ID: 1175847522 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:62066272-62066294 |
| Sequence | GGCGGCGCTGACGGGAGCGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175847519_1175847522 | -10 | Left | 1175847519 | 20:62066259-62066281 | CCAAAATGGCTGCGGCGGCGCTG | No data | ||
| Right | 1175847522 | 20:62066272-62066294 | GGCGGCGCTGACGGGAGCGCCGG | No data | ||||
| 1175847515_1175847522 | 14 | Left | 1175847515 | 20:62066235-62066257 | CCTCGCTCTTTGTCTCGGCTCGC | No data | ||
| Right | 1175847522 | 20:62066272-62066294 | GGCGGCGCTGACGGGAGCGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175847522 | Original CRISPR | GGCGGCGCTGACGGGAGCGC CGG | Intergenic | ||