ID: 1175857075

View in Genome Browser
Species Human (GRCh38)
Location 20:62127142-62127164
Sequence AGGCACTTACAGTAGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175857075_1175857077 -10 Left 1175857075 20:62127142-62127164 CCCTTATTCTACTGTAAGTGCCT 0: 1
1: 0
2: 1
3: 17
4: 199
Right 1175857077 20:62127155-62127177 GTAAGTGCCTCGCTCAAAAATGG 0: 1
1: 0
2: 2
3: 16
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175857075 Original CRISPR AGGCACTTACAGTAGAATAA GGG (reversed) Intronic
904854295 1:33485326-33485348 AGACACTGAAAGTATAATAAAGG - Intronic
906550659 1:46663812-46663834 AGGTAGTTACAGTAGAAAATTGG - Intronic
909712674 1:78670025-78670047 ACTCACTGACATTAGAATAATGG - Intergenic
911055662 1:93706185-93706207 AGGCAATTACAGTAGCTTCAGGG + Intronic
911240005 1:95454810-95454832 AGGCACTGAGATTAGAATAAAGG + Intergenic
912484732 1:110017035-110017057 AGTGACTTGCAGTAGAATTAAGG + Intronic
913065517 1:115249699-115249721 AGTCAAATAAAGTAGAATAAGGG + Intergenic
914703767 1:150155238-150155260 AGGCACTCAAACTGGAATAATGG + Intronic
916012799 1:160721485-160721507 AGACTGTGACAGTAGAATAAAGG + Intergenic
917128452 1:171714330-171714352 AGGCATTTATAGTATAACAATGG - Intronic
917648029 1:177048022-177048044 ATGCACTTACAGTATTATACAGG + Intronic
918296541 1:183162407-183162429 AGGCAGTTTCATTGGAATAATGG + Intergenic
918688356 1:187447756-187447778 AGGCTCTTGCAGTAGAAAATTGG + Intergenic
919696793 1:200585044-200585066 AGGCACAGAGAGTAGAATGATGG + Intronic
920116377 1:203624621-203624643 AGGCACTTACAGGACACTAAAGG - Intergenic
920919308 1:210285062-210285084 AGACATTTTCAGTAGAAAAAAGG - Intergenic
921425857 1:215000255-215000277 AACCACTTGCAGTAAAATAATGG + Intergenic
923164943 1:231351471-231351493 AGGCACTTACATAAAAATCAAGG + Exonic
924831771 1:247603519-247603541 AGGCACACACAGTGGTATAATGG - Intergenic
1066237141 10:33496467-33496489 AGGTAGTTACTGTAGAATATTGG - Intergenic
1068291378 10:55005644-55005666 ATGAACTTACAGAAGAATAGAGG - Intronic
1073598615 10:104824386-104824408 AGGCACTTTCAGTGCAAGAAGGG - Intronic
1075375263 10:121973825-121973847 ATGCACTTACCATATAATAAGGG - Intronic
1075956011 10:126523760-126523782 AGGAACTGACAGTAGAATGGTGG - Intronic
1078713674 11:13818884-13818906 AGGCAATTATAGAAGAAGAAAGG + Intergenic
1080172214 11:29318484-29318506 AGGCTCTTTCACTAGAATATTGG - Intergenic
1084290581 11:68163413-68163435 AGGCATATACAGAAGAATTATGG + Intronic
1088130146 11:106478607-106478629 AGGCATTTACCATAGTATAATGG - Intergenic
1088530481 11:110802871-110802893 AGGCACCTACATAAAAATAATGG + Intergenic
1088806665 11:113358940-113358962 AGGCACTGAGAGTAGATGAAGGG - Intronic
1089718198 11:120384599-120384621 GGCCTCTTACAGTAGAATGAGGG - Intronic
1089858824 11:121571117-121571139 AGGCAGTTACAGTAGAGTGACGG + Intronic
1090450222 11:126799757-126799779 ATTAACTTCCAGTAGAATAATGG + Intronic
1092851083 12:12627436-12627458 AGAGACTTAAAGTAGATTAATGG - Intronic
1092976922 12:13754248-13754270 AGTCACATAGTGTAGAATAAAGG + Intronic
1093987323 12:25550644-25550666 AGGTTCTTACAGGAGAATGAGGG + Intronic
1098344408 12:69486124-69486146 AGGCACTTTCAGTGTAATACAGG + Intronic
1100031289 12:90195075-90195097 AGAAACATACAGTAGAATAATGG - Intergenic
1100506607 12:95226916-95226938 AGCCTCTTAGAGTAGAATGATGG - Intronic
1102106989 12:110333976-110333998 AGGCACAGAAAGTAGAAAAAAGG - Intronic
1106007685 13:25786645-25786667 AAGCACTTTCAGTAGAATAAAGG - Intronic
1107344462 13:39444219-39444241 AGATACTTACAGTAAAATGAAGG + Intronic
1107752175 13:43579847-43579869 CTCCACTTACAGTAGAATATGGG - Intronic
1108114170 13:47109602-47109624 AGGCACTTCTAATGGAATAAGGG - Intergenic
1108771528 13:53707755-53707777 AGGCTATTACAGAAGAAAAATGG + Intergenic
1108786831 13:53913603-53913625 AGGGACTTATAGTAAAATCATGG - Intergenic
1110945930 13:81416743-81416765 AGCCACATACAGAAGAATGAAGG - Intergenic
1111231679 13:85352646-85352668 TGGCACTTACTGTATAAAAAAGG - Intergenic
1112787483 13:102967067-102967089 AGAAACTTACAGTTGATTAAGGG + Intergenic
1113153432 13:107289967-107289989 AGGAACTTTCAGGAGAACAAGGG + Intronic
1113361029 13:109631672-109631694 AGGGACAGAAAGTAGAATAATGG - Intergenic
1113429157 13:110234214-110234236 GGGAACTTACACTAGAATCAAGG + Intronic
1113571505 13:111361466-111361488 AGGCTGTTACAACAGAATAAAGG + Intergenic
1114276582 14:21151679-21151701 AGAGACTTACAGTAGTAAAAAGG - Intergenic
1115786884 14:36836638-36836660 AGGCAGTTTCAGTAGAATGGTGG + Intronic
1116695398 14:48169095-48169117 AGTTACTTCCTGTAGAATAATGG - Intergenic
1118113578 14:62749913-62749935 AAGCGCTTACAGAACAATAATGG - Intronic
1118531390 14:66710113-66710135 AAGCATTTACAGTTGTATAAAGG - Intronic
1119561850 14:75596813-75596835 AGGGACAGAAAGTAGAATAAAGG - Intronic
1123634077 15:22285795-22285817 AGTCACTGAGACTAGAATAATGG + Intergenic
1125299222 15:38236818-38236840 AGACAGTTTCAGTGGAATAAAGG + Intergenic
1125823641 15:42656696-42656718 AGACACTTAACTTAGAATAATGG - Intronic
1126194399 15:45916112-45916134 AGTCACTTACAAGAGGATAAGGG - Intergenic
1126240874 15:46441831-46441853 AAGCAGTTGCAGTGGAATAATGG + Intergenic
1126523603 15:49624218-49624240 AGGCACTTTAAGTAGAAACAGGG - Intronic
1126623967 15:50668193-50668215 AGACTCTAACATTAGAATAAAGG + Intronic
1127123248 15:55789065-55789087 AGGATCCTACAGAAGAATAAAGG - Intergenic
1128919849 15:71600408-71600430 AGGATCTTACAGAAGAGTAAAGG - Intronic
1131404750 15:92155176-92155198 AGACACCTGCAGAAGAATAAAGG - Intronic
1134562396 16:15221936-15221958 AGACACGTAAAGTAGATTAATGG + Intergenic
1134922938 16:18133563-18133585 AGACACGTAAAGTAGATTAATGG + Intergenic
1135348900 16:21712419-21712441 AGGTACTAACACTAGAATTACGG - Intronic
1135520858 16:23176914-23176936 AGTCTCTTACACTAGAAAAATGG + Intergenic
1135911978 16:26569699-26569721 AGGCACTGACACCAGAAGAAGGG - Intergenic
1136277906 16:29190339-29190361 AGGGACTCACAGTAGATCAAGGG - Intergenic
1136298058 16:29314798-29314820 AGGAACTTCCAGCAGAATGACGG - Intergenic
1139187017 16:64818733-64818755 AAGAACTCACAGTAGAATAGGGG - Intergenic
1139517731 16:67461710-67461732 AGGCACTCACAGTAGGGGAATGG + Intronic
1140160295 16:72483829-72483851 AGGTACTTACATTACAATAAGGG - Intergenic
1142059704 16:88021303-88021325 AGGGACTTCCAGCAGAATGACGG - Intronic
1142082278 16:88156379-88156401 AGGGACTCACAGTAGATCAAGGG - Intergenic
1142907185 17:3051847-3051869 AGGCAGTAACAGAAGCATAAAGG - Intergenic
1142927383 17:3252409-3252431 AGGCAGTAACAGAAGCATAAAGG + Intergenic
1148227716 17:45910511-45910533 AGGCACTGGCAGTTTAATAAAGG - Intronic
1151892339 17:76958163-76958185 AGGCGCTTACAGCAGGAGAAGGG + Intergenic
1153872926 18:9336643-9336665 ATGGGCTTACAGTTGAATAATGG + Intronic
1153980291 18:10302912-10302934 AGGCACTTTCAGCAGAATGATGG - Intergenic
1155833413 18:30546724-30546746 GGGCATTTAGAGTAGAATGAAGG - Intergenic
1156962446 18:43049515-43049537 AGGAACTCACAGCAGAATGAAGG + Intronic
1159458309 18:68691820-68691842 AGCCACTTACAGTAGTAATAAGG + Intronic
1164489535 19:28693851-28693873 AGTTACTTCCTGTAGAATAATGG + Intergenic
925639538 2:5974230-5974252 AAGCTTTTACAGTAGAAAAAAGG + Intergenic
926743679 2:16133236-16133258 AGGCATTCAGAGTGGAATAATGG + Intergenic
927316576 2:21690143-21690165 AGACACTGACAGTGAAATAATGG + Intergenic
931777736 2:65554757-65554779 AGGCAGTGACAGTAGAAATAAGG + Intergenic
937353181 2:121180916-121180938 AGGGACATAAAGTAGAATAGTGG + Intergenic
939351218 2:141040522-141040544 AGGCACATACAGCAGATTACAGG - Intronic
942745601 2:179228501-179228523 AGGCACATACTGTAGAACTAGGG + Intronic
943234733 2:185302505-185302527 AGGAACTTTCAGAAGAATCAGGG - Intergenic
945780540 2:214166351-214166373 AGGCACTTACAGGAGAGTGAAGG + Intronic
946752327 2:222904932-222904954 AGGAAACTACAGTGGAATAAGGG + Intronic
946883654 2:224201435-224201457 AGGAACTTACAGTGTAATATGGG - Intergenic
947787298 2:232835028-232835050 AGGCACACAAAGTGGAATAATGG - Intronic
1170742746 20:19072501-19072523 AGGCCCTGCCAGTAGCATAAAGG - Intergenic
1172745083 20:37200825-37200847 AGGCACTAACAGTGGCATCATGG - Intronic
1175623002 20:60466609-60466631 AGACACTGACAAAAGAATAAGGG - Intergenic
1175857075 20:62127142-62127164 AGGCACTTACAGTAGAATAAGGG - Intronic
1177118852 21:17117723-17117745 GGGCACTCACAATAGAATAATGG + Intergenic
1177361831 21:20083231-20083253 AGAAATTTACAGTAGAATAGAGG + Intergenic
1178321885 21:31612147-31612169 AGACACAGAAAGTAGAATAAAGG - Intergenic
1178476366 21:32940778-32940800 AGGCTCTTTGAGTAGAAGAATGG - Intergenic
1180945908 22:19693268-19693290 AGGCACGGACAGTAGAATAGGGG - Intergenic
1184625384 22:45723557-45723579 AGGCACACAGAGTAGTATAATGG - Intronic
951780217 3:26354709-26354731 AGGAAGTTAAAGTAAAATAATGG - Intergenic
954953579 3:54496663-54496685 AGGCACTTACATTTTAAAAATGG - Intronic
955697652 3:61652865-61652887 TGGCAGTTACATTAGAAGAATGG - Intronic
955757862 3:62244075-62244097 AGGGAAGTACAGTAGAAAAAAGG + Intronic
956004074 3:64760580-64760602 AGGTACTTACACCAGAAAAAAGG + Intergenic
956310678 3:67875978-67876000 AGGCACTTACAGTTAAATTGTGG - Intergenic
957139928 3:76340927-76340949 GGGAACTGACAGTAAAATAAAGG + Intronic
957819492 3:85352635-85352657 ATACACTTACAGTGGTATAAGGG + Intronic
959315486 3:104800733-104800755 AGGAATTTACAATAGAATAAAGG + Intergenic
960367336 3:116788727-116788749 AGGCCATCACAGTAGGATAAGGG - Intronic
960461394 3:117940279-117940301 AGGCTGTTAAAATAGAATAATGG - Intergenic
961202002 3:125052811-125052833 AGGGACTTACAGTCTAATACAGG + Intronic
962067672 3:131999059-131999081 AGGCAGTTACATGATAATAAGGG + Intronic
964590546 3:158358990-158359012 ATGTACTCACAATAGAATAAAGG - Intronic
965254464 3:166387306-166387328 AGGCACTGACAGTAGTTCAAAGG + Intergenic
965532843 3:169791895-169791917 AGGCAGGTACAGTATAATAGTGG + Intergenic
966623226 3:181988258-181988280 AGGTATTTACAGGAAAATAAAGG - Intergenic
967838491 3:193984467-193984489 AGTCACTTACAGTAAAATTAAGG - Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
973297180 4:48537477-48537499 AGGCACAAACAGTAGAACTAGGG + Intronic
973532798 4:51850162-51850184 AGGATATTACAGTATAATAAAGG + Intronic
974234712 4:59166212-59166234 AAGCAATTCCAGTAAAATAAAGG + Intergenic
975674344 4:76811618-76811640 GGGAACTTCCATTAGAATAATGG - Intergenic
976097050 4:81519251-81519273 AGGCACTGGCAGGAGAATGAAGG - Intronic
977077104 4:92468582-92468604 AGGAACTTACAGTATAACAGAGG + Intronic
977999013 4:103533344-103533366 GGGCACTGAGAATAGAATAAGGG - Intergenic
979031005 4:115646985-115647007 AGGCACTAAAAGTAAATTAAAGG + Intergenic
982514023 4:156321363-156321385 AAGCACTTACAGTAGCCTACAGG - Intergenic
984839100 4:184051592-184051614 GGGCACTGACTGTAGAGTAAAGG + Intergenic
987566908 5:19600855-19600877 TGGGACTTACATTAGAAAAATGG + Intronic
987795432 5:22622339-22622361 AGGCACTGAGAGTGGAAAAAGGG + Intronic
989228171 5:39054345-39054367 TGGCAGTTAAAGTTGAATAAGGG + Intronic
990020810 5:51125107-51125129 GGGCACTTCCAGTGGAATTATGG - Intergenic
990799465 5:59584141-59584163 GGGCTCTTACAGTAGGACAAAGG + Intronic
991172706 5:63646922-63646944 GTTCACTTACAGTAGAATACAGG - Intergenic
993775547 5:91990977-91990999 AGGGACTTCCCATAGAATAAAGG - Intergenic
993783239 5:92096240-92096262 AGGAACTCACAGTAGAGTTATGG + Intergenic
994275946 5:97837423-97837445 AGGCACTGGCAGGAGAATAGTGG - Intergenic
994728772 5:103467301-103467323 AGGCACTAACATTGCAATAATGG - Intergenic
996458859 5:123717792-123717814 AGACACATACAGTACAGTAACGG - Intergenic
996576373 5:124980736-124980758 ATCCACTTACAGAATAATAAAGG + Intergenic
996594763 5:125187615-125187637 AGATACTTCCAGTAGAATATGGG - Intergenic
996808485 5:127486027-127486049 AGGCACTTACAGGATAATGGAGG + Intergenic
999186024 5:149709615-149709637 AGGCAGTTAGAGTAGACTCAGGG + Intergenic
999682994 5:154077072-154077094 AGGCACTTAAGGTAGAATTCTGG + Intronic
1000839749 5:166203326-166203348 AGTAACTTAGAGTAGTATAAGGG + Intergenic
1001639891 5:173236702-173236724 AGGCGCTTGGAGTAGAATAAAGG + Intergenic
1003788951 6:9520871-9520893 AGACACATACAGAACAATAATGG - Intergenic
1003944579 6:11062536-11062558 AGACACTTAAAGGACAATAAGGG + Intergenic
1004147805 6:13084959-13084981 TGGCAATTAGCGTAGAATAAAGG + Intronic
1004441659 6:15660868-15660890 AAGTACTAACAGGAGAATAATGG + Intronic
1004792350 6:19040761-19040783 AGGAACTTACAGTATGGTAAAGG + Intergenic
1008260555 6:49361129-49361151 AGGCTCTTACAGTAAAAAAATGG - Intergenic
1010511117 6:76721665-76721687 AGGCAAATAAACTAGAATAAAGG + Intergenic
1015173092 6:130276623-130276645 ATACACTTACATTATAATAAGGG + Intronic
1017698733 6:157046454-157046476 TGGGACTTACAGTAGAATATGGG - Intronic
1017861575 6:158403313-158403335 AGACACTCACTGTAGAAAAAGGG - Intronic
1018560133 6:165093405-165093427 AAGCACCCACAGTAGAACAAAGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1028008780 7:85614328-85614350 AGGCACGGAGAGTAGACTAAAGG + Intergenic
1028519618 7:91715735-91715757 AGGATCTTACAGTGGCATAAAGG + Intronic
1028710365 7:93900550-93900572 AGGAACTTACATTATAGTAAAGG - Intronic
1030001000 7:105062067-105062089 AAGTACTTACAGCAAAATAATGG - Intronic
1031160887 7:118166732-118166754 AGACAGTTTCAGCAGAATAATGG + Intergenic
1038373398 8:27014099-27014121 AGGCACTTACAGTCTAGTAAAGG + Intergenic
1038688577 8:29741042-29741064 AGGCAGTTTCAGCAGAAGAAGGG - Intergenic
1042095144 8:65207103-65207125 AGTTACTTCAAGTAGAATAATGG + Intergenic
1042150365 8:65776303-65776325 AAGGACTGACAATAGAATAAAGG - Intronic
1043794710 8:84521982-84522004 ATGAAATTACTGTAGAATAATGG - Intronic
1045069792 8:98490560-98490582 AGGAACTTACAGTATAGTTAGGG - Intronic
1048755112 8:137729974-137729996 AGGCATTTAAATTAGAAAAAGGG + Intergenic
1049317283 8:141976025-141976047 AGGCGCTTGGAGAAGAATAAAGG + Intergenic
1050071028 9:1814297-1814319 AAGCTCATACAGTATAATAAAGG + Intergenic
1051429867 9:16970854-16970876 AGGCACTTGCAGTAGAGACAAGG - Intergenic
1052441310 9:28499245-28499267 AGGCACTCAAAGTAGAATATGGG + Intronic
1053292534 9:36890796-36890818 AGGCACTTACAGAAGGAGATGGG + Intronic
1053377967 9:37624253-37624275 AGGAACTAGCAGGAGAATAAAGG - Intronic
1055831825 9:80388546-80388568 TGGCACTAACAGAAGAAGAAAGG + Intergenic
1055879892 9:80988146-80988168 AGGTACTTATAGTACAACAAGGG + Intergenic
1057015216 9:91645124-91645146 AGGCACCTCCAGAAGAGTAAGGG + Intronic
1057923058 9:99115013-99115035 AGGCACGTACATTAGCATGAGGG + Intronic
1058189502 9:101895621-101895643 AGGCACCTTGAGTAGAATAATGG - Intergenic
1059753349 9:117269809-117269831 AGGCACTTAAAGTTGAACCAAGG + Intronic
1188147453 X:26630798-26630820 AGGCACTGACAGTAGATGGATGG - Intergenic
1188735697 X:33712272-33712294 AGGCACATAGAGTGGTATAATGG + Intergenic
1189535398 X:41929799-41929821 AGACACTTTCAGCAGAAGAAGGG + Intergenic
1189942118 X:46135378-46135400 AGGCACATCCTTTAGAATAAAGG - Intergenic
1190272974 X:48881076-48881098 AGGTACTTACATTAGAAAAGAGG + Intergenic
1193940246 X:87673470-87673492 AGAGACTTAAAGTAGATTAATGG + Intergenic
1194320824 X:92443724-92443746 AGCCACATGCAGAAGAATAATGG - Intronic
1194696658 X:97060705-97060727 AGTCATTTATAGTAAAATAATGG - Intronic
1194756580 X:97745700-97745722 GGGGACTTACATTTGAATAAGGG - Intergenic
1195033651 X:100950921-100950943 AAACACTTACATTAGAAAAAAGG + Intergenic
1195919468 X:109968264-109968286 GGGCACATACAGTATATTAAGGG - Intergenic
1196104538 X:111882276-111882298 AGGTACTTACAGTATAAAACAGG - Intronic
1199398618 X:147370233-147370255 AAACACTTACAGAAAAATAACGG + Intergenic
1199613949 X:149640336-149640358 AGGCAGTTAAAGAAGACTAAAGG - Intergenic
1199709198 X:150456537-150456559 AAGCACTCACAGTAGGCTAAAGG - Intronic
1200277222 X:154745608-154745630 AGGCATTTAAAGGATAATAAGGG + Intronic
1200628936 Y:5556860-5556882 AGCCACATGCAGAAGAATAATGG - Intronic
1200886046 Y:8270982-8271004 AGGAACTTACAGAAAAATTAGGG + Intergenic
1201243711 Y:11982898-11982920 GGACACTGACAGTAGAGTAAAGG + Intergenic
1201941218 Y:19462416-19462438 AGACACTGACAGTAGAATGGTGG - Intergenic
1202305455 Y:23465463-23465485 AGTCACTGAGACTAGAATAATGG + Intergenic
1202565354 Y:26205126-26205148 AGTCACTGAGACTAGAATAATGG - Intergenic