ID: 1175847306

View in Genome Browser
Species Human (GRCh38)
Location 20:62065555-62065577
Sequence CGCCGAGGGCGCGCCCGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175847306_1175847316 2 Left 1175847306 20:62065555-62065577 CCGCTCCGGGCGCGCCCTCGGCG 0: 1
1: 0
2: 2
3: 30
4: 161
Right 1175847316 20:62065580-62065602 GGCGGCCGGCCCTGCGCCCGCGG 0: 1
1: 1
2: 2
3: 35
4: 312
1175847306_1175847318 8 Left 1175847306 20:62065555-62065577 CCGCTCCGGGCGCGCCCTCGGCG 0: 1
1: 0
2: 2
3: 30
4: 161
Right 1175847318 20:62065586-62065608 CGGCCCTGCGCCCGCGGCTCCGG 0: 1
1: 0
2: 0
3: 19
4: 251
1175847306_1175847321 12 Left 1175847306 20:62065555-62065577 CCGCTCCGGGCGCGCCCTCGGCG 0: 1
1: 0
2: 2
3: 30
4: 161
Right 1175847321 20:62065590-62065612 CCTGCGCCCGCGGCTCCGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 313
1175847306_1175847322 13 Left 1175847306 20:62065555-62065577 CCGCTCCGGGCGCGCCCTCGGCG 0: 1
1: 0
2: 2
3: 30
4: 161
Right 1175847322 20:62065591-62065613 CTGCGCCCGCGGCTCCGGCCGGG 0: 1
1: 0
2: 7
3: 35
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175847306 Original CRISPR CGCCGAGGGCGCGCCCGGAG CGG (reversed) Exonic
900549629 1:3247754-3247776 CGCCCAGGGCGCACCAGGACGGG - Intronic
901242864 1:7704952-7704974 CGGCGGGGGCGCGCGCGGGGCGG + Intronic
901433885 1:9234728-9234750 CGGCGGGGGCGCGCGCGGCGGGG - Intergenic
901433891 1:9234743-9234765 GGCCGGGGGCGCGCGCGGCGGGG - Intergenic
901465262 1:9417269-9417291 GGCCGAGGGCTTGGCCGGAGGGG + Intergenic
901641372 1:10694699-10694721 CGGCGCGGGCGCGCGCGGCGGGG - Intronic
903078036 1:20787086-20787108 CGCCGACGCCGCTCCCAGAGAGG - Intronic
903750416 1:25617489-25617511 CGGGGAGGGCTCGGCCGGAGGGG + Exonic
904050215 1:27634306-27634328 CGCGGAGGGGGCGCCCGGAGAGG + Intronic
904611993 1:31731040-31731062 CCCCCAGGGCCCGGCCGGAGGGG - Exonic
904724981 1:32539953-32539975 CGCCGCGGGGGCGCGCGGGGAGG + Intronic
905307788 1:37031549-37031571 CGCCGAGCACCAGCCCGGAGAGG - Intronic
905647291 1:39633317-39633339 CGCAGAGGGAAGGCCCGGAGTGG - Intronic
905892433 1:41525849-41525871 GGCAGGGGGCGCGCCAGGAGAGG + Intronic
906140353 1:43530804-43530826 CGCCGGGGGCGCGCACGGCAGGG + Intronic
915497357 1:156291600-156291622 CTCCGAGGGCGAGGGCGGAGAGG - Exonic
915586910 1:156848893-156848915 TGCCGGGGGCGGGGCCGGAGCGG - Intronic
918114134 1:181482687-181482709 CGCCGAGGGCGCTGCCTGCGGGG + Intronic
922119036 1:222644234-222644256 CGGCGAGGGCGGGGCCAGAGCGG - Intronic
922821255 1:228487360-228487382 CGCCGGGGACGCGCACGGGGCGG - Exonic
924188232 1:241519316-241519338 CTCCGAGGAGGCGCCGGGAGCGG + Intronic
1063450020 10:6144973-6144995 CGCCGGGGGCGCTCCCCGCGGGG - Intronic
1063907815 10:10798730-10798752 GGCTGAGGGCGAGTCCGGAGAGG - Intergenic
1065099739 10:22321337-22321359 GGGGGAGGGCGCGCGCGGAGGGG - Exonic
1069557869 10:69409174-69409196 CGCCCAGGGTGGGCCCGCAGGGG - Intronic
1070140306 10:73733339-73733361 CCCCGAGGGCGCGCAGGGGGCGG + Intergenic
1072656595 10:97334369-97334391 CCCCGGGGGCGCGCACGGCGAGG + Exonic
1073196394 10:101695039-101695061 CGGCGAGGGCGAGGGCGGAGAGG - Exonic
1073241962 10:102065195-102065217 CGCCGAGAGCGTGCCCGGGCGGG + Intergenic
1076554356 10:131311954-131311976 GGCCGAGGGCGCGCCCGGCTGGG + Intergenic
1076879103 10:133231216-133231238 CGACGGGGGCGCGGCCGGAGGGG - Exonic
1078057541 11:8019677-8019699 CGCGGAGGGGGCGCCGGGAGGGG + Intronic
1079076658 11:17388933-17388955 CGGCGGGGGCGCTCCGGGAGGGG - Intronic
1080389009 11:31826997-31827019 CGGCGAGGAGGCGCCGGGAGCGG - Intronic
1083419752 11:62546187-62546209 AGCCGAGGGGGCGCACGGTGCGG + Intronic
1084180547 11:67443543-67443565 GGCCGAGGTCACGCGCGGAGGGG + Intronic
1084296206 11:68214389-68214411 CGCGCAGGGCACACCCGGAGTGG - Intergenic
1084891741 11:72240123-72240145 CGCCAAGGGCGCGGCGGGCGCGG - Exonic
1085037180 11:73307722-73307744 CGCAGAGGGCGGGCGGGGAGGGG + Intergenic
1088172925 11:107018170-107018192 CGCTGCGGTCGCGCCCGGCGGGG + Exonic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1095440819 12:42237834-42237856 CGCCGAGGGCCCGCGGGGCGGGG - Intronic
1096435907 12:51591094-51591116 GGCAGGGGGCGCGCGCGGAGGGG + Intronic
1097035030 12:56118340-56118362 GGTGGAGGCCGCGCCCGGAGGGG + Intronic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1103413032 12:120726036-120726058 GGCCGTGAGCGCTCCCGGAGTGG - Intronic
1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG + Intronic
1107359451 13:39603100-39603122 CGCCGCGGACTCGCCGGGAGTGG - Exonic
1112402470 13:99087672-99087694 CGGAGAGGGCGCGCCAGGCGGGG + Intergenic
1113254828 13:108495641-108495663 CGCGGGGGGCGCGCGGGGAGGGG + Intergenic
1113737750 13:112690301-112690323 CGCCGAGGCCGTGACCGGAGCGG + Intergenic
1113768405 13:112894506-112894528 CGTCGCGGTCGCTCCCGGAGCGG + Intronic
1118925825 14:70188930-70188952 CGCAGAGGGGACGCGCGGAGAGG + Exonic
1122137865 14:99645140-99645162 CGCCGCGAGCGCCCCGGGAGGGG + Exonic
1123024875 14:105419857-105419879 CGCCGAGGCCGCGCAGGGACGGG - Exonic
1126113266 15:45187688-45187710 CGCGGGGGGCGCGGCCGGAGAGG + Intronic
1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG + Exonic
1127103365 15:55588637-55588659 CGGCGAGGGAGCGCCGGGCGCGG - Intronic
1127867183 15:63042494-63042516 CGCCGAGGCGGCGGCCGGAGAGG - Intergenic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129644835 15:77420215-77420237 GGGCGAGGGCGCGCGCGGAGGGG - Intergenic
1129710747 15:77819270-77819292 CGCGGACGGCGCGCCCGGGACGG - Intronic
1129790982 15:78340508-78340530 TGCAGAGGGCGCGCCCCGACGGG + Intronic
1131054415 15:89367294-89367316 GGCCGAGAGCGCTCACGGAGAGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131473355 15:92714919-92714941 CGCCAAAGGGGCGCCCGGGGCGG - Intronic
1132915201 16:2340374-2340396 AGCCGAGGCCGCGGCAGGAGGGG + Intronic
1132915212 16:2340398-2340420 GGGCGCGGGCGCGGCCGGAGGGG + Intronic
1134290792 16:12901824-12901846 CGCCGAGGGGCCGGCCGGGGAGG - Exonic
1136625419 16:31459146-31459168 CGCCGAGTGCACGCCGGGGGCGG + Exonic
1137683317 16:50369105-50369127 GGCCGAGGGCGGGGCCGGGGCGG + Intergenic
1139775062 16:69311650-69311672 CGGCGAGGGGGCGGCCGGAGCGG - Intronic
1141686556 16:85573694-85573716 CACAGTGGGCGCGTCCGGAGGGG + Intergenic
1141828121 16:86494993-86495015 CGCCGAGGGCGCGGAGGGAGCGG + Intergenic
1141972142 16:87491704-87491726 CGGCAAGGGCGCGCCCGGGCCGG - Exonic
1143493393 17:7296551-7296573 GGCAGAGGGCGCGCCGGGACCGG - Intergenic
1143528187 17:7484375-7484397 CGCCGAGAGCGCGGCCGGGACGG + Exonic
1144756201 17:17681904-17681926 CGCCGAGCGCGCGCGCTGGGTGG + Intronic
1146281967 17:31550350-31550372 CGGCGAGGGCGCACGCGGCGCGG - Intergenic
1147110466 17:38257434-38257456 GGACGAGGGCGCGGCCGGCGGGG + Intergenic
1147450592 17:40501676-40501698 CGTGCAGGGCCCGCCCGGAGGGG - Intergenic
1148419041 17:47530997-47531019 GGACGAGGGCGCGGCCGGCGGGG - Intronic
1148542628 17:48492618-48492640 GGACGAAGGCGCGCCCGGAGAGG + Intergenic
1148664104 17:49361933-49361955 CGCCGAGGCGGCGGCCGGGGCGG - Intronic
1150311169 17:64130270-64130292 GGCCGAGGGCGTGCCCCGGGCGG + Intronic
1152293622 17:79454388-79454410 CGCAGAGGGCAGGCCAGGAGGGG - Intronic
1152352098 17:79789887-79789909 CGCAGAGGGGGCGCCCGTGGCGG + Intergenic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1153911464 18:9709015-9709037 AGCCGAGGGCGCGGCCGGGGTGG + Intronic
1160663419 19:312029-312051 CGCCCAGGGCGGGGCCGCAGCGG + Intronic
1160663439 19:312086-312108 CGCCCAGGGCGGGGCCGCAGCGG + Intronic
1160831942 19:1108315-1108337 CTCCGAGGGCGCGCTGGGGGAGG - Exonic
1160967708 19:1753854-1753876 CGCCGGGGGCGCGGGCGGCGCGG + Exonic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1162520814 19:11178434-11178456 TGCCGGGGGCCCGCCTGGAGGGG + Exonic
1162733824 19:12734695-12734717 CGCCAAGCGCGGGGCCGGAGCGG - Exonic
1163433465 19:17281993-17282015 GGCCGGGGGCGGGCCAGGAGTGG + Intronic
1163579892 19:18132076-18132098 CGCGGAGGGCGGGGCCAGAGAGG + Intronic
1163607041 19:18281241-18281263 CGCCGACGGCGCCCCCAGCGCGG - Exonic
1164639331 19:29812557-29812579 TGCCGAGGGAGCGCAGGGAGCGG + Exonic
1164713479 19:30375446-30375468 GGCCGGGGGCGCGCCCGGGTCGG - Intronic
1166100389 19:40568111-40568133 CGCGGAGGCGGCGGCCGGAGCGG + Exonic
1167001206 19:46746518-46746540 CACCGCGCGCGCGCCCGGCGGGG + Exonic
1167258394 19:48443984-48444006 GCCCGAGGGGGCGCCCGCAGTGG + Exonic
1167445287 19:49533881-49533903 GGCCGAGGGCGGGGCCGGCGCGG + Intronic
1167926075 19:52821753-52821775 CGCAGAGGGCGGGGCCGGAGCGG + Intronic
1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG + Intergenic
1168003475 19:53467609-53467631 CGCAGAGGGCGGGGCCGGGGTGG - Intergenic
926217118 2:10912404-10912426 CTGCGAGGGCGCGCGCGGGGAGG + Exonic
928983203 2:37156867-37156889 AGCCGAGGGAGCGCGGGGAGCGG - Intronic
929151230 2:38750914-38750936 CGCCGAGGGCGGGGGGGGAGGGG + Intronic
934079107 2:88452440-88452462 TGCCGGGGGGGCGCCCGGGGCGG + Exonic
936452885 2:112646337-112646359 CGCGGAGGGCGCGCGCGGGCTGG + Intronic
938344321 2:130556597-130556619 CACAGAGGAGGCGCCCGGAGTGG + Intergenic
938345512 2:130564125-130564147 CACAGAGGAGGCGCCCGGAGTGG - Intergenic
938397930 2:130964268-130964290 CGCGGAGGGCGCGTGCGGCGCGG - Intronic
940774966 2:157875949-157875971 GGCCGAGGGCCGGCCCAGAGCGG + Intergenic
942083937 2:172427493-172427515 GGCCGCGGGCGCGCAAGGAGGGG + Intronic
942451052 2:176108087-176108109 CGGCGAGGGCCCCCCGGGAGAGG + Exonic
944273134 2:197805102-197805124 GGCCGAGGGCGCGGCCGGCAGGG + Exonic
948368923 2:237475306-237475328 CGCCCAGGCCGCGCCCAGAATGG + Intergenic
1170889914 20:20368208-20368230 CGCCGGGGCCGAGCGCGGAGGGG + Exonic
1172284623 20:33732098-33732120 CTGCGAGGGCGCGGCGGGAGGGG - Intronic
1172661742 20:36573471-36573493 CGCCGACGGCCCGCCCCGCGGGG + Exonic
1173785816 20:45792108-45792130 CGGTGAGGGCGCCCCCGGTGAGG + Exonic
1173831261 20:46089972-46089994 GGCAGAGGGCGCGCACGTAGCGG + Intergenic
1175394644 20:58650259-58650281 GGCCCAGCGCGCGGCCGGAGCGG - Intergenic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1176005749 20:62861586-62861608 CGTCGAGGGCGCGGGCGGCGGGG - Exonic
1178673849 21:34614730-34614752 CCCCGACGGCCCGCCCGGCGCGG + Intronic
1178948504 21:36966939-36966961 CGCCGGGGCTGCACCCGGAGAGG + Intronic
1179494385 21:41762452-41762474 CGCCTAGGGAGCACCTGGAGAGG - Intronic
1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG + Exonic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180782402 22:18528615-18528637 CGGCGCGGGAGCGCGCGGAGCGG + Exonic
1181239291 22:21467950-21467972 CGGCGCGGGAGCGCGCGGAGCGG + Intergenic
1183903297 22:41022028-41022050 CGCCCAGGGCTGGGCCGGAGGGG + Intergenic
950316321 3:12004670-12004692 GGCCGAGGCGGCGCCCGGACCGG - Exonic
950584170 3:13880737-13880759 CGCCGCGAGCGCGCTCTGAGCGG - Intergenic
951544477 3:23810789-23810811 CGTCGGGGGCGCGCGCGGGGTGG + Intronic
954110198 3:48429299-48429321 CGCGGAGCCCGAGCCCGGAGCGG - Exonic
956989857 3:74751069-74751091 TGCCGAGGGCGAGCCAGGTGTGG + Intergenic
960896758 3:122514417-122514439 CGCCGAGGCAGCGGGCGGAGAGG - Intronic
961674317 3:128555531-128555553 TGCCGCGGACGCGCCCCGAGGGG - Intergenic
963236740 3:142963700-142963722 CGCCGCCGCCGCCCCCGGAGCGG + Intergenic
966181909 3:177196570-177196592 GGCCGGGGACGCGCCCGGGGAGG + Intronic
968620775 4:1602658-1602680 CGGGGAGGGGGCGCGCGGAGGGG - Intergenic
969487504 4:7480533-7480555 CGCCAAGGGGGCGACTGGAGGGG + Intronic
976390193 4:84498309-84498331 CGCCGAGGGCGCGAGCGGAGAGG + Exonic
976874494 4:89837041-89837063 CGCCCAGGACGCTCTCGGAGGGG + Intronic
986402940 5:7396582-7396604 GGCCGAGGGGCAGCCCGGAGCGG - Intronic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
991435889 5:66596750-66596772 GGCCGAGGAAGCACCCGGAGAGG - Exonic
992320791 5:75611640-75611662 GGCCCCGGGCGCGCCCGGCGGGG - Exonic
992400045 5:76403504-76403526 CGCGGGGGGCGCGCCCCGGGCGG + Exonic
996405463 5:123098899-123098921 CTCCAAGGGCGCGCCCGAAATGG - Intronic
1002368372 5:178730383-178730405 CGGCGAGGGAGCGCCCCGCGGGG + Intronic
1002712799 5:181205182-181205204 CGCCGAGGGCCCACTGGGAGAGG + Intronic
1004861086 6:19805092-19805114 CGCAGAGCGCGCGCCCGTGGGGG - Intergenic
1012450546 6:99349462-99349484 CGCGGAGGGCGCGGGCGGCGCGG + Exonic
1015244767 6:131063322-131063344 CGCCGGGGGCTCGTCCGGCGGGG - Exonic
1019537522 7:1537074-1537096 AGCCGGGGGCGCCCCAGGAGGGG - Intronic
1019562500 7:1665660-1665682 CGCGGCGGGGGCGACCGGAGGGG - Intergenic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1019712934 7:2525602-2525624 CGCGGAGCGCACACCCGGAGTGG + Intronic
1022096385 7:27144064-27144086 TGCCGATCGCGCGCCCGGCGAGG + Intronic
1023255819 7:38311425-38311447 GGCAGAGGGCGCGGCGGGAGGGG - Intergenic
1028417634 7:90596547-90596569 CGGCGAGGGCGCGCGCCGCGGGG - Intronic
1034347651 7:150397209-150397231 CGCCGCGGGGGCGCCCCGAGTGG + Exonic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1037825300 8:22156817-22156839 CGGCGGGGGCGCGCGCGGGGCGG + Exonic
1045173719 8:99697729-99697751 GGCCTAGGGCGCGCCCGTAGGGG + Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1051418814 9:16870814-16870836 CGGCGAGGGCGCGCGCGGGCGGG - Intronic
1052807493 9:33025646-33025668 CCGCGGGGGCGCGCACGGAGGGG - Intronic
1053381215 9:37650927-37650949 CGCCGAGGCTGCAGCCGGAGGGG - Intronic
1055611592 9:78030963-78030985 GGCCGGGGGCGCGCCCGGGAGGG + Intronic
1057488621 9:95506064-95506086 CGCCTGGGCCGCGCCCCGAGAGG - Intronic
1061242707 9:129383638-129383660 CGCCGAGCGCGCGCCCAGCTTGG + Intergenic
1061382208 9:130265484-130265506 CGCCGATGGCGCGCCGGGGGCGG - Intergenic
1203760801 EBV:12417-12439 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203761730 EBV:15489-15511 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203762659 EBV:18561-18583 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203763588 EBV:21633-21655 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203764517 EBV:24705-24727 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203765446 EBV:27777-27799 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203766375 EBV:30849-30871 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203767304 EBV:33921-33943 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1189005099 X:36986343-36986365 CGGCGAGGGCGCGGCCTCAGAGG - Intergenic
1196707226 X:118727310-118727332 GGCCCAGGCAGCGCCCGGAGTGG + Intergenic
1198480220 X:137033921-137033943 CGCTGCGGGCGCGGCAGGAGCGG + Intergenic
1200239512 X:154486444-154486466 GGCCGAGGGCGGGCACGGGGCGG - Intronic
1200787545 Y:7273745-7273767 CGCCCGGGGCGCCCCCGGGGTGG - Intergenic