ID: 1175847522

View in Genome Browser
Species Human (GRCh38)
Location 20:62066272-62066294
Sequence GGCGGCGCTGACGGGAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175847519_1175847522 -10 Left 1175847519 20:62066259-62066281 CCAAAATGGCTGCGGCGGCGCTG No data
Right 1175847522 20:62066272-62066294 GGCGGCGCTGACGGGAGCGCCGG No data
1175847515_1175847522 14 Left 1175847515 20:62066235-62066257 CCTCGCTCTTTGTCTCGGCTCGC No data
Right 1175847522 20:62066272-62066294 GGCGGCGCTGACGGGAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175847522 Original CRISPR GGCGGCGCTGACGGGAGCGC CGG Intergenic