ID: 1175847021

View in Genome Browser
Species Human (GRCh38)
Location 20:62064838-62064860
Sequence GGCCGCCGGGGGCCCCGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 480}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175847021_1175847039 -7 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847039 20:62064854-62064876 GGCGGCCGGGGCGGGGGCGGGGG 0: 1
1: 12
2: 262
3: 2311
4: 6379
1175847021_1175847041 2 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847041 20:62064863-62064885 GGCGGGGGCGGGGGCTGCCCCGG 0: 2
1: 2
2: 34
3: 313
4: 2139
1175847021_1175847051 30 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847051 20:62064891-62064913 CCCCCGTTCTGGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 20
4: 147
1175847021_1175847035 -10 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847035 20:62064851-62064873 CCCGGCGGCCGGGGCGGGGGCGG 0: 1
1: 0
2: 34
3: 316
4: 2109
1175847021_1175847037 -9 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847037 20:62064852-62064874 CCGGCGGCCGGGGCGGGGGCGGG 0: 1
1: 3
2: 59
3: 474
4: 2490
1175847021_1175847049 29 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847049 20:62064890-62064912 GCCCCCGTTCTGGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 8
4: 172
1175847021_1175847043 19 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847043 20:62064880-62064902 CCCCGGCGCTGCCCCCGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 129
1175847021_1175847048 26 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847048 20:62064887-62064909 GCTGCCCCCGTTCTGGGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 137
1175847021_1175847045 20 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847045 20:62064881-62064903 CCCGGCGCTGCCCCCGTTCTGGG 0: 1
1: 0
2: 1
3: 3
4: 100
1175847021_1175847047 23 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847047 20:62064884-62064906 GGCGCTGCCCCCGTTCTGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 144
1175847021_1175847038 -8 Left 1175847021 20:62064838-62064860 CCCCCGCGGGGCCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 45
4: 480
Right 1175847038 20:62064853-62064875 CGGCGGCCGGGGCGGGGGCGGGG 0: 2
1: 8
2: 174
3: 791
4: 3253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175847021 Original CRISPR GGCCGCCGGGGGCCCCGCGG GGG (reversed) Exonic
900145599 1:1157599-1157621 GACCGCTGGGCGCCCCGAGGAGG + Intergenic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900344481 1:2204590-2204612 GGCTCCCGGGGGCTCGGCGGCGG - Intronic
900386283 1:2412472-2412494 GGCCGCCGCCAGCCCCCCGGAGG - Exonic
900391074 1:2434204-2434226 GGCCGGCGGGGGCCGCGCCTGGG + Intronic
902044480 1:13514314-13514336 GGCTGCCAGGGCCCCCGCTGTGG + Intergenic
902067609 1:13700655-13700677 GGCCACCTGGGGCCCCACGTGGG + Intronic
902680733 1:18042182-18042204 GGAGGCAGGGGCCCCCGCGGGGG + Intergenic
903233758 1:21936997-21937019 GCCCGCCGGGGACCCCGGGCCGG - Intronic
903263370 1:22142961-22142983 GGCCGCGGGGGGCCTCCCGTCGG + Exonic
903420759 1:23216936-23216958 TGGCGCCCGGGGCCCCTCGGGGG + Intergenic
903652444 1:24930156-24930178 GGCCGCGGCGGGGCCCGCGCGGG + Intronic
903742853 1:25568383-25568405 GGATGCCGGGAGCCCCACGGGGG - Exonic
903986932 1:27235079-27235101 GGACACCCGGGGCCCCGAGGCGG - Intronic
904050164 1:27634152-27634174 GCCCACCCGGAGCCCCGCGGCGG + Intronic
904181462 1:28669154-28669176 GGGCGCCGGGGCCCCCCCAGTGG - Intronic
904252996 1:29237855-29237877 GGCCGCCCGGGGCGCAGCCGCGG - Intronic
905066914 1:35192319-35192341 GGCGGCGGGGAGCCCCGCGGGGG - Exonic
905803798 1:40861972-40861994 GGCCGCGGGGGGCTCCGCTGGGG - Exonic
905912233 1:41662629-41662651 GGCTGCCGGCGGCCGCGGGGAGG + Intronic
906950909 1:50333766-50333788 GGCCGCCAAGGGCCCCGGAGCGG - Intergenic
909657415 1:78046459-78046481 GTCCGCCGGGGGCGTCCCGGGGG + Intronic
911527539 1:99004749-99004771 AGCCACCGGGGGCGCGGCGGCGG + Exonic
912652156 1:111449128-111449150 GGCCGCCGGGGGCACTAGGGGGG + Exonic
912878953 1:113390403-113390425 GCGCGCCGGGCGCCGCGCGGCGG + Intergenic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
913222036 1:116667568-116667590 GCCCGGAGGGGGCCCCGGGGAGG - Intronic
914255337 1:145957793-145957815 GGCAGGCGGGGGGCCCGCAGGGG + Exonic
914919578 1:151838334-151838356 CTGCGCCTGGGGCCCCGCGGCGG - Exonic
917291604 1:173477231-173477253 GGCCGCTGGGGGCCGGGCCGCGG - Intergenic
920385751 1:205569323-205569345 GGGTGCCGGGGGCCGCGGGGCGG - Intronic
920528353 1:206684956-206684978 GGGCGGCGGGGGCCCGGCCGGGG - Intronic
922116450 1:222618300-222618322 GGCCCCGGGGGTCTCCGCGGCGG + Intronic
922335936 1:224617971-224617993 GGACGCTGGGGGCCTAGCGGAGG - Intronic
922496501 1:226062226-226062248 GCGCGCCGGGGCCCGCGCGGGGG + Intronic
922513143 1:226186465-226186487 GGCGGCTGGGGGCGCGGCGGAGG - Exonic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
924172446 1:241356762-241356784 CGCCCCCGGGAGCCCCGCGCCGG - Intronic
1062898105 10:1120369-1120391 GACCCCCGGGTGCCCCTCGGAGG - Intronic
1063418335 10:5890592-5890614 GGCCTCGGGGGGCAGCGCGGGGG - Intronic
1064028733 10:11869783-11869805 GCCGCCCGGGGGCCCCGCAGTGG + Exonic
1064086524 10:12349748-12349770 GGGCGCCGGGGGCGCGGCGCGGG - Exonic
1064231023 10:13529152-13529174 GGCCGCGCGGCGCCCCGAGGAGG + Intergenic
1064443104 10:15371055-15371077 AGCCGCCGCCGGCCCCGCGGCGG - Exonic
1065188923 10:23193224-23193246 GGCTGCGGGGGGCCGGGCGGCGG + Exonic
1065636989 10:27743465-27743487 GGCCGCCGGGAGCTCCGCAGCGG + Exonic
1066022706 10:31319339-31319361 GGCAGCCGGGGCGCCCCCGGGGG + Intronic
1066464200 10:35639448-35639470 GGCGGCGGGGGGCCGGGCGGCGG - Exonic
1066464211 10:35639466-35639488 GGCGGCGGGGGACCCGGCGGCGG - Exonic
1068617763 10:59138338-59138360 GGCCTGCGGGCGGCCCGCGGAGG - Intergenic
1069738363 10:70672385-70672407 GGGCGCCGGGCGCCCGGGGGCGG - Intergenic
1071086879 10:81875400-81875422 GGCCGAGGAGGGCACCGCGGCGG + Exonic
1072059746 10:91798481-91798503 GCCCCCCGGCTGCCCCGCGGCGG - Exonic
1072336621 10:94403327-94403349 CGGCGCCGGGGGTCCCGAGGAGG + Exonic
1072336657 10:94403482-94403504 GGGCACCGGCGGCCCCGCCGGGG - Exonic
1072654295 10:97319647-97319669 GGCCCCCGGGGGCGCCGCTGCGG + Exonic
1072809226 10:98446565-98446587 GGCAAACGGGAGCCCCGCGGCGG - Intronic
1072891674 10:99329972-99329994 AGCCGCCGGCGGCGCCGTGGTGG - Exonic
1073059417 10:100724508-100724530 GGACGCGCGGGGCCCCGGGGCGG + Intergenic
1073139691 10:101238953-101238975 GGCCGCCGCGCTCCCCGCGCGGG + Intergenic
1075587132 10:123666245-123666267 GGCCGCCTGAGGCTCCGGGGTGG + Intergenic
1075800758 10:125152064-125152086 GGCCGCCAAGTGCCCTGCGGGGG + Intronic
1076329699 10:129655180-129655202 GTCCCGTGGGGGCCCCGCGGAGG + Intronic
1076821681 10:132942768-132942790 GGACGCCGGGGGCTCCGCGCGGG + Intronic
1076895363 10:133308842-133308864 CGCCGTCGGGGGCTGCGCGGGGG - Exonic
1076936159 10:133568384-133568406 GGCCGCGGAGGGCTCCGCGGGGG - Intronic
1077090753 11:777267-777289 GGCCGCTGGGGGCGCCGGGCAGG - Intronic
1077367040 11:2165477-2165499 GGCCTCCGAAGGCCCGGCGGGGG - Intronic
1077371729 11:2185562-2185584 TGCCGCAGGGAGCCCTGCGGAGG + Intergenic
1079126372 11:17720917-17720939 CGCCGCCGGGCGCCGCTCGGGGG - Exonic
1081636880 11:44727322-44727344 GGTCCCCGGGGGCGCGGCGGCGG - Intronic
1081927904 11:46846043-46846065 GGAGGCCGGGGGACCTGCGGCGG - Intronic
1083660957 11:64251563-64251585 GGCCGGAGCGGGCCGCGCGGTGG + Exonic
1083813229 11:65117123-65117145 GGCGGCCGCGGGCTCCGCGGCGG + Exonic
1083940122 11:65891230-65891252 CGCCGCTGGGGCCGCCGCGGGGG - Exonic
1084086443 11:66857304-66857326 GGCCGCCGGGCGCAGCGCGGGGG + Intronic
1084128672 11:67118131-67118153 GGCCGCCGGGGGCACCGGCGCGG + Intergenic
1084151374 11:67289359-67289381 GGCCGCGGGGGGCGCAGCTGGGG + Exonic
1084165590 11:67373427-67373449 GACCCCCGGGAGCCCCGCGCCGG - Intronic
1084310154 11:68312350-68312372 GGCCGCCGGGCCCCGCGGGGCGG + Intergenic
1084516116 11:69638879-69638901 GGCCCCCGGGTCCCCCGAGGGGG - Intergenic
1084758123 11:71251922-71251944 GGCCGCCAGGTGGCGCGCGGGGG - Intronic
1085197967 11:74683645-74683667 GGCCGCGGTGGGGGCCGCGGTGG - Intergenic
1086959709 11:92969676-92969698 GGCTGTCCGGGGCCGCGCGGTGG + Intergenic
1089527586 11:119107437-119107459 GTCCGGCGGGGCCCGCGCGGTGG + Exonic
1089694923 11:120211076-120211098 CGCCCCCGGCGGCCCCGAGGCGG - Exonic
1089729585 11:120511902-120511924 GCGGGCCGGGGGCGCCGCGGGGG - Intronic
1089772842 11:120815723-120815745 GGCCGCTGGGGGCACCGCCATGG - Intronic
1091393311 12:138916-138938 GCCCGCCGCGGGCTCTGCGGGGG - Exonic
1095825830 12:46530473-46530495 GGCAGACGGGGGCCCTGAGGTGG + Intergenic
1095953717 12:47795224-47795246 GGCTGCATGGGGCCCGGCGGTGG + Exonic
1096489779 12:52007156-52007178 GTCCGCTGGGGGCCCAGGGGTGG - Exonic
1096622683 12:52874322-52874344 GGCGGCCGGGGGCCCCAGGGCGG + Intergenic
1096983732 12:55743385-55743407 GGCGGCCGAGGGCCCCGCGGCGG + Exonic
1097176772 12:57147819-57147841 GGCCTCAGGGGGGCCCTCGGGGG - Intronic
1100565659 12:95790994-95791016 GGCAGCCGGGGGCCAGGCTGAGG - Intronic
1101253460 12:102956547-102956569 GGCCGCCGAGGTGCCCGCGGCGG + Intronic
1101253461 12:102956549-102956571 CGCCGCCGCGGGCACCTCGGCGG - Intronic
1101910479 12:108857375-108857397 GGCCGCCGGACGCCGCGCCGAGG - Intronic
1102025969 12:109714496-109714518 GGCCGCCGGGCTCCCAGCGCGGG + Exonic
1102240167 12:111320256-111320278 GGGCAGCGGGGGCCCCGCGCAGG + Exonic
1102518001 12:113463151-113463173 GGCCCCCGGGGGCCGAGCGCGGG + Exonic
1102924915 12:116819344-116819366 GGCCTCCGGGCGTCCCGCGCCGG - Intronic
1103325315 12:120116531-120116553 GGCCCGCGGGGGCCTCGGGGCGG - Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1104376262 12:128267331-128267353 GGCCGGCGGGGGCCGCGGGCGGG + Intergenic
1104601927 12:130160824-130160846 GGCTGCACGGGCCCCCGCGGTGG - Intergenic
1104633540 12:130424385-130424407 GGCCGCTGCTGGCCCGGCGGCGG - Intronic
1106246427 13:27954036-27954058 GCCTGCCGGGGGCCTCGCGCAGG + Intergenic
1106776717 13:33016456-33016478 GGCGGCCGCGGGCGGCGCGGCGG - Exonic
1108478447 13:50843461-50843483 GCCCGCCGCGGGCCCGGCCGGGG - Exonic
1110706212 13:78603436-78603458 GGCTGGCGGCGGCCCCGCCGCGG + Exonic
1112336936 13:98523862-98523884 GGCCGTCGGGGCCTCCGCTGGGG - Intronic
1112344235 13:98576933-98576955 GGGCGGCGGGGGCTCAGCGGCGG + Intronic
1112494809 13:99896168-99896190 GGGCTCCGGGCGGCCCGCGGCGG - Exonic
1112505216 13:99971043-99971065 GGCCGCCGCGGGGGCCGTGGCGG + Exonic
1112506613 13:99980001-99980023 GGCGGACGGGGACGCCGCGGGGG + Intergenic
1112652656 13:101416136-101416158 TGCGGGCGGGGGCCCCGCGCGGG - Intronic
1113495553 13:110725627-110725649 GGCCTCCGGGTGCCAGGCGGTGG - Intergenic
1113517416 13:110914515-110914537 GGCAGCCGGGGGGCGCGGGGCGG - Intronic
1113614018 13:111668699-111668721 GGGAGCCGCGGGCCCTGCGGGGG - Intronic
1113656188 13:112068843-112068865 GGACGCCGGGGACTCTGCGGCGG + Exonic
1114461199 14:22887058-22887080 GGCGGCCCGGGGCCGCTCGGCGG + Exonic
1115398582 14:32934893-32934915 GGCCGGCGGGGCGGCCGCGGGGG + Intergenic
1115576295 14:34714833-34714855 GGCCGGGGGGGGCGACGCGGTGG + Intergenic
1117063922 14:51989778-51989800 GGCCGCCGAGGGTCCCGACGGGG - Intronic
1118854624 14:69611555-69611577 GGGCGGGGGAGGCCCCGCGGAGG - Intergenic
1118854746 14:69612013-69612035 CGCCGCTGGGAGCCCCGCGCTGG + Intronic
1118925688 14:70188482-70188504 GGCCGGCGGGCAGCCCGCGGGGG - Exonic
1119046254 14:71320919-71320941 GGCTGGCGGGGGGCCGGCGGGGG - Intronic
1119260896 14:73237615-73237637 AGCCCCCGGGCGCCCAGCGGCGG + Intronic
1122550050 14:102544734-102544756 GGCCTCCCGGGGCCGCGCGCAGG - Intergenic
1122557977 14:102591905-102591927 GGAGGCCGGGGCCCCCGGGGTGG - Intergenic
1122688932 14:103522578-103522600 GGCGCCGGGGGGCCCGGCGGCGG - Intronic
1122788318 14:104174013-104174035 GGCTGCCTGGGGCCCCACGCTGG + Intronic
1122978561 14:105181086-105181108 GGCCGCCGGCGGGGGCGCGGGGG + Intronic
1122984358 14:105205446-105205468 GGCAGCAGCGGGCCCCACGGGGG - Intergenic
1123023984 14:105415047-105415069 GGCCGCCCGTGGCGCTGCGGAGG - Intronic
1123630706 15:22258113-22258135 CGCCGTAGGGGGACCCGCGGCGG - Intergenic
1125200735 15:37099011-37099033 CGCCGCCGGGGCCGCCGCTGGGG - Intronic
1125597207 15:40894693-40894715 GGGCGACGGGGACCCCGGGGGGG + Exonic
1125684985 15:41558854-41558876 GGGCGCCGGCGGGGCCGCGGGGG + Intronic
1126766999 15:52019431-52019453 CGCCGCGGCGGGCCCGGCGGCGG + Intronic
1128119189 15:65133416-65133438 GGCCGCCCTGGAGCCCGCGGTGG - Exonic
1128344155 15:66842883-66842905 GGCGGCCCGGGGCTCCGCGGGGG + Intergenic
1128797243 15:70474885-70474907 GGCCGCCGGCCGCCCCGGTGAGG - Intergenic
1129322254 15:74781975-74781997 GGGCGCCGGGGGCACTGCGGGGG - Intergenic
1129348277 15:74938163-74938185 CGCCGCCGCCGGCCGCGCGGTGG - Exonic
1129644736 15:77419830-77419852 GGCCGCCAGAGCCCCGGCGGCGG + Intronic
1129814640 15:78540747-78540769 GGACGCCGGGGCCCGCGAGGGGG + Intronic
1130831786 15:87608401-87608423 GGCCGCCAGGGGCCCATCTGAGG - Intergenic
1132055640 15:98648852-98648874 GGCGGGCGGGGGCCGGGCGGGGG + Intergenic
1202966182 15_KI270727v1_random:178784-178806 GTGCGCCGGGGGCTCTGCGGGGG + Intergenic
1132490730 16:229206-229228 GGCCGCCGGGCGGCCTGAGGCGG - Intronic
1132522215 16:397106-397128 GGCGGCGGGGGGCTCCGGGGCGG + Intronic
1132656695 16:1044481-1044503 GGCCGCCTGGGGGGCCGAGGTGG + Intergenic
1132682381 16:1148390-1148412 GGCCGCCTGGGGACCTGGGGAGG - Intergenic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132876886 16:2143955-2143977 GCAAGCCGGGGACCCCGCGGAGG + Intronic
1133156589 16:3880514-3880536 GGCCTCCCGGAGCCCGGCGGCGG - Exonic
1133188452 16:4116355-4116377 GGCCGCGGGGGACACGGCGGCGG - Intergenic
1133784374 16:8963430-8963452 GGCCCCGGGGCGGCCCGCGGCGG + Exonic
1134149662 16:11796492-11796514 GGCCGCCTGAGGCCCGGCCGGGG - Intronic
1135321759 16:21502160-21502182 CGTCGCCGGGGCCCCCGAGGAGG + Intergenic
1135775920 16:25257610-25257632 GGCCGCCGCGGGTGCCGCTGGGG + Exonic
1136227122 16:28866633-28866655 GGTCTCCAGGGGCCCAGCGGAGG - Exonic
1136365292 16:29806671-29806693 GAGCCCCGGGGGCCCCGCTGCGG + Exonic
1137426331 16:48384706-48384728 GGCCTCCGGGCGCCGCGGGGAGG + Intronic
1138560529 16:57798261-57798283 GGCTGCCTGGTGCCCCGAGGAGG - Exonic
1138660801 16:58515896-58515918 GGCGGGCGGAGGACCCGCGGCGG + Exonic
1139491119 16:67286549-67286571 GGCCTGCGGGGGCCCCACGCAGG + Exonic
1139546708 16:67653118-67653140 GCCGGCCGGGGGCCCAGGGGCGG - Exonic
1139806178 16:69566573-69566595 AGCGGCCGGCGGCTCCGCGGGGG - Intronic
1139950066 16:70664271-70664293 GGCCGTGGGCAGCCCCGCGGTGG + Exonic
1140223101 16:73058173-73058195 GGCCGCCGGCGACCCCCGGGAGG - Intronic
1141615299 16:85206679-85206701 GGACGCTGGGGGCCCAGCCGGGG - Intergenic
1141765082 16:86052904-86052926 GGCAGCCGGGGGCTCCCCTGAGG + Intergenic
1142067667 16:88072098-88072120 GGCCTCCTCGGACCCCGCGGCGG + Exonic
1142203195 16:88770780-88770802 GGCCGCGCGGGGCCCAGTGGAGG - Intronic
1142408664 16:89905058-89905080 GGACGCCGGGGACCCAGCCGTGG + Exonic
1143452477 17:7043847-7043869 GGCGGGCGGGGGCCCCGAAGGGG + Exonic
1143830358 17:9645842-9645864 GGCCCCCGGGAGCCCCGGGGAGG + Exonic
1143976700 17:10835660-10835682 GGACGCCGGGGTCCCCGAGCTGG + Intronic
1144500845 17:15786230-15786252 GGGCGGCGGGGGTCCGGCGGCGG - Intergenic
1145163006 17:20588892-20588914 GGGCGGCGGGGGTCCGGCGGCGG - Intergenic
1146322722 17:31859166-31859188 GGCCGCCGGGGCCCAGGCGCAGG - Exonic
1146398417 17:32486471-32486493 GGCAGCTGCGGGCGCCGCGGCGG + Intergenic
1147200711 17:38799610-38799632 GGCCGGCGGGCTCCCCGGGGCGG - Exonic
1147264388 17:39225893-39225915 GGCCGCCGGGTGCCGGGCTGGGG - Intergenic
1147393450 17:40123172-40123194 GGCCGCCAGGGTCCCGGCGGTGG - Intronic
1148262239 17:46193550-46193572 GGCCCGCGGGGGCGGCGCGGCGG - Intronic
1148664076 17:49361849-49361871 GGCTGCCGGGGGCGCCGCCGCGG + Intronic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1149512668 17:57256352-57256374 GGCAGGCGGGGGCCGCACGGGGG + Intronic
1149597851 17:57874689-57874711 GGCAGCCGAGGGCCGGGCGGTGG + Intronic
1149663885 17:58352374-58352396 GCCCGCCGAGGGCGCGGCGGAGG + Intronic
1152209889 17:78997418-78997440 GCCTGCCGGGGGCCGGGCGGTGG + Exonic
1152237453 17:79145907-79145929 GGCCGCCGGGGGCAGGGGGGTGG + Intronic
1152349703 17:79777937-79777959 CCCCGCCCGGGGCCCCGCGCGGG + Intergenic
1152433101 17:80260503-80260525 CGCCGCCGCCGGCCCCGCGCAGG - Intergenic
1152697575 17:81804533-81804555 GGCCGCCTGGCGCCCTGCGGCGG + Intronic
1152721855 17:81927403-81927425 GGCGGTTGGGGGCCCGGCGGCGG - Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1152779180 17:82218894-82218916 AGCCGCCGGGGGCACCGCTAGGG + Intergenic
1152808873 17:82371883-82371905 GGGCGCGAGGGGCTCCGCGGTGG - Intergenic
1152870833 17:82752214-82752236 GGCCGCGGGCGGCCCCGAGGAGG + Exonic
1153514476 18:5891332-5891354 GGCCCCGGGGGGCGCCGCGGCGG + Exonic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1153997602 18:10455089-10455111 GGGCGCCGCGGAGCCCGCGGAGG + Intronic
1154070571 18:11148829-11148851 GGCCGCAGGGGGCCGGGCGCCGG - Intergenic
1154202459 18:12308598-12308620 GGCCGCCGGGGCGCCTGGGGTGG + Intronic
1154241373 18:12657337-12657359 GGCTGGCCGGGGCCCCTCGGAGG - Intronic
1154499061 18:14985438-14985460 GGAGGCCGGGGGCACCGCGAGGG - Intergenic
1154501017 18:14998117-14998139 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
1154954586 18:21242101-21242123 GGGCGCGGGGGTCCCCGCTGCGG + Intergenic
1154991236 18:21600271-21600293 GGGCTCCGGGAGCCCCGAGGTGG - Intronic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1155199344 18:23503582-23503604 CGCCCCCGGGGCCCCCGCCGCGG + Exonic
1155519764 18:26656673-26656695 GGCGTCCGGGGGCGCCGCCGAGG + Intronic
1156350433 18:36297662-36297684 GGCCGCGGGGGGCGGGGCGGGGG - Intergenic
1157609977 18:48950154-48950176 CGCGGCCGGGGGCGCCGAGGCGG - Exonic
1158437097 18:57441433-57441455 GGCGGGCTGGGGCCTCGCGGGGG - Intronic
1158954155 18:62523581-62523603 GGCGGCAGAGGGCCCCGCGACGG - Exonic
1159511211 18:69400696-69400718 GGCCTCGGGGCGCCCGGCGGCGG + Intergenic
1160157228 18:76442976-76442998 GGCCGGCCGGGGCCACGAGGTGG - Exonic
1160499970 18:79396602-79396624 GGCCGCCGCGGGTCCCGCCGAGG + Intronic
1160511370 18:79455420-79455442 GGCCTCCCGGGGCCCCTCTGGGG + Intronic
1160540117 18:79616746-79616768 GGCCGCCGGGGCCCGGGCTGGGG + Intergenic
1160730583 19:640081-640103 GGCCGCCGGGATCCACGCGCAGG - Exonic
1160810054 19:1009379-1009401 GGCCCCCGTGGGCCTTGCGGCGG - Exonic
1160830997 19:1104799-1104821 GGCGGCCGCGAGCCCCTCGGCGG + Intronic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1160935480 19:1592650-1592672 GGCGGCGGCGGGCCCGGCGGCGG - Exonic
1160943287 19:1630021-1630043 GGCAGGCGGGGGTCCCGGGGAGG - Intronic
1160952892 19:1675997-1676019 GCCTGGCGGGGGCCGCGCGGGGG + Intergenic
1160988706 19:1851959-1851981 GGCGGCCGGGGGACCCTCCGTGG + Intergenic
1161085574 19:2333416-2333438 GTCCGCCGTGGTCCCTGCGGTGG + Intronic
1161156131 19:2732699-2732721 GCCCGCCGGGAGCCCCGGGCCGG - Exonic
1161161105 19:2762278-2762300 GGCCGCAGGGCTGCCCGCGGAGG - Intronic
1161964928 19:7542639-7542661 GGCTGCCAGGGACCCCCCGGAGG - Exonic
1162140204 19:8580808-8580830 GGCCAGAGGGGGCCCCGGGGGGG - Exonic
1162374423 19:10296352-10296374 GGTCGCCGTGGGCGGCGCGGCGG + Exonic
1162535738 19:11262207-11262229 GGCCGCGGGGGTCCCGGCGGGGG - Intronic
1163026833 19:14517759-14517781 GGCCGCCGGGGTCCGCGGGGCGG - Intronic
1163111119 19:15161388-15161410 GGCCGCAGGGGCCCCGGGGGCGG - Exonic
1163138610 19:15331845-15331867 GCGCGCCGCGGACCCCGCGGCGG + Intronic
1163154608 19:15432946-15432968 GGCCGCTGGGCGCCCAGCGTGGG - Intronic
1163438583 19:17310029-17310051 GGCCGGCCTGGGCCCCGGGGCGG + Intronic
1163587017 19:18169614-18169636 GGACCCCGGGGGACCTGCGGTGG - Exonic
1163606930 19:18280848-18280870 GGGCGCGGGGGGCGCCGCGACGG - Exonic
1163720461 19:18896048-18896070 GGCGGCGGCGGGGCCCGCGGCGG - Exonic
1163725177 19:18919303-18919325 GGCCTCCGGCGGCTCCGGGGAGG - Exonic
1163748940 19:19064053-19064075 GGGCGCGGGGGGCGCCGGGGGGG + Exonic
1164229294 19:23273899-23273921 GGACGCCGGGGTCCCGGCTGCGG + Intergenic
1164690945 19:30210380-30210402 GGCCTCCCGGGGCCCAGCGTGGG + Intergenic
1165428331 19:35757589-35757611 GCCCCCCGGGGGCCGCGCGCTGG + Intronic
1165879470 19:39032179-39032201 GGCCGCCCGGGTCCCCGCGCCGG - Exonic
1166876559 19:45901455-45901477 GGGCGCCGGGCCCGCCGCGGAGG - Exonic
1167258124 19:48443087-48443109 GCCCGCCGGCGCCCGCGCGGTGG + Exonic
1167268311 19:48494034-48494056 GGCCGCCGCGGGCCCGGCCCCGG + Exonic
1167291942 19:48629369-48629391 GGCAGCGGGGTGCCCAGCGGAGG - Exonic
1167456274 19:49597883-49597905 GGCCGAGGCGGGCCCCGCAGTGG - Exonic
1167508040 19:49881416-49881438 GGGCGCGGGTGCCCCCGCGGTGG - Exonic
1167578476 19:50328909-50328931 GGGTGCCGGGGGGCCCGCCGGGG + Exonic
1168078509 19:53993012-53993034 GGCCGCCGTGGGCGCCACGCTGG + Exonic
1168242546 19:55094678-55094700 GTCCGCTGGGGGCGCCGTGGAGG + Exonic
1168443675 19:56393469-56393491 GGCTGCCGGGGGCGCGGCCGCGG - Exonic
1168669245 19:58228797-58228819 GGGAGCATGGGGCCCCGCGGCGG - Intronic
1168719011 19:58544730-58544752 CGCCGCCGGGGGCGCCCAGGGGG - Exonic
1202693104 1_KI270712v1_random:105089-105111 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693116 1_KI270712v1_random:105133-105155 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693128 1_KI270712v1_random:105177-105199 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693140 1_KI270712v1_random:105221-105243 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693152 1_KI270712v1_random:105265-105287 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693164 1_KI270712v1_random:105309-105331 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693176 1_KI270712v1_random:105353-105375 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693188 1_KI270712v1_random:105397-105419 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693200 1_KI270712v1_random:105441-105463 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693211 1_KI270712v1_random:105485-105507 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693223 1_KI270712v1_random:105529-105551 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
925075857 2:1014967-1014989 GGAAGCCGGGGGCCCCGGGAGGG + Intronic
925309958 2:2875293-2875315 GGCTGCTGGGGGCCCTGCGAGGG - Intergenic
926325183 2:11779284-11779306 TGCCGCCTGGTGCACCGCGGGGG - Intronic
927552139 2:24010072-24010094 GGCCGCGGGCGGCGCTGCGGTGG + Exonic
927679681 2:25131526-25131548 GAGGGCCGGGGACCCCGCGGAGG + Intronic
927881504 2:26692840-26692862 GGGCGCCGGGGGGCCGGCGGCGG + Exonic
928511971 2:32010685-32010707 GGGTGCGGGGAGCCCCGCGGGGG - Intronic
928606437 2:32947891-32947913 GGCCACTCGGAGCCCCGCGGTGG + Intronic
929578691 2:43068451-43068473 GGCCGGCGGGGGCCGCCCGTGGG + Intergenic
930096494 2:47570435-47570457 GGCGGCGAGGGGCTCCGCGGCGG - Exonic
930872756 2:56184633-56184655 GGCGGCCGGAGGCGCGGCGGCGG + Exonic
931253785 2:60553882-60553904 GGCCGCAGCGAGCGCCGCGGCGG + Intergenic
931614632 2:64143979-64144001 GGCCGCCGGGGAAGCCGCCGAGG + Intronic
931614642 2:64144017-64144039 GGCCGCCGAGGGGCGCGGGGAGG - Intronic
931671875 2:64654401-64654423 GGCGGGCAGGGTCCCCGCGGGGG + Intronic
932592522 2:73075826-73075848 GGCAGCCTGGGGCCCTGTGGTGG - Intronic
934716987 2:96550140-96550162 GGCCGGCGGGCGCCCCCTGGCGG - Intronic
935592469 2:104855358-104855380 GGCCGGCGGGGGCCCGGGGCGGG + Intergenic
937198021 2:120177348-120177370 GGCAGCCGGGGGCACTGCTGAGG + Exonic
937203840 2:120223421-120223443 GGCCGGGGCGGGCCCTGCGGGGG + Intergenic
937305803 2:120869851-120869873 GGCTGCAGGGGGCCCTGCAGGGG + Intronic
938277145 2:130037135-130037157 GGTCGCCGGGGGCTTCGGGGTGG - Intergenic
938328115 2:130427908-130427930 GGTCGCCGGGGGCTTCGGGGTGG - Intergenic
938361834 2:130693570-130693592 GGTCGCCGGGGGCTTCGGGGTGG + Intergenic
938438239 2:131300254-131300276 GGTCGCCGGGGGCTTCGGGGTGG + Intronic
938500188 2:131828306-131828328 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
941095888 2:161239012-161239034 CGGCGCTGGGGGCCGCGCGGGGG - Intergenic
941905587 2:170714691-170714713 GGCGGGCGGGGGACACGCGGCGG + Intergenic
944515736 2:200510036-200510058 GGCCGCCGGACGCCGCGGGGCGG + Exonic
945045284 2:205776328-205776350 GGCCGCCGGGGGCGCCGTGCTGG + Intronic
946354848 2:219178260-219178282 GGCGGAAGGGGGCGCCGCGGAGG - Exonic
946865523 2:224038846-224038868 GCCCGCCGGGAGCCCCGAGCGGG - Intronic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
948563987 2:238871875-238871897 GGCTGCCGGGGGCCGAGGGGAGG + Intronic
948590225 2:239044530-239044552 GGCTGCCGAGGGCCCCTGGGAGG + Intergenic
948874724 2:240820424-240820446 CACCGCGGCGGGCCCCGCGGAGG + Intergenic
1168753080 20:297589-297611 GGCCACCGGCGGCGGCGCGGAGG + Exonic
1169216150 20:3795993-3796015 TGCCGCGGGGGGTCCTGCGGAGG + Exonic
1169405276 20:5316768-5316790 GGCAGGCGGGGACCCCGGGGCGG - Intergenic
1170567358 20:17614677-17614699 AGCTGCCGGGAGCCCCGGGGAGG - Intronic
1170761040 20:19251830-19251852 GGCAGCCGGGGTCCCCAAGGGGG + Intronic
1172568979 20:35954236-35954258 GGCCACTGGGAGTCCCGCGGCGG - Exonic
1172702682 20:36862885-36862907 CGCGGCCGGGGGCCCGGCGGGGG - Exonic
1173243427 20:41317591-41317613 GGCCGGCGCAGGCCCCGCAGAGG + Intronic
1173251642 20:41366780-41366802 GGCCGCCTGGCGCTTCGCGGCGG + Exonic
1173582903 20:44159961-44159983 GGCCGCCGAGGGCGCCGACGAGG - Exonic
1173633240 20:44532058-44532080 AGCCGCCGGGGATCCCGGGGAGG + Intronic
1173792089 20:45834245-45834267 GGCCGGCGACGGCCCCGGGGAGG + Exonic
1174054040 20:47785775-47785797 GGGCGCGGGGGGCCCAGCCGCGG + Intronic
1174386561 20:50191167-50191189 GGCCGCGGGGGGCGCCGCGGGGG - Exonic
1174506788 20:51022570-51022592 CCCCGCCGGGGTCACCGCGGCGG + Intronic
1175429122 20:58890303-58890325 CGCCGTCGGGGGCGCCGAGGAGG + Intronic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1176194648 20:63831472-63831494 GGTCGCAGGGGGCCGCGCCGGGG + Intergenic
1176550056 21:8217087-8217109 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
1176568983 21:8400122-8400144 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
1176576897 21:8444357-8444379 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
1178497723 21:33101448-33101470 GGCAGCCCGGGTCCACGCGGCGG - Intergenic
1178561588 21:33643137-33643159 GGCCTCCCGGGGACCCGCGTTGG + Intronic
1178680847 21:34670639-34670661 GGCCGAGGAGGGCCCCGCCGAGG + Exonic
1178839863 21:36130040-36130062 GGGTGCGGGGAGCCCCGCGGCGG + Intergenic
1178914496 21:36699065-36699087 GGCCGCCTGGGTCCCGGAGGGGG - Intergenic
1179788222 21:43741377-43741399 GGCTGGCGGGGGGCTCGCGGGGG + Intronic
1179951588 21:44711605-44711627 GGCGGCCGCGGGGCCCCCGGGGG + Intergenic
1180038731 21:45264873-45264895 GGCCTCAGGGAGCCCCGTGGAGG - Exonic
1180187247 21:46145838-46145860 GGCCCCCGGGGGCGGCTCGGTGG - Exonic
1180216202 21:46324915-46324937 GGCGGCCGGGAGCGCCGCGGGGG - Intronic
1180801591 22:18634490-18634512 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180852834 22:19030029-19030051 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180871626 22:19150049-19150071 GCCCGCAGGGCGCCGCGCGGGGG + Exonic
1181312531 22:21952888-21952910 GGGCGCCGCGGGCGCCGCGCAGG + Intergenic
1181786852 22:25233451-25233473 GGCCACCGGAGGCCCGGGGGTGG - Intergenic
1181817298 22:25448146-25448168 CGCCTCAGGGGGCACCGCGGCGG + Intergenic
1181941902 22:26484028-26484050 GGCGCCCCGGGGCCCCGAGGCGG + Exonic
1182603995 22:31489563-31489585 GGGCGCCGGGGCGCCCGCAGGGG - Exonic
1182771778 22:32801646-32801668 GGCCCCCGGGGACCCCGCCTCGG - Intronic
1183427358 22:37746783-37746805 GGCGGCCAGGGGCCCCAGGGAGG + Intronic
1183524796 22:38316877-38316899 GGCCTCGGAGGGCCCAGCGGGGG + Intronic
1183540704 22:38427829-38427851 TGCGGCGGGGGGCCCGGCGGCGG - Exonic
1183601597 22:38843529-38843551 GCCCGTCGGGGGCCCAGCAGGGG - Exonic
1183683767 22:39350206-39350228 GGCCCCCGGCGGCGGCGCGGCGG + Intronic
1183702314 22:39457481-39457503 GGCCCCCGGGGTCCCCGGCGGGG - Exonic
1183710864 22:39502459-39502481 GGCCGCCGGCGGCTGGGCGGCGG + Intronic
1184034107 22:41910485-41910507 TGCAGCCGCGGGCCGCGCGGGGG + Exonic
1184620414 22:45672219-45672241 GGCGGCCGGGACTCCCGCGGCGG + Intronic
1184859094 22:47163154-47163176 GGCAGCCAGGGGCCGGGCGGGGG - Intronic
1184887481 22:47355264-47355286 GGCCACCGAGGTCCCCGAGGAGG - Intergenic
1185069068 22:48646498-48646520 GGCTGCTGGGGGCCCCTCTGTGG + Intronic
1185409489 22:50674531-50674553 GGCCGACGGGGCTCCGGCGGGGG + Intergenic
1203254946 22_KI270733v1_random:133413-133435 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
1203263002 22_KI270733v1_random:178492-178514 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
950316327 3:12004691-12004713 GGCGGTCGGGGGCGCCGCCGAGG - Exonic
951881405 3:27484204-27484226 GCGCGCCGGGGGCTCGGCGGCGG - Intronic
951907938 3:27722061-27722083 GGCCGCGGGGGCCCCTGCGCTGG + Exonic
954028825 3:47803482-47803504 CGCAGCCAGGGGCTCCGCGGAGG + Intronic
954386419 3:50246352-50246374 GGCTGCCGGGCGCCCCCTGGTGG + Intronic
954912505 3:54121774-54121796 GGATGCCGGGAGCCCCGCGCTGG + Intergenic
956675041 3:71725331-71725353 GGCCGCCGCGCCCCCCGCCGGGG - Exonic
956678029 3:71753683-71753705 GGCGGCGGCGGGCCCGGCGGGGG + Intronic
956813556 3:72888080-72888102 GGCCGGCGGGCGGCCGGCGGCGG - Exonic
956979051 3:74614874-74614896 CGCCGCCCAGGGCCCTGCGGAGG - Intergenic
961299823 3:125915689-125915711 GCCCGCCGCTGGCCCCGCGTCGG + Intergenic
961359361 3:126357332-126357354 GGCGGCCGGGGGCCGAGCCGCGG + Exonic
962808879 3:138945718-138945740 GGGCGCCGGGGGCGCGGCGGTGG + Exonic
962814840 3:138988476-138988498 GGGTGCCGGGGGCCACACGGAGG - Intergenic
963904490 3:150762745-150762767 GGCGGCCGGGGGCGCAGCCGGGG + Exonic
966866391 3:184261050-184261072 GGCAGCCGGGGGGCGCCCGGCGG + Intronic
967858253 3:194134269-194134291 CGCCGCCGGGTGCCACGTGGCGG - Intergenic
968541577 4:1170950-1170972 GGCCGCTATGGCCCCCGCGGTGG - Intronic
969428561 4:7139770-7139792 GGCAGCCGGAGGCCCTGCCGAGG - Intergenic
969715869 4:8867837-8867859 GGTGGCCGGGGGCCCAGCGGCGG + Exonic
970456265 4:16226719-16226741 GGCCGGCCGGGGCACCGCGCCGG + Intronic
972960459 4:44447475-44447497 CCCCGCTGGAGGCCCCGCGGGGG - Intronic
975818123 4:78241008-78241030 GGCCACCGGTGGCCACGCTGAGG + Intronic
979785624 4:124712620-124712642 AGCCGCCGGGGGCCAAGAGGAGG - Exonic
981617289 4:146655171-146655193 GCCCTCCGGGGGCCCCTCTGGGG + Intergenic
981621147 4:146700107-146700129 GGCGGCCGGGGGCGGGGCGGAGG - Intergenic
984778749 4:183505515-183505537 GGCCCTCCGTGGCCCCGCGGTGG + Intronic
984811097 4:183797361-183797383 GGCGCCCAGCGGCCCCGCGGGGG - Intergenic
984811313 4:183798143-183798165 GCCCGCCGCGGGCACCGCCGAGG + Intergenic
985629852 5:1008744-1008766 GGCCGCCGGGGGCGCTGCGGGGG + Intergenic
985645842 5:1084393-1084415 CGCCGCCGAGGGCCTCGGGGAGG - Intronic
985688505 5:1294546-1294568 GGCCCGCGGGGGCCCCCCCGAGG - Exonic
985763498 5:1764235-1764257 GTCCTCCTGGGGCCCCACGGAGG - Intergenic
986330694 5:6714189-6714211 GGGCGGCGGGGGCGACGCGGCGG - Intergenic
989102281 5:37834605-37834627 GTCCGCCGGCGGCCCCCCCGCGG + Intronic
989229882 5:39074080-39074102 GGGCGCCGCGGGCGCCGCGAGGG - Intronic
990381956 5:55227450-55227472 GGCGGGCCGGGGCCCCGCGCTGG - Intergenic
992052803 5:72956357-72956379 GGTGGCCGGCGGCCCCGCTGCGG - Intronic
992550157 5:77852033-77852055 CGCCGCCGCGGGCACCGCCGGGG + Intronic
997265166 5:132490976-132490998 GGCCCGCGGTGGCCCCGGGGCGG - Intergenic
997899637 5:137753459-137753481 GGCGGCCGGGGGCGCGGCGGTGG - Exonic
998283006 5:140830143-140830165 GGGCGCCGCGGGCCCAGAGGCGG + Exonic
998517706 5:142770709-142770731 GGCGGCCCGGGCCCCGGCGGAGG + Exonic
1001579677 5:172790104-172790126 GGAGGCCGGGGGCCCCTCGAGGG + Intergenic
1001823042 5:174724746-174724768 GGGCGCCGAGGGGGCCGCGGAGG + Exonic
1002140288 5:177133735-177133757 GGCCGCGGGGGCGCGCGCGGTGG + Intronic
1002349921 5:178576746-178576768 GGTCGCCGGGGGACCCGTTGGGG - Intronic
1002929645 6:1624422-1624444 TGCAGCCCGGGGCCCCGCAGCGG + Intronic
1006334037 6:33411180-33411202 GGCCGCCGGGAGCCGGGCAGGGG - Exonic
1007082146 6:39115153-39115175 GGCCGGCGCGGGCCGAGCGGAGG - Exonic
1007473315 6:42104518-42104540 CGCCGCCCGGGGCGCCGCGGAGG - Exonic
1009437538 6:63635709-63635731 TGCAGCCCGGGGCCCCACGGAGG + Intergenic
1010032811 6:71288565-71288587 GGCCGCCGGGGGCCGCGTGAAGG + Intergenic
1011517136 6:88166598-88166620 GGCCTCCGGGAGCGCGGCGGCGG - Intergenic
1011640386 6:89412019-89412041 GGACGGCGGGGGTCCCGGGGTGG + Exonic
1012912902 6:105137234-105137256 GCCCGCCGGGGGGCGCGGGGCGG - Intergenic
1013170808 6:107634973-107634995 GGCCGCCTCGGGGCCCGCCGGGG - Exonic
1013793606 6:113860165-113860187 GGCCGCCGGGGGCGCAGCTGCGG + Exonic
1014272534 6:119349844-119349866 CGCCGCCCAGGGTCCCGCGGGGG + Intergenic
1015497036 6:133892969-133892991 GGCCGCCGCGGGCTGCGCTGGGG - Exonic
1015525968 6:134175516-134175538 CGCCGCCGCCGGCCCCGCTGGGG - Intronic
1015785971 6:136922029-136922051 GGCGGCTGGGCGCCCCGGGGCGG - Intergenic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1017311473 6:152982467-152982489 CACCGCCGGGGGCCCCGGGGTGG + Intronic
1017738216 6:157381927-157381949 GGCGGCCGGGCGGCCGGCGGCGG + Exonic
1017764053 6:157592807-157592829 GGAGGCCGGGGTCCCAGCGGAGG + Intronic
1018613212 6:165662676-165662698 GGCCGGCGGGGGGAGCGCGGCGG - Intronic
1018941250 6:168310013-168310035 GGCCTCCGTGGGCCACGTGGTGG - Intronic
1019164020 6:170087360-170087382 GGGACCCGGAGGCCCCGCGGTGG + Intergenic
1019164196 6:170087785-170087807 GGGACCCGGAGGCCCCGCGGTGG + Intergenic
1019404587 7:876928-876950 GGCCGCGGGTCGCCCGGCGGAGG + Intronic
1019410201 7:903555-903577 GGCTGCAGGGGGCGCAGCGGTGG - Intronic
1019527633 7:1487831-1487853 GGCCGCCAGGTGCCCCTCGAAGG + Exonic
1019540643 7:1549682-1549704 GGTCCCCTGGGGCCCAGCGGTGG - Intronic
1019689628 7:2403503-2403525 GGCCGCCGGAGGGGCCACGGAGG - Intergenic
1020106359 7:5423943-5423965 GGCGGCCGGGGGCCGGGCTGGGG - Intronic
1020204523 7:6104858-6104880 GGCCGCCGGGGGGCGCGCCAGGG - Intergenic
1020281532 7:6652594-6652616 GGCCGGCGGGGCCACTGCGGCGG - Exonic
1021845281 7:24757404-24757426 GGCTGCCGGGGACCCAGCAGCGG - Intronic
1022103818 7:27184629-27184651 GGCCGCCGGGGGCCCCTTCTCGG + Exonic
1022427948 7:30285537-30285559 CGCCTCCGGCGGCGCCGCGGCGG + Exonic
1023029279 7:36078847-36078869 GGTCCCCGGGGGCCCTGGGGTGG - Intergenic
1027025897 7:74851445-74851467 GGCGGCCGAGAGCCCCGCGCGGG + Exonic
1027061860 7:75092665-75092687 GGCGGCCGGGAGCCCCGCGCGGG - Exonic
1029537826 7:101166388-101166410 GGCCGAAGGGGGCACAGCGGGGG - Intergenic
1029549975 7:101232504-101232526 GGCCGCCGGGCGCTGCGGGGAGG + Exonic
1029640193 7:101815727-101815749 GGTCGCCGGTCGGCCCGCGGAGG + Intergenic
1029640316 7:101816153-101816175 CTCCGCCGGGGGCCCCGGGCTGG + Intronic
1029640330 7:101816179-101816201 AGCCGCCGGGGGGCCCGCGGCGG + Intronic
1029640331 7:101816181-101816203 CGCCGCCGCGGGCCCCCCGGCGG - Intronic
1029715137 7:102321560-102321582 GGCCTCCGGGGGCTCCTCGGCGG - Exonic
1032078354 7:128846631-128846653 GGCCGCTGGGGACCCAGCTGAGG - Intronic
1032441433 7:131945625-131945647 GGCTGCCTGGGGACCCGCGCGGG + Intergenic
1033099841 7:138460602-138460624 GGCCTCCGGGGGGCCCTCGGCGG + Exonic
1033099842 7:138460604-138460626 CGCCGCCGAGGGCCCCCCGGAGG - Exonic
1033477211 7:141702257-141702279 CGCTGCCCGGGGCCCCGCCGCGG + Intergenic
1034342812 7:150368967-150368989 GGCCCCCCGCGGGCCCGCGGTGG - Intronic
1034347648 7:150397197-150397219 TGCAGCCGGGGCCGCCGCGGGGG + Exonic
1036173114 8:6509458-6509480 TTCCGCAGGGGGCCCCGGGGGGG + Intronic
1036723623 8:11200682-11200704 GGCCACCGCGGGCCGCGCCGTGG + Exonic
1036786764 8:11692904-11692926 AGCCGCCTGGGGTTCCGCGGCGG + Intronic
1038008821 8:23457657-23457679 TGCCGGCGGGGGCCGGGCGGGGG - Exonic
1038537088 8:28361032-28361054 GGCAGCCGAGGGCCCCTCCGAGG + Exonic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1039595520 8:38787341-38787363 GGCCGCAGCGGGCCCCGCGCCGG - Exonic
1039936637 8:42051783-42051805 GGCCGCTGCAGGCCCCGCCGCGG - Intronic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1045815165 8:106270316-106270338 AGCGGCGGCGGGCCCCGCGGCGG - Intronic
1047235904 8:123041913-123041935 GGCCCCAGGAGGCCCAGCGGCGG - Intronic
1047732038 8:127736097-127736119 GGACGGCCGGGGCCCGGCGGTGG - Exonic
1048303185 8:133266188-133266210 AGAAGCCTGGGGCCCCGCGGAGG - Intronic
1048833446 8:138497327-138497349 GGCCGCCGGGCGGCCCGCCCCGG - Intergenic
1049552446 8:143266911-143266933 GGGCGCTGGGGCCCCCGCGAGGG + Intronic
1049585595 8:143431099-143431121 GTCCGCCTCGGGCCACGCGGCGG + Intergenic
1049621109 8:143598671-143598693 GGGCGCAGGGGACCCCGGGGCGG + Exonic
1049755919 8:144311268-144311290 GGCCGGCGGGGGCCCCACAAGGG + Intronic
1049850438 8:144827496-144827518 GGCCGCCCTGGGCCGCTCGGAGG - Intronic
1049896154 9:113590-113612 GCCCGCAGGGAGCCCCGGGGAGG + Intergenic
1049936275 9:504459-504481 GGACGCCCGGCTCCCCGCGGGGG - Intronic
1053555531 9:39133064-39133086 GCCCGCTGGGGGCACCTCGGAGG + Exonic
1053819646 9:41953315-41953337 GCCCGCTGGGGGCACCTCGGAGG + Exonic
1054285398 9:63163645-63163667 GGCCGCTGGGGAGCCCACGGGGG + Intergenic
1054389422 9:64601378-64601400 GGCCGCTGGGGAGCCCACGGGGG - Intergenic
1056746780 9:89310515-89310537 GGGCGCCAGGAGCCCCGCGACGG + Intergenic
1057600046 9:96450119-96450141 GGACGGCGGCGGCGCCGCGGGGG + Intergenic
1057665235 9:97039343-97039365 GGCGCCCGGGGGCTGCGCGGAGG + Intronic
1057708079 9:97412158-97412180 CTCCGCCAGGGGCCCCGCCGCGG - Exonic
1057759006 9:97857875-97857897 GGCCGCCCGCGACCCCGCTGTGG - Intergenic
1059375216 9:113876124-113876146 GGGCGGCGGCGGCCCCGCGAGGG + Intergenic
1061128318 9:128690085-128690107 GGGTGCCGGGGGCGCCGCCGCGG - Intronic
1061242680 9:129383525-129383547 GCCCGCTGGGGGCCTCGCGCGGG + Intergenic
1061257403 9:129460638-129460660 GGCCGCCGCGGGCCCGGCTCCGG + Intergenic
1061293593 9:129665835-129665857 GGCCCCGGGGGGGCCGGCGGGGG - Exonic
1061415523 9:130445081-130445103 GCCCGCCCCGGGGCCCGCGGAGG + Intronic
1061415525 9:130445083-130445105 TGCCTCCGCGGGCCCCGGGGCGG - Intronic
1061559680 9:131394354-131394376 GGCCCCCGGGCCCCCGGCGGCGG - Intronic
1061672161 9:132194794-132194816 GGCTGCCTGGGGCTCCTCGGTGG - Intronic
1061972689 9:134053433-134053455 GGTCGCCGGGATCCCCGCGGGGG + Exonic
1062269489 9:135702070-135702092 GGCCGCGCCGGGACCCGCGGCGG - Intergenic
1062372188 9:136245703-136245725 GGCAGCCGTGCGGCCCGCGGCGG + Exonic
1062469478 9:136696290-136696312 GGGCGCCCGGGGCCCCTCGGCGG - Intergenic
1062472458 9:136712494-136712516 GGCCGACGGCGGCGCGGCGGGGG - Intergenic
1062499520 9:136846271-136846293 GGGCTCCGGGGCCCCCGCGCTGG + Exonic
1062538481 9:137031257-137031279 GGCCGCCTGGAGCCCCACTGGGG - Exonic
1202800299 9_KI270719v1_random:169766-169788 GCGCGCCGGGGGCACCGCGAGGG - Intergenic
1203769174 EBV:40341-40363 AGCCACCAGGGGCCCGGCGGGGG + Intergenic
1203791184 EBV:152594-152616 GGCCACCAGGGTCCCCACGGTGG + Intergenic
1203471348 Un_GL000220v1:116559-116581 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
1203479169 Un_GL000220v1:160531-160553 GGCACCCGGGGGGCCGGCGGCGG + Intergenic
1186463348 X:9765620-9765642 GGCCGGCGGGGACGTCGCGGGGG + Exonic
1186514727 X:10158578-10158600 CGCTGCCGGGGGCGCCGGGGAGG - Intronic
1187225846 X:17375144-17375166 GGGCGCAGGAGGCCGCGCGGGGG - Intergenic
1187464519 X:19515401-19515423 GCGCACCGGGGACCCCGCGGCGG + Intergenic
1187915407 X:24149342-24149364 GGCCGACCGCGGCCCCGCGCGGG + Intronic
1190337242 X:49269955-49269977 AGGCGGCGGTGGCCCCGCGGAGG + Exonic
1195072081 X:101291142-101291164 GGCTGCGGGGTGCACCGCGGCGG + Intronic
1195954880 X:110318153-110318175 GGCCGCCGGGGGCGCGCCAGAGG + Exonic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic
1200277864 X:154751164-154751186 GGCCGCCGCGGCCCCCGGGGAGG + Intronic