ID: 1175849362

View in Genome Browser
Species Human (GRCh38)
Location 20:62080406-62080428
Sequence GTGAGAGAGCTCACTCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175849352_1175849362 19 Left 1175849352 20:62080364-62080386 CCCCATGATCCAATTACCTCCAC No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849358_1175849362 0 Left 1175849358 20:62080383-62080405 CCACCTGGTCCCACTCTTGATAC No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849354_1175849362 17 Left 1175849354 20:62080366-62080388 CCATGATCCAATTACCTCCACCT No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849360_1175849362 -9 Left 1175849360 20:62080392-62080414 CCCACTCTTGATACGTGAGAGAG No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849357_1175849362 3 Left 1175849357 20:62080380-62080402 CCTCCACCTGGTCCCACTCTTGA No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849351_1175849362 20 Left 1175849351 20:62080363-62080385 CCCCCATGATCCAATTACCTCCA No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849359_1175849362 -3 Left 1175849359 20:62080386-62080408 CCTGGTCCCACTCTTGATACGTG No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849350_1175849362 23 Left 1175849350 20:62080360-62080382 CCACCCCCATGATCCAATTACCT No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849361_1175849362 -10 Left 1175849361 20:62080393-62080415 CCACTCTTGATACGTGAGAGAGC No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849353_1175849362 18 Left 1175849353 20:62080365-62080387 CCCATGATCCAATTACCTCCACC No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data
1175849356_1175849362 10 Left 1175849356 20:62080373-62080395 CCAATTACCTCCACCTGGTCCCA No data
Right 1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175849362 Original CRISPR GTGAGAGAGCTCACTCACTG CGG Intergenic