ID: 1175849766

View in Genome Browser
Species Human (GRCh38)
Location 20:62083552-62083574
Sequence AGAGAGAAGGAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175849766_1175849772 20 Left 1175849766 20:62083552-62083574 CCCTCCTCTTTCTCCTTCTCTCT No data
Right 1175849772 20:62083595-62083617 CTCTCCCTCTCTCCTGCTTCCGG No data
1175849766_1175849776 26 Left 1175849766 20:62083552-62083574 CCCTCCTCTTTCTCCTTCTCTCT No data
Right 1175849776 20:62083601-62083623 CTCTCTCCTGCTTCCGGATTGGG No data
1175849766_1175849775 25 Left 1175849766 20:62083552-62083574 CCCTCCTCTTTCTCCTTCTCTCT No data
Right 1175849775 20:62083600-62083622 CCTCTCTCCTGCTTCCGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175849766 Original CRISPR AGAGAGAAGGAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr