ID: 1175856518

View in Genome Browser
Species Human (GRCh38)
Location 20:62123284-62123306
Sequence GCGAATCCTGCAAGCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175856510_1175856518 15 Left 1175856510 20:62123246-62123268 CCGGCGTCTCCCGAAGGCTGGGG 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 71
1175856517_1175856518 5 Left 1175856517 20:62123256-62123278 CCGAAGGCTGGGGGTGGGGTCAC 0: 1
1: 1
2: 5
3: 96
4: 533
Right 1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 71
1175856505_1175856518 23 Left 1175856505 20:62123238-62123260 CCAGTGTCCCGGCGTCTCCCGAA 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 71
1175856508_1175856518 16 Left 1175856508 20:62123245-62123267 CCCGGCGTCTCCCGAAGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 71
1175856516_1175856518 6 Left 1175856516 20:62123255-62123277 CCCGAAGGCTGGGGGTGGGGTCA 0: 1
1: 0
2: 6
3: 55
4: 658
Right 1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175856518 Original CRISPR GCGAATCCTGCAAGCCTTTC TGG Intronic
906658304 1:47564702-47564724 AGAAAGCCTGCAAGCCTTTCTGG + Intergenic
907264521 1:53249293-53249315 GCCAATCCTAGAAGGCTTTCTGG - Intronic
915493832 1:156267117-156267139 GGCAATTCTGGAAGCCTTTCTGG - Intronic
918052405 1:180985880-180985902 CTGAATCCTGCAAGGCTGTCAGG - Intronic
918151176 1:181799203-181799225 GAGAAGCCTGGAAGACTTTCTGG + Intronic
1070649528 10:78224916-78224938 GCTAGTCCTGAAAGCCTCTCTGG + Intergenic
1072231975 10:93421575-93421597 GAGAAGCCACCAAGCCTTTCAGG - Intronic
1072944885 10:99800786-99800808 GAGAAGCCTGCAAGCTGTTCTGG + Intronic
1076297460 10:129397665-129397687 GCGGATCCTGCAGGACTTTGTGG - Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1083334804 11:61916484-61916506 GTGGATCCTGCCTGCCTTTCCGG + Intronic
1089143876 11:116310156-116310178 GCCCATCCTGGGAGCCTTTCAGG - Intergenic
1092901248 12:13061592-13061614 GCTAATCTTGTATGCCTTTCGGG + Exonic
1096753355 12:53777744-53777766 GCAAATCATGCAAGACTTTGTGG + Intergenic
1101281972 12:103267128-103267150 GTAAATCCTGCATGCCCTTCAGG + Intronic
1103147320 12:118606860-118606882 GGGATTCCTGCAATCATTTCGGG + Intergenic
1104541464 12:129669904-129669926 GCGACTCCTGCAGGCCTGGCTGG - Intronic
1118599387 14:67461110-67461132 GCCACTCCAGCAAGCATTTCTGG - Intronic
1120067321 14:80058218-80058240 GCTAATCCTATAAACCTTTCAGG - Intergenic
1120197963 14:81507000-81507022 GCTACTCCTGCACGCCCTTCAGG - Intronic
1135912779 16:26576755-26576777 GGGAATCCTTCAATCCATTCAGG - Intergenic
1136548964 16:30971650-30971672 GGGGAGCCTGCAACCCTTTCCGG - Exonic
1143196150 17:5077927-5077949 GTCACTCCTGCAAGCCCTTCCGG + Intergenic
1143780571 17:9226712-9226734 GCGATTCCTGCCAGCTTCTCAGG + Intronic
1144311249 17:14016131-14016153 CCCAATCCTGCAAGACTTGCTGG - Intergenic
1145017963 17:19411304-19411326 CCGCAGCCTGCTAGCCTTTCCGG + Exonic
1146184316 17:30715134-30715156 GTAAATCCTGCAAGCTTTGCGGG + Intergenic
1147192903 17:38747830-38747852 GCGCATCCCGCAAGCCCTCCCGG + Intronic
1161657168 19:5523397-5523419 GCAAATCATGCAGGCCTTTGTGG - Intergenic
1162974461 19:14200543-14200565 GTAAATCCTGCAAGCTTTGCGGG - Intronic
925951625 2:8918721-8918743 GCGAGGCTTGCAAGCCTTTTAGG - Intronic
926167337 2:10529729-10529751 GCCAATCCTGGAAGCCACTCAGG - Intergenic
930536122 2:52648313-52648335 GTGCAAGCTGCAAGCCTTTCTGG - Intergenic
933946543 2:87291011-87291033 GCACAGCCTGCAAGCCTTCCTGG + Intergenic
936333650 2:111570530-111570552 GCACAGCCTGCAAGCCTTCCTGG - Intergenic
937035180 2:118775020-118775042 GCCCTTCCTGCAAGCCTTACAGG + Intergenic
938554925 2:132416103-132416125 GTGAATCCTGCAAGCCTGCTTGG + Intergenic
948294758 2:236852292-236852314 GGGAATCTTGGAAGCCTTCCTGG - Intergenic
1172029623 20:31972691-31972713 GGGATTCCTGCCAGGCTTTCGGG + Intronic
1173443772 20:43099704-43099726 TCCAATCCTGCCAGTCTTTCAGG + Intronic
1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG + Intronic
1175921910 20:62454148-62454170 GCAAATCCTGCCTGCCTTTGGGG + Intergenic
1181865311 22:25850119-25850141 GCTAATCCTGGAAGACTTCCTGG - Intronic
1183935392 22:41259022-41259044 GGGAATCCAGGAAGCCTTCCTGG - Intronic
953443231 3:42937781-42937803 GTGAATCCAGAAAGCCATTCAGG - Exonic
959753851 3:109872870-109872892 CAGATTCCTGCAAGCCTTTTGGG + Intergenic
959896566 3:111613315-111613337 GGGAGTCCTGAAACCCTTTCTGG + Intronic
962098765 3:132319829-132319851 GCTAATCCAGCAAACCTTACAGG - Intronic
985282383 4:188300261-188300283 GGGAATCCTGCTATCCTTTGTGG - Intergenic
986748298 5:10762494-10762516 GCGAATCCAGCAAGGCATTGCGG - Intergenic
992466719 5:77013317-77013339 GTGAATCCTGTAAGCATTTAAGG + Intergenic
996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG + Intergenic
997377732 5:133409327-133409349 GCGTATCTTGCAAACCTCTCAGG + Intronic
1002195076 5:177497058-177497080 GCGGATCCTCCTAGCCATTCCGG + Intronic
1005150310 6:22741341-22741363 AAGAATCCGGCAGGCCTTTCAGG + Intergenic
1010808599 6:80269362-80269384 GAGAAAACTGCGAGCCTTTCAGG + Intronic
1016739502 6:147512470-147512492 TCAAATCCTACAATCCTTTCAGG - Intronic
1021534248 7:21685007-21685029 GAGAATCCTACCAGCCTCTCAGG - Intronic
1024960689 7:54971394-54971416 GTGAATCCTGCAGGCCTCTACGG - Intergenic
1033248921 7:139741981-139742003 GCGAATCCTGCCAGTCTCTCTGG - Intronic
1037469759 8:19195854-19195876 GCTTGTCCTGCCAGCCTTTCGGG - Intergenic
1038530853 8:28317133-28317155 GCAGAACCTGCAAGCCTTCCTGG - Exonic
1039818880 8:41118879-41118901 GCAAATCCTCCAAGACTGTCAGG + Intergenic
1050383218 9:5053809-5053831 TCTAATCCAGGAAGCCTTTCTGG - Intronic
1052754444 9:32526127-32526149 ACGCAGCCTGCAAGCCTTCCAGG - Exonic
1059303374 9:113333838-113333860 GGGATTCCTGAGAGCCTTTCAGG + Intronic
1186394039 X:9189861-9189883 GAGCAACCTGCAAGCCTTGCAGG + Intergenic
1186878943 X:13845325-13845347 GAAAAACCTGGAAGCCTTTCAGG - Intronic
1189353964 X:40297763-40297785 GCTAATCCTGAAAACCATTCTGG + Intergenic
1196441224 X:115721835-115721857 GGGAATCATGCAAGCTATTCGGG - Intergenic
1196444753 X:115839822-115839844 GGGAATCATGCAAGCTATTCGGG - Intergenic
1197967684 X:132082464-132082486 GAGATGCCTGCAAGGCTTTCTGG - Exonic
1199745484 X:150769703-150769725 CCGACCCCAGCAAGCCTTTCCGG + Intronic