ID: 1175858195

View in Genome Browser
Species Human (GRCh38)
Location 20:62133929-62133951
Sequence AGCGCCTCGGGACAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175858185_1175858195 -4 Left 1175858185 20:62133910-62133932 CCTGGTGCCAACCCCACCCAGCG 0: 1
1: 0
2: 2
3: 22
4: 221
Right 1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 161
1175858183_1175858195 9 Left 1175858183 20:62133897-62133919 CCCACATGGGGTGCCTGGTGCCA 0: 2
1: 0
2: 0
3: 14
4: 160
Right 1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 161
1175858184_1175858195 8 Left 1175858184 20:62133898-62133920 CCACATGGGGTGCCTGGTGCCAA 0: 2
1: 0
2: 0
3: 9
4: 142
Right 1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175858195 Original CRISPR AGCGCCTCGGGACAGCCAGG TGG Intronic
900347409 1:2216308-2216330 ACAGCCTGTGGACAGCCAGGGGG - Intergenic
900609733 1:3539454-3539476 AGCACCTCGGCCCTGCCAGGAGG + Intronic
900801040 1:4737284-4737306 AGGGACTCGGCAGAGCCAGGGGG - Intronic
900996029 1:6124171-6124193 AGGGCCTCAGGGCAGCCAGGGGG + Intronic
901114410 1:6830289-6830311 AGCACCTTGGGACACCAAGGCGG - Intronic
901706483 1:11077328-11077350 ACCTCTTCGGGACAGTCAGGAGG + Intronic
902027091 1:13392181-13392203 AGCGGCTCAGGGCAGGCAGGAGG - Exonic
902508154 1:16951233-16951255 AGGTCCTGGGGACAGCTAGGAGG + Intronic
904750751 1:32740501-32740523 AGCCCCTGGGGACATGCAGGGGG + Intergenic
907471980 1:54679938-54679960 GGAGCCTCGGGCCCGCCAGGTGG + Exonic
916817501 1:168367986-168368008 AGGGCCTCTGGACTGCTAGGTGG - Intergenic
921637917 1:217518926-217518948 AGTGCCTCCCGACAGCCTGGAGG - Intronic
924362278 1:243254746-243254768 AGGGGCTCGGGAAAGCCGGGGGG + Intronic
1063091854 10:2872650-2872672 ATCACCACGGAACAGCCAGGGGG + Intergenic
1064146873 10:12832858-12832880 AGCGCTTTGGGAGAGCGAGGCGG + Exonic
1065047672 10:21758619-21758641 AGGGCCTCTGGACAGCCACCAGG + Intronic
1065472111 10:26092778-26092800 ACCGCCTGGGGACAGACATGGGG - Intronic
1066332313 10:34438046-34438068 AAAGCCTCTGGAGAGCCAGGTGG + Intronic
1066484888 10:35833723-35833745 AGCGCTTCAGGACACCGAGGCGG + Intergenic
1067086413 10:43242778-43242800 AGCACCTCGGGAGACCGAGGTGG - Intronic
1067109161 10:43387231-43387253 ACCGGCCCGGGACTGCCAGGAGG - Exonic
1072682526 10:97517298-97517320 AGCGCCACTGGAGAGCCTGGTGG + Intronic
1073062487 10:100740982-100741004 AGTGGCACGGGCCAGCCAGGTGG - Intronic
1075390584 10:122088106-122088128 AGAGCCTCAGGACATCCAGAGGG - Intronic
1075954340 10:126509014-126509036 AGCCCCTCAGCACAGCCTGGGGG - Intronic
1076342103 10:129756289-129756311 AGCACCACAGGACAGGCAGGAGG + Intronic
1076905209 10:133357872-133357894 AGCACCCCGGGACAGGCAGGAGG - Intronic
1077039574 11:513404-513426 AGCACCTCGGGACACTGAGGCGG - Intergenic
1077210882 11:1370475-1370497 TGTGCCTCGGGGGAGCCAGGAGG - Intergenic
1077532988 11:3105997-3106019 AGGGCCTCGGGACAGCCGAGGGG - Intronic
1079076038 11:17386157-17386179 AGCCTCTGGGGACAGGCAGGAGG + Exonic
1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG + Intronic
1084089079 11:66868755-66868777 GGCTCCTGGGGCCAGCCAGGGGG - Intronic
1084208729 11:67611210-67611232 AAGGCCTGGGGCCAGCCAGGTGG + Intronic
1084729482 11:71064333-71064355 AGAGCCTGGGGACAGCTGGGCGG + Intronic
1085392361 11:76188988-76189010 AGCGCCTGGGGAGAGTCAGCCGG + Intronic
1087077633 11:94140195-94140217 AGCACCCCAGGACAGCCATGGGG - Intronic
1088791968 11:113234104-113234126 AGCTTCTCGGGGGAGCCAGGGGG + Intronic
1088812298 11:113399958-113399980 TGCTCCTCTGGACCGCCAGGTGG - Exonic
1089264271 11:117247240-117247262 AGCGCTTTGGGACACCAAGGTGG + Intronic
1091664889 12:2411940-2411962 AGCTCAGAGGGACAGCCAGGAGG - Intronic
1091995771 12:4992754-4992776 AGAGCCTGGGGACAGCCAAAGGG - Intergenic
1095687951 12:45056816-45056838 AGCACCTGGGGAGACCCAGGTGG - Intergenic
1101719934 12:107342371-107342393 AGCTACTCTGGACAGCCAGAGGG - Intronic
1108575150 13:51784162-51784184 AGCGCCTCCTGAGAGCCAGGTGG + Intronic
1117462055 14:55955043-55955065 AGCACTTTGGGACAGCAAGGTGG + Intergenic
1119626764 14:76184176-76184198 ACAGCCTGGGAACAGCCAGGAGG - Intronic
1123104993 14:105837169-105837191 AGCCCCTGGGGTCAGACAGGGGG + Intergenic
1123587640 15:21773384-21773406 AGCGCCTTGGGAGGCCCAGGTGG + Intergenic
1123624278 15:22215949-22215971 AGCGCCTTGGGAGGCCCAGGTGG + Intergenic
1124475901 15:30034235-30034257 AGCACTTTGGGAGAGCCAGGTGG + Intergenic
1128782832 15:70374266-70374288 CCTGCCTGGGGACAGCCAGGAGG + Intergenic
1128806820 15:70537152-70537174 AGAGCGTGGGGACAGCCAAGTGG + Intergenic
1130505235 15:84534024-84534046 AGCACCTTGGGAGAGCAAGGTGG + Intergenic
1131017080 15:89066774-89066796 AGAGCCACGGGCCAGCCAAGAGG + Intergenic
1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG + Intronic
1133235074 16:4383966-4383988 AGCGTCCCGGGAGAGCCAAGCGG + Intronic
1133799872 16:9076434-9076456 AGCACTTCGGGAGACCCAGGTGG + Intergenic
1134832231 16:17332839-17332861 AGCTCCTGCGGACAGACAGGTGG - Intronic
1134866378 16:17610958-17610980 AGCGCTTTGGGACACCAAGGTGG - Intergenic
1136844925 16:33568666-33568688 GGAGACTCGGGGCAGCCAGGTGG + Intergenic
1138497843 16:57419111-57419133 AGCCCCTGGGGACAGCGATGGGG - Intergenic
1141203647 16:81915788-81915810 AGCTCCTCAGGGCAGGCAGGGGG - Intronic
1142239904 16:88940482-88940504 CGGGCCTCGGCACAGCCGGGTGG - Intronic
1203155093 16_KI270728v1_random:1868964-1868986 GGAGACTCGGGGCAGCCAGGTGG + Intergenic
1143141626 17:4744615-4744637 GGCCCCTCAGGACAGCCTGGAGG + Exonic
1143539666 17:7561663-7561685 CGCGCCACAGGAGAGCCAGGAGG - Intergenic
1149596226 17:57866379-57866401 AGCGCCTCTGGACACCTGGGAGG + Intronic
1151529625 17:74696025-74696047 AGGGCCTGGAAACAGCCAGGGGG - Intronic
1151675596 17:75595837-75595859 GCCGCCTCAGGACAGCCAGGAGG + Intergenic
1151858153 17:76737471-76737493 AGCGCCTGCGCACAGCCCGGCGG + Exonic
1151975500 17:77481722-77481744 ACTGCCTCGGGCCACCCAGGTGG - Intronic
1153816471 18:8794537-8794559 AGCGCCTCTCCACAGCCAGGCGG + Intronic
1155872289 18:31042999-31043021 AGCGCCGCGGGGCAGCCGAGGGG - Intergenic
1157326707 18:46674386-46674408 AGCTCCCCTGGACAGGCAGGAGG + Intronic
1157455782 18:47827727-47827749 AGCACCTCGGGAGGCCCAGGCGG - Exonic
1160880869 19:1319390-1319412 GGGGCCTCGGCTCAGCCAGGAGG + Intergenic
1161285464 19:3466128-3466150 AGGGCACAGGGACAGCCAGGTGG + Intronic
1161394728 19:4038925-4038947 AACGCCTGGGGACAGGAAGGAGG - Exonic
1168707908 19:58480193-58480215 TGGGCCTCTGGGCAGCCAGGTGG - Exonic
927303377 2:21541536-21541558 AGCACCTTGGGAGACCCAGGTGG - Intergenic
927883730 2:26706220-26706242 AGCTCCTGGGGTGAGCCAGGTGG + Intronic
930546849 2:52778915-52778937 AGCGCCTCAGGAGAACCAGGAGG - Intergenic
932446652 2:71785826-71785848 AGCGCCACGGGACAGGGATGAGG - Intergenic
937990312 2:127658585-127658607 GGCCCTTCGGCACAGCCAGGAGG + Intronic
938185201 2:129225523-129225545 AGCACTTTGGGACACCCAGGCGG - Intergenic
940091514 2:149924663-149924685 AGCACTTTGGGAGAGCCAGGAGG - Intergenic
940342044 2:152591556-152591578 AGCGCCCTGGGACACCAAGGTGG + Intronic
940971332 2:159899956-159899978 AGGGCCTGGGGAAAGCCTGGGGG + Intronic
947856675 2:233328833-233328855 AGTCCCTCGGGACAGCCAGTGGG - Intronic
1172021657 20:31918984-31919006 AGAGCCTCGGGTGGGCCAGGTGG + Intronic
1175698065 20:61117262-61117284 ATGGCCTCTGGACATCCAGGTGG - Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG + Intronic
1175908686 20:62394375-62394397 AGCCCCTCGGGAAAGAAAGGCGG + Intronic
1176086124 20:63296418-63296440 AGTCCCTGAGGACAGCCAGGTGG + Intronic
1177932061 21:27297447-27297469 AGCACTTCGGGACACCAAGGTGG - Intergenic
1178914110 21:36697570-36697592 AGGGGCTAGGGACAGGCAGGGGG + Intergenic
1180044712 21:45299973-45299995 AGCCCCTCGAGACCCCCAGGAGG + Intergenic
1180783800 22:18535944-18535966 AGGGCCTGGGGAGAGACAGGAGG + Intergenic
1180950553 22:19718752-19718774 AGCGCCCCAGGACCGCCTGGTGG + Intronic
1180960956 22:19762147-19762169 TGTGCCTGGGGACAGCAAGGAGG - Intronic
1181165441 22:20980597-20980619 AGGGACTGGGGACAGCCTGGAGG + Intronic
1181240700 22:21475296-21475318 AGGGCCTGGGGAGAGACAGGAGG + Intergenic
1183162487 22:36124170-36124192 ACAGCCTCGGCAGAGCCAGGAGG - Intergenic
1183553388 22:38506370-38506392 AGCGCCTCGGAATAGCCCGAGGG + Intronic
1184053095 22:42023440-42023462 AGCACCTCGGGAGGGCAAGGCGG - Intronic
949965836 3:9355483-9355505 AGGGCCTAGGAATAGCCAGGTGG - Intronic
951779562 3:26347295-26347317 AGCGCTTTGGGAGACCCAGGCGG - Intergenic
954756271 3:52842009-52842031 AGGGCCCTGGGACAGCCTGGAGG - Intronic
955314351 3:57923223-57923245 AGAGCCTCAGGACTGCCTGGAGG + Intronic
960031659 3:113060319-113060341 AGAGGCTCAGGACATCCAGGTGG - Intergenic
961381935 3:126500924-126500946 AGAGTCTGGGGCCAGCCAGGTGG + Intronic
961476695 3:127151132-127151154 GGAGGCTGGGGACAGCCAGGAGG + Intergenic
964763141 3:160153326-160153348 AGGGCCTGGGGACAGGGAGGGGG - Intergenic
968569435 4:1331725-1331747 AGGCCCTCAGGACAGCCAGAGGG + Intronic
968939412 4:3630336-3630358 AGCGCCTGGGGCCAGCCTGGAGG + Intergenic
968995433 4:3942307-3942329 GGCACCTGGGGTCAGCCAGGTGG + Intergenic
971627045 4:28934704-28934726 AGCGCCTCAGAACAGTGAGGTGG + Intergenic
976276572 4:83284610-83284632 CGCGGCTCGGGACAGGCGGGGGG + Exonic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
980467500 4:133204328-133204350 AGCTGCTTGGGACAGCCATGTGG - Intronic
981532074 4:145762691-145762713 GGCCCCTCTGGACAGCCAGGAGG - Intronic
982978590 4:162101059-162101081 ATCGCCTTCAGACAGCCAGGTGG + Intronic
983523985 4:168741570-168741592 AGCTACTCGGGACAGTGAGGTGG + Intronic
984006666 4:174319054-174319076 AGCACTTTGGGACATCCAGGTGG - Intronic
987950930 5:24674587-24674609 AGCACCTTGGGACACCGAGGCGG - Intergenic
991222675 5:64234844-64234866 AGCGCCTCGGGAGGCCAAGGAGG - Intronic
1002533570 5:179863822-179863844 AGCCCCACAGGAGAGCCAGGTGG - Exonic
1002763291 6:218226-218248 AGGCCCCGGGGACAGCCAGGGGG + Intergenic
1010409287 6:75542837-75542859 AGCTACTCGGGACGGCAAGGAGG + Intergenic
1012416747 6:99020989-99021011 AACGCCACGGGCCAGCCAAGCGG + Intergenic
1017981802 6:159406988-159407010 AGCACCTCGGGAGGCCCAGGTGG - Intergenic
1018025245 6:159800487-159800509 AGGGCCTCGGGAAGGACAGGGGG + Intronic
1019135135 6:169903131-169903153 AGCGCCTTGGGAAACCCACGTGG - Intergenic
1019358325 7:592427-592449 AGTGACTCGGCACAGCCAGTGGG - Intronic
1019358350 7:592519-592541 AGTGACTCGGCACAGCCAGTGGG - Intronic
1019629512 7:2040720-2040742 TGGGCCTCGGAACAGCCTGGCGG - Intronic
1019646151 7:2130069-2130091 GGCGCATCGGGGCAGCCAGGTGG - Intronic
1020016840 7:4836215-4836237 ACAGCCTCGGCACAGCCAGAGGG + Intronic
1021585863 7:22207446-22207468 AAAGACTGGGGACAGCCAGGGGG + Intronic
1021690027 7:23222568-23222590 AGAGGCAAGGGACAGCCAGGGGG + Intergenic
1021976115 7:26012532-26012554 AAGGCCTGGGGCCAGCCAGGTGG + Intergenic
1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG + Intronic
1029717020 7:102334532-102334554 AGCGCCTTGGGAGACCGAGGCGG - Intergenic
1030030750 7:105367132-105367154 AGCACTTTGGGACACCCAGGTGG - Intronic
1032991675 7:137401282-137401304 AGCACTTTGGGACAGCCAGGTGG + Intronic
1033683989 7:143622213-143622235 GGCACCTCGGGAAAGCCACGGGG + Intronic
1033687165 7:143701402-143701424 GGCACCTCGGGAAAGCCACGGGG + Intronic
1033700623 7:143835425-143835447 GGCACCTCGGGAAAGCCACGGGG - Intergenic
1033913813 7:146299025-146299047 AGCACTTTGGGACACCCAGGTGG + Intronic
1034917447 7:155052527-155052549 AGCACCTTGGGAGGGCCAGGCGG + Intergenic
1035018534 7:155787313-155787335 GGACCCTCGGGGCAGCCAGGCGG - Intergenic
1035919451 8:3661412-3661434 AGAGCCTCAGCACAGCCACGTGG - Intronic
1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG + Intronic
1039911818 8:41832521-41832543 AGGGCTTTGGGACAGCCTGGGGG - Intronic
1048162614 8:132034883-132034905 AGAGCCTCTGGAAACCCAGGTGG - Intronic
1049339417 8:142104146-142104168 AGAGACCCGGGACAGGCAGGTGG - Intergenic
1050862223 9:10449286-10449308 GGCGCCTCGGGAGGCCCAGGTGG - Intronic
1051672672 9:19527828-19527850 ATAGCCTCTGGACAGCCATGTGG - Intronic
1053082143 9:35185186-35185208 AGTGCCTCAGGACAGTGAGGAGG + Intronic
1054451350 9:65404996-65405018 AGAGCCTGGGGCCAGCCTGGAGG - Intergenic
1054783600 9:69189208-69189230 TTGGCCTCGGGACAGCCTGGAGG + Intronic
1054891464 9:70256969-70256991 AGCACTTCGGGACACCGAGGTGG + Intergenic
1057207161 9:93180524-93180546 AGAGCCTCAGGACAACCAGCAGG - Intergenic
1057533387 9:95875269-95875291 AGCTCCCCGGGACAGCCACGGGG - Intergenic
1060407422 9:123379767-123379789 AGCCCCTCAGCACAGCCAGGGGG + Exonic
1060903985 9:127288115-127288137 AGCGCCTGAGGAAAGACAGGTGG + Intronic
1061828128 9:133274656-133274678 GGCGCCTCGGGAAGGCGAGGTGG - Intronic
1062261646 9:135665915-135665937 TGCGACTCGGGACGGGCAGGGGG + Intronic
1062493723 9:136821863-136821885 ACCGGCTGGGGGCAGCCAGGAGG - Intronic
1062696564 9:137878810-137878832 AGCCCCTCGGCACACCCGGGCGG - Intronic
1186250997 X:7666492-7666514 AGAGCCTTGGGAGATCCAGGAGG + Intergenic
1198805994 X:140495348-140495370 AGCACTTCGGGAGAGCAAGGTGG + Intergenic
1200686692 Y:6265130-6265152 GGCGCGTGGGGTCAGCCAGGAGG - Intergenic
1200989570 Y:9336046-9336068 GGCGCGTGGGGTCAGCCAGGAGG - Intergenic