ID: 1175851029

View in Genome Browser
Species Human (GRCh38)
Location 20:62093093-62093115
Sequence CCCCTGCCCAGCAGAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175851025_1175851029 -10 Left 1175851025 20:62093080-62093102 CCATGGGGGCCTGCCCCTGCCCA No data
Right 1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG No data
1175851024_1175851029 -4 Left 1175851024 20:62093074-62093096 CCGAAGCCATGGGGGCCTGCCCC No data
Right 1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG No data
1175851017_1175851029 11 Left 1175851017 20:62093059-62093081 CCAGATGACCTTTGCCCGAAGCC No data
Right 1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG No data
1175851016_1175851029 27 Left 1175851016 20:62093043-62093065 CCTCACTTTCGGCAGACCAGATG No data
Right 1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG No data
1175851022_1175851029 3 Left 1175851022 20:62093067-62093089 CCTTTGCCCGAAGCCATGGGGGC No data
Right 1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG No data
1175851023_1175851029 -3 Left 1175851023 20:62093073-62093095 CCCGAAGCCATGGGGGCCTGCCC No data
Right 1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175851029 Original CRISPR CCCCTGCCCAGCAGAGCCCT GGG Intergenic
No off target data available for this crispr