ID: 1175847594

View in Genome Browser
Species Human (GRCh38)
Location 20:62066480-62066502
Sequence GCTTCCCCGCGGCGGCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175847594_1175847600 -8 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847600 20:62066495-62066517 GGGGAAGCTGGGTCCGCCTCTGG No data
1175847594_1175847606 11 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847606 20:62066514-62066536 CTGGCTCAGCCGGTCCCGGGCGG No data
1175847594_1175847607 14 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847607 20:62066517-62066539 GCTCAGCCGGTCCCGGGCGGTGG No data
1175847594_1175847610 19 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847610 20:62066522-62066544 GCCGGTCCCGGGCGGTGGGGAGG No data
1175847594_1175847613 21 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847613 20:62066524-62066546 CGGTCCCGGGCGGTGGGGAGGGG No data
1175847594_1175847608 15 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847608 20:62066518-62066540 CTCAGCCGGTCCCGGGCGGTGGG No data
1175847594_1175847601 1 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847601 20:62066504-62066526 GGGTCCGCCTCTGGCTCAGCCGG No data
1175847594_1175847603 7 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847603 20:62066510-62066532 GCCTCTGGCTCAGCCGGTCCCGG No data
1175847594_1175847612 20 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847612 20:62066523-62066545 CCGGTCCCGGGCGGTGGGGAGGG No data
1175847594_1175847605 8 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847605 20:62066511-62066533 CCTCTGGCTCAGCCGGTCCCGGG No data
1175847594_1175847609 16 Left 1175847594 20:62066480-62066502 CCTCCAAGCCGCCGCGGGGAAGC No data
Right 1175847609 20:62066519-62066541 TCAGCCGGTCCCGGGCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175847594 Original CRISPR GCTTCCCCGCGGCGGCTTGG AGG (reversed) Intergenic
No off target data available for this crispr