic
935137844 2:100322576-100322598 CTGCTGGCGCGCCGGCACCGCGG + Exonic
935196630 2:100820199-100820221 CGGCTGCGGCCCAGGAGCGGCGG + Exonic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592563 2:104855624-104855646 CGGCGGCGGGGGCGGCGCAGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592897 2:104857084-104857106 CGGCGGCGGCGGCGGCGGCAGGG - Exonic
936073064 2:109384190-109384212 CGGCTGCGGGCCAGGCCCCGGGG + Intronic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936278722 2:111120772-111120794 CGCCGGCGGCCGCGGCGCCGAGG + Intronic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
936954995 2:118014188-118014210 CTGCTGTGGCGCAGGCGCAGTGG - Intergenic
938018397 2:127885998-127886020 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
938271855 2:129979678-129979700 GGGCTGCGGCGGCGGCGGCTGGG + Exonic
938444146 2:131364122-131364144 GGGCTGCGGCGGCGGCGGCTGGG - Intergenic
938451542 2:131425324-131425346 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
939153799 2:138501739-138501761 CGGCGGCGGCGGCGGCTCCTGGG - Intergenic
939432660 2:142130786-142130808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
942043371 2:172085256-172085278 GGGCTGCGGCGTCTGCGCCGGGG - Exonic
942046188 2:172100734-172100756 CGGCAGCGGCGCCGGCAGCTCGG - Exonic
942278053 2:174336793-174336815 CGGCGGCGGCGGAGGAGCCGAGG - Exonic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942446140 2:176080241-176080263 CGGCGGGGGCGCCGGGGCCGGGG - Exonic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942450903 2:176107589-176107611 CGGCGGCGGCGGCAGCGCGGGGG + Exonic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
942450925 2:176107637-176107659 CGGGGGCGGCGGCGGCGCGGGGG + Exonic
943470804 2:188292056-188292078 CGGCCGGGGCGCCGTCTCCGAGG - Intronic
944933630 2:204545548-204545570 CGGCGGCGGCGGCGGCGCACGGG - Intergenic
945189028 2:207166928-207166950 CGGCGGCGGCGCCCGCGGGGCGG - Intronic
945466006 2:210171292-210171314 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946404074 2:219483584-219483606 GGGCTGGGGCTCCGGCGCTGCGG - Exonic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946921437 2:224585182-224585204 CGGCGGCGGCGGCGGCGGCTCGG + Exonic
947418481 2:229921702-229921724 CGCCGGCGGCGGCGGGGCCGCGG - Intronic
947741331 2:232486362-232486384 CGGCGGCGGCGCCTGTCCCGAGG - Exonic
947741662 2:232487576-232487598 CGGCTGCGGCTGCGGCTCCCGGG - Intronic
948479158 2:238239635-238239657 CGGCGGCCGGGCAGGCGCCGTGG - Intronic
948487250 2:238288749-238288771 CGGCGGAGGCGGCGGCGCTGAGG - Intronic
948492118 2:238320484-238320506 CGGCGGCCGCGCAGGCGCTGTGG + Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1168795882 20:610033-610055 CGGCGGCGGCGCGGGCCCCGTGG - Exonic
1168883252 20:1225636-1225658 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1169207791 20:3749769-3749791 CGACTGCGGCGGAGGCACCGTGG + Exonic
1169214723 20:3786501-3786523 CGGCGGCGGCGCCGGGCCCCGGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1170026049 20:11890919-11890941 CGGCTGCGTCGCCCGAGGCGAGG + Exonic
1170150381 20:13221379-13221401 GGGCTGCGGGGTCGGCGGCGGGG - Intergenic
1170150501 20:13221712-13221734 CGGCGGCGGCGGTGACGCCGGGG - Intergenic
1171464643 20:25319069-25319091 CTGCTGCGGGGCCAGGGCCGAGG - Intronic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172596592 20:36154710-36154732 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1173166661 20:40690683-40690705 CGGTTTCGGCGCCTGAGCCGAGG - Intergenic
1173243437 20:41317620-41317642 CGGCGGCGACGCCGGAGCCGCGG + Intronic
1173576641 20:44116294-44116316 CGACCGGGGCGCCGGCGCAGCGG - Exonic
1174053915 20:47785433-47785455 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1174380696 20:50153674-50153696 CGGCGGCGGCGGCAGGGCCGCGG + Exonic
1174576730 20:51542516-51542538 AGGCTGCGGGGCCGGGGGCGAGG + Exonic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175715516 20:61252449-61252471 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175926774 20:62475194-62475216 CGGCAGCGGCGGCAGCGCGGGGG - Exonic
1175944200 20:62551161-62551183 CGGCTCCGGCGGGGGTGCCGTGG + Intronic
1176125389 20:63472645-63472667 CGGCCGCGGGCCAGGCGCCGAGG - Intergenic
1176194430 20:63830898-63830920 CAGCTGCGGCGCGGGCTCCGGGG - Intronic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176548427 21:8211775-8211797 CGGCAGCGGCCCCGACGGCGTGG + Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556318 21:8255981-8256003 CGGCCGCGGCCCCGACGACGTGG + Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567358 21:8394810-8394832 CGGCAGCGGCCCCGACGGCGTGG + Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575257 21:8439023-8439045 CGGCCGCGGCCCCGACGACGTGG + Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176590977 21:8651224-8651246 CGGCGCCGGCTCCGGCGCAGAGG - Intergenic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1176619154 21:9043133-9043155 CGGCGCCTGCGCCGGCGCTGTGG + Intergenic
1177188112 21:17819671-17819693 CGCCTGCGGCCCCCGCCCCGGGG - Intergenic
1178103975 21:29298761-29298783 GGGCTTCGGCGCCGGGGGCGGGG + Intronic
1178610431 21:34074147-34074169 CGGCGGCGGGGCCGGCGACGAGG - Intronic
1178916698 21:36709021-36709043 CGGCTGCGGAGCCGGGGAGGCGG + Intronic
1178981196 21:37267011-37267033 CGGCGGCGGCGCCTGCCCTGGGG + Intronic
1178992264 21:37366346-37366368 GGGCTGCGGGGGCGGCGGCGCGG + Intronic
1179054326 21:37916905-37916927 AGGCTCCGGCTCCCGCGCCGGGG - Intergenic
1179561584 21:42219215-42219237 CGGCGGCGGCGGCGGGGACGAGG - Exonic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179605708 21:42513996-42514018 CGGCTGCGGCGCCTGAGCGCCGG - Exonic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1179977029 21:44874022-44874044 CGGCTCCTGCGCCTGCGCGGCGG + Intergenic
1180136798 21:45867227-45867249 CGGCTGCTGCGCCGGATCTGAGG + Intronic
1180273803 22:10628257-10628279 CGGCGCCGGCTCCGGCGCAGAGG - Intergenic
1180614773 22:17120233-17120255 CCGCGGGGGCGCCGGCGGCGCGG - Exonic
1180614905 22:17120695-17120717 CGGCGGGGGCGCCGCGGCCGGGG - Exonic
1180650018 22:17369697-17369719 AGGCTGCGGCGCTGCCGCGGCGG + Exonic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG + Intronic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1181030314 22:20146282-20146304 TGGCTGCGGTGCTCGCGCCGTGG + Intronic
1181478025 22:23180573-23180595 CGGCGGCGGCGGCGGCGGCACGG + Exonic
1181478026 22:23180576-23180598 CGGCGGCGGCGGCGGCACGGCGG + Exonic
1181491517 22:23263194-23263216 CGGCTGCGGGGCCAGCGCTCTGG + Intronic
1181725136 22:24806237-24806259 CGGCTGCAGCAGCAGCGCCGCGG + Intronic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1182475519 22:30574588-30574610 CGGCAGCGGCGGCGGGGGCGGGG - Intergenic
1183247219 22:36703246-36703268 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1183386744 22:37519387-37519409 CGGCGGCTCCGCCGGCGCAGGGG + Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183524929 22:38317279-38317301 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1183540750 22:38428074-38428096 CGGTTGCGGCGCTTCCGCCGGGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183744866 22:39686332-39686354 CGGTTGCGGCGGGGGCGCCAAGG - Exonic
1183912949 22:41092442-41092464 CCGGTGCGGCGGCGGCGGCGCGG + Exonic
1184035257 22:41915000-41915022 CGGAGGCCGCGCCGGGGCCGCGG + Intergenic
1184439083 22:44497921-44497943 CGGGCGCGGGGCGGGCGCCGCGG - Intronic
1184465898 22:44668775-44668797 TGGCAGCGGCGGCGGCGGCGCGG + Intronic
1184465901 22:44668784-44668806 CGGCGGCGGCGCGGGGACCGAGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185055202 22:48575677-48575699 CGGCCGCGGCGGCGGAGGCGCGG + Intronic
1185055269 22:48575874-48575896 CGGCGGTGGCGGCGGCGGCGCGG + Intronic
1185055270 22:48575877-48575899 CGGTGGCGGCGGCGGCGCGGCGG + Intronic
1185055360 22:48576110-48576132 CGGCTCCGGGGGCGGCGGCGGGG + Intronic
1185278708 22:49960894-49960916 CGGCCGCGGCTTCGGCGCCTGGG + Exonic
1185296761 22:50058450-50058472 CGGCTGCGGGGTCGGCGGCGCGG + Intergenic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185409537 22:50674647-50674669 CGGCCCCGGGGCCAGCGCCGTGG + Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203253308 22_KI270733v1_random:128078-128100 CGGCCGCGGCCCCGACGACGTGG + Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261363 22_KI270733v1_random:173157-173179 CGGCCGCGGCCCCGACGACGTGG + Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950153834 3:10708003-10708025 CGGCTGCGGCTCCTCTGCCGCGG + Intronic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
951080464 3:18445285-18445307 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
951217731 3:20040507-20040529 CGGCTGCGGGGCAGGAGCCGGGG + Exonic
951485287 3:23203240-23203262 CGGCGGCAGCGGCGGCGCTGAGG + Intronic
952451783 3:33440126-33440148 CGGCTGCAGCGCTAGCGGCGCGG - Exonic
952942300 3:38454086-38454108 AGGCTGCGGCCCGGGCTCCGGGG - Exonic
953705149 3:45225520-45225542 CGGTGGCGGCGGCGGCGCTGGGG + Exonic
953909285 3:46883515-46883537 CGGCGGCGGCGGCTGCCCCGAGG + Exonic
953947779 3:47164026-47164048 CGGCGGCGGCGGCGGCGGCAGGG + Intergenic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954382575 3:50227468-50227490 GGGGTGCGGCGCGGGAGCCGAGG - Intronic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954540739 3:51391657-51391679 GGGCTCCGGCGCTGGCGGCGGGG + Exonic
954615555 3:51967344-51967366 CGGCGGCGGCGGCGGCGGCACGG + Exonic
954615556 3:51967347-51967369 CGGCGGCGGCGGCGGCACGGCGG + Exonic
954778995 3:53045741-53045763 CGGCGGCGGCGCCGGGGCGGGGG - Intronic
954795885 3:53161222-53161244 CGCCTCGGGCTCCGGCGCCGCGG - Exonic
955763815 3:62319000-62319022 CAGCTACTGCGCCGACGCCGGGG - Intronic
955769235 3:62372520-62372542 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956675022 3:71725289-71725311 CGGCGGCAGCGGCGGCGGCGCGG + Exonic
956677936 3:71753428-71753450 CGGCGGCGGCGCCCGCGCTGGGG - Intronic
956813594 3:72888202-72888224 CGGCGGCGGCGGCGGCCCCCAGG - Exonic
957970404 3:87375505-87375527 CAGCTGAGGCCCCGGCGCCCAGG - Intergenic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
959591895 3:108090920-108090942 CGGCGGCGGCGGCGACCCCGCGG - Exonic
959849708 3:111071950-111071972 AGCCTGAGGCGCCGGGGCCGGGG + Exonic
961013016 3:123448477-123448499 AGACTGCGGCGCCGGCGCCCCGG - Exonic
961252690 3:125520196-125520218 CGGCGGCGGCGCAGGCGCACTGG - Exonic
961446293 3:126983224-126983246 CGGCGGCGGCGCGGGCGGCTGGG + Intergenic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
962277951 3:134030031-134030053 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
963213955 3:142724296-142724318 CGGCCGGGGCGCCGGCGGCTGGG + Exonic
963253044 3:143119853-143119875 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966860980 3:184230676-184230698 CGGGTGGGGCGCGGGCGCGGCGG + Intronic
966866519 3:184261473-184261495 CGGCGGCGGCGGCGGTGGCGGGG + Intronic
967867735 3:194204153-194204175 CGGCTCCAGCGCCGCCCCCGCGG - Intergenic
967916720 3:194583896-194583918 CGGCGGCGGCTGCGGCGGCGGGG + Intergenic
967924189 3:194633389-194633411 CGGCGGCGGCGAAGGCGCCGGGG + Exonic
967930451 3:194686864-194686886 CGCCTGCCGCGGCGGCGCCTCGG - Exonic
968178168 3:196568983-196569005 CGATGGCGGCGCCGGCCCCGGGG + Exonic
968382281 4:107425-107447 CGGCCGGGGCGCCGGGGCCCTGG - Intergenic
968434110 4:576196-576218 GGGCTCCGGCGGCGGCGGCGCGG - Intergenic
968556736 4:1249485-1249507 CGGCTGCGGCTGCGGCGCGGAGG - Intronic
968640501 4:1712222-1712244 AGGCTGAGGCGGCGGCGGCGCGG + Exonic
968908787 4:3466322-3466344 CGGCTCCTGCGCCGTCTCCGTGG - Intronic
969113308 4:4856841-4856863 TGGCTGCGGGGCCGGTGCTGCGG + Intergenic
969330801 4:6472541-6472563 TGGCTGCGGCGACGGCGGCGAGG + Intronic
969436591 4:7192612-7192634 CGGCAGCGGAGCCGGCGGCGGGG - Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970456221 4:16226550-16226572 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
970597616 4:17614609-17614631 CGGCTTCCGCGCAGGCGCAGTGG + Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457812 4:26860800-26860822 CGGCGGCGGCGCGGGAGCTGGGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972739049 4:41873693-41873715 AGGCGGAGGCCCCGGCGCCGAGG + Intergenic
972817179 4:42657141-42657163 GAGCTCGGGCGCCGGCGCCGGGG + Intergenic
973279219 4:48341712-48341734 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
974047140 4:56907872-56907894 CGGTGGCGGCGGCGGCGGCGCGG + Intronic
975118464 4:70704821-70704843 CGGTGGCGGCGGCGGCGCAGCGG + Intronic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975778985 4:77819675-77819697 CGGCGGCGGCGGTGGCGGCGGGG + Intergenic
975870832 4:78776579-78776601 CGGCAGCGGCGGCGGAGCGGCGG + Exonic
975986259 4:80203237-80203259 CGGCTGCGGCGGCGGCCGCGGGG + Exonic
976431407 4:84966514-84966536 AGGCTGAGGCGGCGGCGGCGGGG - Intergenic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
978072572 4:104491421-104491443 CGGCGGCGGCGGCGGAGGCGGGG - Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979205586 4:118033690-118033712 CGGCTGCGGGGCGAGCGCAGCGG - Intronic
979624118 4:122827049-122827071 AGGCTGGGGGGCCGGGGCCGGGG + Exonic
980035782 4:127881256-127881278 CGGCTGCGGGGCGGGCACCGAGG + Intronic
980130362 4:128811616-128811638 CAGCTGCGCCGCCCGGGCCGGGG + Intronic
981504108 4:145481723-145481745 CGGCAGCGGCGGCGGCGCGCGGG + Intronic
981550557 4:145937589-145937611 CGGCTGCTCCCGCGGCGCCGAGG - Intronic
982042371 4:151409038-151409060 CGGCGGCGGGGGCGGGGCCGGGG + Intergenic
982573201 4:157076123-157076145 GGGCCGCGGAGCCTGCGCCGTGG - Exonic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745989 4:159104011-159104033 CGGCGGCGGCGCGGGGCCCGCGG - Intergenic
983061508 4:163166473-163166495 TGGCTGTGGCTGCGGCGCCGGGG + Exonic
983061509 4:163166479-163166501 TGGCTGCGGCGCCGGGGTCCCGG + Exonic
983649680 4:170026146-170026168 CGGCGGCCGAGTCGGCGCCGGGG - Intronic
984167530 4:176320296-176320318 GGGCTGCCGTGCCGGGGCCGCGG + Intronic
984668066 4:182449093-182449115 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
984992636 4:185396284-185396306 CTGCTGCCGCCTCGGCGCCGGGG - Intronic
985537439 5:473153-473175 CGGGGGCGGGGCCTGCGCCGGGG - Intergenic
985555302 5:555193-555215 CGGCTTCCTCGCGGGCGCCGGGG + Intergenic
986297088 5:6448739-6448761 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987050805 5:14144910-14144932 CGGCGGCGGCGGCGGCCTCGGGG + Intronic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987258268 5:16179474-16179496 CGGCGTCGGCGGCGGCGGCGGGG + Exonic
989379240 5:40797824-40797846 AGGCCGCGGCGCCGTCGCCATGG + Intronic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992468531 5:77030786-77030808 CGGCGGCGGCGACCGCGGCGGGG - Exonic
992487435 5:77210402-77210424 CGGCTGCGGCCGCGGAGCCGGGG + Intergenic
992487493 5:77210573-77210595 CGGCGGCGGGGGCCGCGCCGAGG + Intronic
992530143 5:77645318-77645340 CGGCGACGGCGGCGGCGGCGCGG - Intergenic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
992940039 5:81751838-81751860 CCGCTGCGGTGGCGGCGCCCGGG + Intergenic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
994107322 5:95961732-95961754 CGGCGGCGGCGGCGGCACCCCGG - Exonic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995106207 5:108380921-108380943 CGGCTGCGGGGGCTGCTCCGGGG + Exonic
995106233 5:108381004-108381026 CGGCGGCGGCGGCGGTGGCGGGG - Exonic
995224723 5:109689846-109689868 CGGGGGCGGTGCCGGTGCCGCGG + Exonic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997912431 5:137889324-137889346 CGGCTGCGCCGCAGGAGCCCGGG - Intronic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
998166656 5:139848230-139848252 CGCGAGCGGCGCCAGCGCCGGGG + Exonic
1000052552 5:157575474-157575496 CGGCGGGGGCGCAGGCCCCGCGG + Intronic
1001035089 5:168291775-168291797 CGGCAGCGGCAGCGGCGGCGTGG + Intronic
1001070308 5:168579568-168579590 CGGCGGTGGCGGCGGCTCCGGGG - Exonic
1001191621 5:169637435-169637457 ATGCTGCGGGGCCGGCGGCGCGG + Intronic
1002061980 5:176630505-176630527 CGGCTCCGGCTCCGGCGCTGCGG + Intronic
1002401660 5:178994569-178994591 CGGCCGCGGCGACGGCGACGAGG - Exonic
1002591053 5:180291926-180291948 CGGCGGCGGAGCCGGGGCCGCGG - Exonic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002621973 5:180494461-180494483 TGGCGGCGGCGACGGCGGCGCGG + Exonic
1002621974 5:180494464-180494486 CGGCGGCGACGGCGGCGCGGAGG + Exonic
1002712769 5:181205065-181205087 CGGCCCCGGAACCGGCGCCGAGG - Exonic
1002925799 6:1605076-1605098 TGGCTGCGGCCCCGGCGCCTGGG + Intergenic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1002928615 6:1619149-1619171 CGGCTGGGGAGCCGGGGCCAGGG + Intergenic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004044727 6:12012581-12012603 CAGCTGCAGCGCCCCCGCCGCGG - Intronic
1004044868 6:12013089-12013111 CGGCGGCGGAGCAGGCGGCGAGG + Intronic
1004193872 6:13487271-13487293 GGGCTGCGGCGGCGCGGCCGCGG - Exonic
1004216780 6:13711248-13711270 CGGCGGGGGCGGCGGGGCCGCGG + Exonic
1004504727 6:16238651-16238673 CGGCGGCGGCGACGGCGGGGCGG - Exonic
1004650181 6:17600580-17600602 CGGCTGCGGCGGCAGCCGCGAGG - Exonic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1004924046 6:20402355-20402377 CGGCGGCGGCGGCGAAGCCGGGG - Exonic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1006293966 6:33161633-33161655 AGGCGGAGGCGCCAGCGCCGAGG + Intergenic
1006369186 6:33633753-33633775 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1006645384 6:35511739-35511761 CGTCTGCGGCGCCCGGGCCTGGG + Exonic
1006694564 6:35920617-35920639 CGGCTGCGGGGCCTGCCTCGGGG + Intronic
1006725502 6:36196795-36196817 CGGCGGCGGCGGCCGGGCCGGGG + Exonic
1006814250 6:36839815-36839837 CGGATGGGGCGCTGGCGGCGGGG + Exonic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1007600164 6:43076382-43076404 CTGCTGCGGCGCCCGCGCTCCGG + Intronic
1007630260 6:43269534-43269556 CCCCTGCGGCGCCGGCGTCCCGG - Intronic
1007784207 6:44270790-44270812 CGGCGGCGGTGGCGGCCCCGGGG + Exonic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1010703266 6:79077625-79077647 CGGCGGCAGCGGCGGCGCAGCGG + Intronic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1011277443 6:85643769-85643791 CGGCCGCGGAGCCGGGGGCGGGG - Intronic
1013009575 6:106107137-106107159 GCGCTGCGGCCCCGGCGCCTGGG + Exonic
1013099478 6:106974865-106974887 CGGCGGCGGCGGGGGCGCTGGGG - Intronic
1013230511 6:108157785-108157807 CGGCTGCGGCGGGGGCGGCCGGG - Intronic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1014913361 6:127118780-127118802 CGGCTGCGGCTGCAGCGGCGGGG - Exonic
1014913372 6:127118818-127118840 CGGCTGCAGCGGCGGCCCCTTGG - Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1015149311 6:130020111-130020133 CGGGGCCGGGGCCGGCGCCGGGG + Intronic
1015220639 6:130801497-130801519 CGGCAGCGGCGGCAGCGGCGGGG + Intergenic
1015799384 6:137044862-137044884 CGGCTGTGGCGGAGGCGCCCTGG - Exonic
1015843048 6:137493490-137493512 CAGCTGCAGCGCGGGCGGCGTGG + Exonic
1015965589 6:138693082-138693104 CGGCGGCGGCCGCGGCGGCGAGG + Intergenic
1015994942 6:138987945-138987967 CGGCTCCGGCTCCGGCCGCGGGG + Exonic
1016714107 6:147204111-147204133 CGGCGACGGTGGCGGCGCCGGGG + Intergenic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018400358 6:163414733-163414755 CGGCAGCGGCAGAGGCGCCGCGG + Exonic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019111916 6:169723980-169724002 CGGCAGCGGCGGCGGCGGCCGGG - Exonic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019343457 7:519041-519063 CGGCTGGAGCGCCCGCCCCGCGG - Exonic
1019343754 7:519997-520019 CTGCCGCGGCGGCGGCGCCCGGG - Intronic
1019544979 7:1569894-1569916 CGGCTGCAGGGCCGGGGCGGCGG - Exonic
1019563189 7:1667842-1667864 CGGCGGCGGCGCCGGCGTCCGGG + Intergenic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019828333 7:3301616-3301638 CGGTGGCGGCGGCGGCGGCGCGG + Exonic
1019989555 7:4682253-4682275 CGGCTGCAGCGGCGGCGCGGGGG - Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1020278310 7:6637517-6637539 CGGGGGCGGCGGCGGCGGCGGGG + Intronic
1021451050 7:20784418-20784440 CGGCGGCGGCGGCGGCTCGGCGG - Exonic
1021451051 7:20784421-20784443 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021827988 7:24573553-24573575 CGGCGGCAGCGGCGGCGCGGAGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1021828056 7:24573763-24573785 CGGCGGCGGCGCCGCGGTCGGGG + Intronic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022310902 7:29194886-29194908 CGGCGGCGGCGTCCGCACCGGGG + Exonic
1022396091 7:29989361-29989383 CGGCTGCGGTGCGGGAGCCCGGG + Intronic
1023405882 7:39833523-39833545 CGGTAGCGGCGGCGGCGGCGAGG + Intergenic
1023637590 7:42228073-42228095 AGGCCGCGGCGGCGGCGCGGTGG + Intronic
1024579949 7:50793340-50793362 TGGCGGCAGCGCCGGCGGCGCGG - Intronic
1025069689 7:55887623-55887645 CGGCGGCGGCGGCGGCGTCAGGG + Intronic
1025481867 7:60992641-60992663 AGCCTGGGGCGCCGGCGCCTAGG - Intergenic
1025608195 7:63054404-63054426 GGGCTCCGGCGGCTGCGCCGCGG - Intergenic
1025739042 7:64182008-64182030 CGGCGGCGGCGCCTGGTCCGGGG - Intronic
1027061898 7:75092779-75092801 CGTCGGCGGCGTCGGCGGCGGGG - Intronic
1027138199 7:75639204-75639226 CGGCGGCGGCGGCGGCACCAAGG + Intronic
1029123187 7:98281711-98281733 CGGCGGCGGCGGCGGGGACGCGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640400 7:101816394-101816416 CGGCGGCGGCGCGGGGCCCGGGG - Intronic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029896399 7:103989353-103989375 CGGCGGCGGCGGCGGCGGCATGG - Exonic
1030138607 7:106284264-106284286 CCTCTGCGGCTCCGGCGCGGAGG - Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033299973 7:140176830-140176852 CGGGGGCGGCGGAGGCGCCGAGG + Exonic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1033477154 7:141702073-141702095 CGGCTGCGGGGCCTGCGGCAGGG + Exonic
1033657000 7:143381349-143381371 AGTCTGCGGACCCGGCGCCGAGG + Exonic
1034147137 7:148883842-148883864 TGGCCGGGGCGCCGGGGCCGGGG - Intronic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034228007 7:149497741-149497763 GGGCCGCGGCGCCGGCTCCCAGG - Exonic
1034254014 7:149714743-149714765 CCGCTTCCGAGCCGGCGCCGCGG + Intergenic
1034264125 7:149773117-149773139 CGGCCGCTCCGCCCGCGCCGCGG + Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034483534 7:151341716-151341738 CGGCGGCGGCGGCGGCGCGAAGG + Exonic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1034977739 7:155457987-155458009 GGGCTCCGGCGCCGCCGCCTGGG - Intergenic
1036723698 8:11200983-11201005 CGGCGGCGGCTCCGGCCGCGCGG + Exonic
1036786667 8:11692625-11692647 CGGCTGAGGCGCAGAGGCCGCGG - Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG + Exonic
1038883505 8:31639660-31639682 CGGGCGCGGCGGCGGCGCGGGGG + Intronic
1039454294 8:37697291-37697313 CGGCTGCGGAGGCGGCGCCCGGG - Exonic
1039554866 8:38468315-38468337 CTGCGGAGGCCCCGGCGCCGCGG + Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1039921461 8:41896788-41896810 CGGCGGCGGCGGCGGCGAAGCGG + Intergenic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1041040653 8:53843087-53843109 CGGCTGTGTCCCCGGCGCCCCGG - Exonic
1041124456 8:54621336-54621358 CGGCTGCTGAGCCAGGGCCGCGG - Exonic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041690398 8:60680417-60680439 CGGCGGCGGCGGCGGCTCCCGGG + Intronic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1042962186 8:74315450-74315472 CGGCGGCGGCTGCGGCGTCGTGG + Exonic
1043148338 8:76682476-76682498 CGGCGCGGGCGCGGGCGCCGCGG + Intronic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1043954200 8:86342626-86342648 AGGGCGCGGCGCCGGCGACGCGG + Intergenic
1044999704 8:97869028-97869050 CGGCTGGGGAGGCGGTGCCGCGG - Intronic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1045583223 8:103500814-103500836 CAGCGGCGGCACCGGCGCGGCGG - Intronic
1046547209 8:115667939-115667961 CGGCGGCGGCGGCGGCCCCTCGG + Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047024555 8:120811811-120811833 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1048214269 8:132480880-132480902 CGGCGGCGGCGGCGGCACCCAGG + Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049548907 8:143247263-143247285 CGGCCTCGGGGCCGGCGCCCGGG - Exonic
1049574378 8:143383660-143383682 CCGCTCCGGCTCCGGCTCCGTGG - Exonic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049623438 8:143609522-143609544 CAGCTGCGGAGCCGTCTCCGCGG - Exonic
1049665446 8:143840805-143840827 CCGCCTCGGCGCCGGCTCCGGGG + Exonic
1049665447 8:143840808-143840830 CGGCCCCGGAGCCGGCGCCGAGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050455727 9:5832625-5832647 CGGCTCCTGCGCAGGCTCCGGGG - Intronic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1051287426 9:15510935-15510957 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1051665066 9:19461323-19461345 CGGCGGCGGCGACGGCGCGAGGG + Intergenic
1051855428 9:21559637-21559659 CGGCTTCGGCGCCGCGGCCGGGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1052888939 9:33677382-33677404 CGGCGGCGGCGGCGGCGGCCCGG - Intergenic
1053055188 9:34989756-34989778 AGGCGGCGGAGCCGGAGCCGGGG + Exonic
1053070208 9:35096585-35096607 CGGCGGCGGCGCCTGCGACCTGG + Intronic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054407655 9:64774848-64774870 CGGCGGCTGCGGCGGCGGCGGGG + Intergenic
1054798627 9:69325384-69325406 CGGCGGCGGCAGCGGCGCCCGGG - Intronic
1054842666 9:69760048-69760070 CGGCCGCGGCGGCGGGGACGCGG - Intergenic
1054842667 9:69760054-69760076 CGGCGGCGGCCGCGGCGGCGGGG - Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055611776 9:78031582-78031604 CGGCGGCGGCGGCGGCTCGGGGG - Intergenic
1055611779 9:78031585-78031607 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1056676896 9:88683473-88683495 CTCCTGGGGCCCCGGCGCCGCGG - Intergenic
1057208111 9:93185108-93185130 GGGCTGCGGGCCCGGCGCCTCGG - Exonic
1057361126 9:94374677-94374699 CGGCGCCAGCGGCGGCGCCGAGG - Exonic
1057488632 9:95506092-95506114 CGGCAGCGGCGGCGGGCCCGGGG + Intronic
1057547258 9:96027601-96027623 CGGCGGCGGCGCCGGCCTGGAGG - Intergenic
1057619163 9:96619597-96619619 GGGCTGCGGCGCCGGTCCTGCGG - Exonic
1057619216 9:96619762-96619784 CCGCTGCTGCGTAGGCGCCGGGG + Exonic
1057662233 9:97013475-97013497 CGGGTCAGGCGGCGGCGCCGAGG + Exonic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1059769796 9:117414665-117414687 CGGCGCCCGCGCCGGGGCCGGGG - Exonic
1059769799 9:117414671-117414693 CTGGAGCGGCGCCCGCGCCGGGG - Exonic
1060114440 9:120929113-120929135 CGGTGGCGGAGGCGGCGCCGAGG - Intronic
1060209082 9:121699423-121699445 CGGCGGCGGCGGCGGCGCTCCGG - Exonic
1060283475 9:122228846-122228868 GGGCGGCGGGGCCGGCGCCTCGG - Intronic
1060554952 9:124503464-124503486 CGGCTGGGGCGGCGGCCGCGGGG - Intronic
1060643887 9:125261884-125261906 CGGCTAGGGCGACGGCTCCGAGG + Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1060849196 9:126860686-126860708 CGGCGGCGGAGGGGGCGCCGCGG + Intronic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061299661 9:129697386-129697408 CGGCGGCGGCGCGGGCAGCGCGG + Intronic
1061438152 9:130579652-130579674 CGGCGGCGGCGACGGCGGCGGGG + Exonic
1061513688 9:131076268-131076290 GGGCTGGGGCGCCGGGGCCAGGG - Intronic
1061808457 9:133149132-133149154 CGGCTGCCGGGGCGGCCCCGAGG - Intronic
1061884580 9:133585182-133585204 CTCCTGCGGCACCGGCACCGAGG + Intronic
1061961673 9:133991971-133991993 CGGCGGCGGCCCAGGCGCCCTGG - Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062230696 9:135480028-135480050 CGGGTGCAGGGCCGGGGCCGGGG + Intronic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062414120 9:136439369-136439391 CGGCTGCGGGGCCGGCTCGGAGG + Exonic
1062443718 9:136584644-136584666 TGGCTGCAGCGCCGGCCCCTGGG - Intergenic
1062507673 9:136886472-136886494 CGGCGGCGGCGGCGGCGTTGGGG + Intronic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1062572977 9:137194100-137194122 CGGCTGGGGTGCCGGGGCCTGGG - Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062579189 9:137222051-137222073 CGGACGCGGCGCCCGCGCCTCGG + Intergenic
1062592656 9:137281119-137281141 CTGCAGCGGGGCCGGCGGCGGGG - Exonic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469708 Un_GL000220v1:111225-111247 CGGCCGCGGCCCCGACGACGTGG + Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477529 Un_GL000220v1:155197-155219 CGGCCGCGGCCCCGACGACGTGG + Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203620990 Un_KI270749v1:129948-129970 CGGCGCCGGCTCCGGCGCAGAGG - Intergenic
1185736622 X:2500831-2500853 CTGCTGCGGCGCTGCCGCGGGGG - Exonic
1185894123 X:3843384-3843406 CGGCTCCGGCGACCGCGCCTCGG + Exonic
1186496379 X:10015322-10015344 CGGCGGCGGCGGCGGCTCCCGGG + Intergenic
1187067465 X:15854726-15854748 CGGCGGCGGCGGCGGCGAAGGGG + Exonic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1187950418 X:24465316-24465338 CGGCTGCACCGGCGGCGCCGAGG + Intronic
1188003527 X:25002648-25002670 CGGCGGCGGCGGCGGCGTGGCGG + Intergenic
1189323182 X:40098179-40098201 CCGCTGCGGCGCCTCCGCGGCGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324664 X:40105333-40105355 TGACTGCGGCGGCGGCGGCGGGG - Intronic
1189325707 X:40109555-40109577 CGGACTCGGCGCCGGCCCCGCGG + Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1189474017 X:41334986-41335008 CGGCTGCGGCGCAGGGCCCCCGG - Intronic
1189534512 X:41923174-41923196 CGGCCCCGCCGCCCGCGCCGGGG - Intronic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190114894 X:47619939-47619961 CGGCTGGGCCGGCGGCGGCGCGG + Intergenic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1195802806 X:108732894-108732916 CGGCTGCTGCGCCGATGCCCGGG + Exonic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196031078 X:111096320-111096342 CGGCTGCGGCCGCGGGGCTGCGG + Intronic
1197415105 X:126165273-126165295 CGGCTCCCGCGACGGCACCGTGG - Exonic
1197415263 X:126165963-126165985 CGGCGGCGGCGGCGGCGGCCCGG + Intergenic
1197415264 X:126165966-126165988 CGGCGGCGGCGGCGGCCCGGCGG + Intergenic
1197735034 X:129843946-129843968 CGGCCGGGGCGGAGGCGCCGAGG - Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198767096 X:140091345-140091367 CGGCGGCGGCGGCGGCGGCTGGG + Intergenic
1199445121 X:147912093-147912115 CGGCGGCGGCGGCGGCGGCTGGG + Exonic
1199500387 X:148500731-148500753 CGGCGGCGGCAGCGGCGGCGGGG - Exonic
1200155289 X:153971842-153971864 CGGCAGCGGCGCCGGCGGTCGGG + Intergenic
1200292665 X:154887048-154887070 GGGCTGGGGTGCCGGCGGCGGGG - Exonic
1200339509 X:155382788-155382810 GGGCTGGGGTGCCGGCGGCGGGG - Exonic
1200346961 X:155457905-155457927 GGGCTGGGGTGCCGGCGGCGGGG + Exonic