ID: 1175855491

View in Genome Browser
Species Human (GRCh38)
Location 20:62118750-62118772
Sequence TGCTAGGAGGACTTCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175855491_1175855497 4 Left 1175855491 20:62118750-62118772 CCTGCCCGGAAGTCCTCCTAGCA No data
Right 1175855497 20:62118777-62118799 TGGCCCTGAGCCTCCCCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175855491 Original CRISPR TGCTAGGAGGACTTCCGGGC AGG (reversed) Intergenic