ID: 1175859483

View in Genome Browser
Species Human (GRCh38)
Location 20:62142852-62142874
Sequence CGCCCCGGCGAGCAGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 174}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175859483_1175859492 5 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859492 20:62142880-62142902 GCGACCCACGCGCCCGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 113
1175859483_1175859501 24 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859501 20:62142899-62142921 GGGGCCAGGGGTGCTCAAGATGG 0: 1
1: 0
2: 0
3: 26
4: 348
1175859483_1175859497 12 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859483_1175859490 3 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859490 20:62142878-62142900 GCGCGACCCACGCGCCCGGCCGG 0: 1
1: 0
2: 2
3: 15
4: 106
1175859483_1175859489 -1 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859489 20:62142874-62142896 GGCGGCGCGACCCACGCGCCCGG No data
1175859483_1175859495 10 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859495 20:62142885-62142907 CCACGCGCCCGGCCGGGGCCAGG 0: 1
1: 0
2: 3
3: 49
4: 406
1175859483_1175859496 11 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859496 20:62142886-62142908 CACGCGCCCGGCCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 18
4: 229
1175859483_1175859491 4 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859491 20:62142879-62142901 CGCGACCCACGCGCCCGGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175859483 Original CRISPR CGCCCCGGCGAGCAGAGGCC GGG (reversed) Intronic
900191236 1:1353198-1353220 GCCCCCGACGAGCAGAGCCCTGG + Exonic
900201290 1:1407780-1407802 GGCCGCGGCGAGCCGAGGTCGGG - Intergenic
900205625 1:1430936-1430958 AGCCCCGGAGAGCAGAGGCCTGG + Intergenic
900232828 1:1570374-1570396 CACCCTGCCGACCAGAGGCCAGG + Intronic
900607666 1:3531079-3531101 AGCGCCGGTGACCAGAGGCCAGG - Intronic
901232536 1:7649286-7649308 GGTCCCTGAGAGCAGAGGCCCGG + Intronic
901626990 1:10630161-10630183 CGGCCAGGCGAGAGGAGGCCAGG - Exonic
901671011 1:10856487-10856509 CGCCCTGGCCAACGGAGGCCTGG - Intergenic
902079846 1:13813507-13813529 TTCCCAGGCGAGCAGAGCCCTGG - Intronic
903115570 1:21176433-21176455 CGCGCCGGGGTGCAGGGGCCGGG + Intronic
903652398 1:24930017-24930039 GGCCCTGGCGAGTAGTGGCCGGG - Intronic
904743262 1:32694949-32694971 GACCCCTGCAAGCAGAGGCCCGG - Exonic
905107979 1:35575238-35575260 CCCCTCGGCGGGGAGAGGCCAGG - Intronic
907487821 1:54789355-54789377 GGCTCCCGTGAGCAGAGGCCTGG + Intronic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
913535581 1:119768961-119768983 AGCCACGGTGAGCAGAGGCGGGG - Intergenic
921414454 1:214870468-214870490 CGCGCCGGCGAGCACCGCCCGGG - Intergenic
1063012956 10:2043649-2043671 CGCCCTAGCAAGGAGAGGCCAGG - Intergenic
1064031321 10:11885213-11885235 CGGGCTGGTGAGCAGAGGCCAGG + Intergenic
1064245674 10:13666032-13666054 GGCCCCGGCAACCAGACGCCAGG - Intronic
1065968216 10:30785481-30785503 GGCCCCTGGGAGCAGCGGCCAGG - Intergenic
1066135925 10:32446188-32446210 CGCCCGGGGGCGCAGAGGCCGGG + Exonic
1066370523 10:34815209-34815231 CGCCGCGGCGGGGAGAGGCGAGG - Exonic
1067296536 10:44978001-44978023 GGCCACGGAGAGCAGAAGCCGGG + Exonic
1068845049 10:61662843-61662865 CTACCCGGCGGGCAGAGGCTCGG + Intergenic
1068955359 10:62815617-62815639 CGCCCCGGCGCGCCCAGCCCCGG - Intronic
1070877298 10:79826097-79826119 CGCCCCGGCGAGAACAGGCCCGG + Intergenic
1071643795 10:87342141-87342163 CGCCCCGGCGAGAACAGGCCCGG + Intergenic
1071676368 10:87659683-87659705 CGCGCCCGCGAGTAGGGGCCGGG + Intronic
1072726113 10:97815238-97815260 CGCCCCTGGGAGCAAAGGCCTGG - Intergenic
1074416691 10:113273188-113273210 CTCATCAGCGAGCAGAGGCCTGG - Intergenic
1075398393 10:122143737-122143759 GCCCCCGGAGAGCAGGGGCCTGG + Intronic
1076131999 10:128019714-128019736 CTCCCCGCCCAACAGAGGCCTGG - Intronic
1076657900 10:132036732-132036754 AGCCTCGGTGAGCAGCGGCCGGG + Intergenic
1076750003 10:132537762-132537784 CGCCCCGCGGAGCCGAGCCCGGG - Intergenic
1077251567 11:1563116-1563138 AGCCCCTGGTAGCAGAGGCCAGG + Intronic
1077495432 11:2884665-2884687 CTCACCGGAGATCAGAGGCCCGG + Exonic
1081998258 11:47378106-47378128 TGCCCTGGCGGGCTGAGGCCAGG - Intronic
1083897468 11:65627287-65627309 AGCCCAGCAGAGCAGAGGCCAGG + Intronic
1084180431 11:67443234-67443256 CGCCCAGGAGAGGAGAGGCTGGG + Intronic
1084218456 11:67664116-67664138 TGCACAGGCAAGCAGAGGCCCGG - Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1089616381 11:119697032-119697054 CGCTGCAGCGGGCAGAGGCCGGG + Intronic
1091616474 12:2053984-2054006 CGCCGCGGAGCCCAGAGGCCCGG + Intronic
1092242014 12:6841049-6841071 AGCCCAGGAGAGCAGAGCCCAGG - Intronic
1094216894 12:27952107-27952129 CGCCCTGGGGAGAATAGGCCAGG - Intergenic
1094378730 12:29819189-29819211 CACCACTGCCAGCAGAGGCCTGG - Intergenic
1096072156 12:48781462-48781484 CTGCCCAGGGAGCAGAGGCCAGG - Intronic
1096124660 12:49110451-49110473 GGCCCCGGCGAGGAGAAGCGGGG - Intronic
1096491489 12:52015315-52015337 CGACCCGGCGGGCCGAGGCTAGG - Exonic
1097981720 12:65742457-65742479 CTCCCCGGCGGGGGGAGGCCGGG + Intergenic
1102033613 12:109758786-109758808 CCCCCTGGCGAGCTGGGGCCAGG + Intronic
1102058653 12:109915595-109915617 GGCCCAGGGGAGCAGGGGCCGGG - Intronic
1103377539 12:120469004-120469026 AGCCACGGCGAGCACGGGCCGGG + Intronic
1103592837 12:122004442-122004464 AGCCCCGCCCAGCAGAGGCCGGG + Intergenic
1112733671 13:102394640-102394662 GCCCCCGGCGAGCCGAGGCTGGG + Intronic
1113949973 13:114066410-114066432 CGGCCGGGCGAGAGGAGGCCCGG + Intronic
1121634222 14:95442900-95442922 CTCCCAGGAGAGCAGGGGCCTGG + Intronic
1122602400 14:102928293-102928315 AGCCCGGGCGAGCTCAGGCCCGG - Intronic
1122929751 14:104927824-104927846 AGCCCCTGGAAGCAGAGGCCAGG + Exonic
1132252059 15:100341617-100341639 CGCATCGGCGAGCGGAGACCCGG + Intronic
1132414808 15:101612563-101612585 TGCCCCGGGGAGCAGGGGTCAGG - Intergenic
1132503706 16:296518-296540 CGGCCCGGCGGGCAGCGGCAGGG + Intronic
1132599359 16:767132-767154 CACCCCGGGGGGCAGAGGGCGGG - Intronic
1132855059 16:2041025-2041047 AGCCCCAGTGAGCAGACGCCTGG - Intronic
1136456330 16:30381845-30381867 CGCCCCGGCGCTCAATGGCCAGG + Exonic
1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG + Intronic
1138139929 16:54559443-54559465 GCCCCCTGTGAGCAGAGGCCAGG + Intergenic
1139511496 16:67430841-67430863 CGCGGCGGAGAGCTGAGGCCGGG + Intronic
1141428941 16:83960934-83960956 GGTTCAGGCGAGCAGAGGCCTGG + Intronic
1142230249 16:88896785-88896807 CGCCCCGGCCAGCCTGGGCCTGG + Intronic
1142631391 17:1228846-1228868 CTCTCCGGCGAGCTGTGGCCGGG + Intronic
1144640460 17:16933922-16933944 GGGCCTGGCTAGCAGAGGCCTGG - Intronic
1144734351 17:17546626-17546648 GGCGCCTGTGAGCAGAGGCCTGG - Intronic
1147672680 17:42185600-42185622 CGCTGCGGCGTTCAGAGGCCAGG + Intergenic
1148326940 17:46788844-46788866 CTCCACGGCGAGCTGAGGGCAGG + Intronic
1150920310 17:69475766-69475788 CACCCCTGGGACCAGAGGCCAGG - Intronic
1152376188 17:79920075-79920097 CTCCCCGGGGCGCAGGGGCCTGG - Intergenic
1152396748 17:80037307-80037329 AGCCTAAGCGAGCAGAGGCCCGG - Intronic
1152721911 17:81927536-81927558 GGGCCCGGCGGGCCGAGGCCGGG + Exonic
1203162345 17_GL000205v2_random:63484-63506 CGCCCCGGAGAACCGGGGCCTGG - Intergenic
1153794332 18:8609256-8609278 CGGGCAGGCGAGCAGAGGCAGGG + Intergenic
1154199195 18:12287668-12287690 CGCTCCTCCCAGCAGAGGCCAGG + Intergenic
1156502017 18:37566136-37566158 CGCCACGGCGGGCGGCGGCCGGG + Intergenic
1157168848 18:45383808-45383830 AGCCCAGGCAAGCAGAGCCCAGG - Intronic
1157183522 18:45518836-45518858 CTCCCTGGAGAGCAAAGGCCAGG + Intronic
1160091806 18:75834101-75834123 CGCCTCCGGGAGCAGAGACCAGG - Intergenic
1160499110 18:79393839-79393861 CGGGCCGGGGCGCAGAGGCCGGG + Intergenic
1160830786 19:1104184-1104206 CACGCCGGCGAGCGGAGGCAGGG - Intronic
1161219779 19:3113229-3113251 CGCCCGGGCCAGCCGAGGCCTGG + Intronic
1161224401 19:3136390-3136412 TGCCCTGGCCAGCAGGGGCCCGG + Exonic
1161239015 19:3211471-3211493 CTGGGCGGCGAGCAGAGGCCAGG + Intergenic
1161489861 19:4555928-4555950 AGGTCGGGCGAGCAGAGGCCTGG + Intronic
1161707519 19:5829132-5829154 CCTCCCGGCGGGGAGAGGCCTGG + Intergenic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1163427037 19:17245580-17245602 CCCCCGGGCGAGCGGCGGCCAGG - Exonic
1163664752 19:18598089-18598111 CGCCCCAGGAAGCCGAGGCCTGG - Intronic
1165073372 19:33268172-33268194 GGCCCCGGGGAACAGAGTCCAGG + Intergenic
1165448337 19:35868827-35868849 CGCGCCGGCGTCCAGAGACCCGG - Intronic
1165489027 19:36112777-36112799 GGCCCCTGGGAGCAGAGGTCAGG - Exonic
1166984184 19:46649697-46649719 CGCCACGGCGTGCAGGGGGCTGG + Exonic
1167503638 19:49860534-49860556 CATCCCTGTGAGCAGAGGCCTGG - Exonic
925532758 2:4883385-4883407 CGCCCCGGCCCCCTGAGGCCCGG - Intergenic
926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG + Exonic
927471895 2:23383913-23383935 AGCCAAGGAGAGCAGAGGCCTGG + Intergenic
927692171 2:25216050-25216072 CACCCCGGCGAGCAGAGCCGCGG + Intergenic
928089325 2:28364375-28364397 CGCCCTGGGAAGGAGAGGCCTGG - Intergenic
929539582 2:42809979-42810001 CGCCCCGGCCGGGCGAGGCCAGG - Intergenic
929777918 2:44939876-44939898 CTCCCCGGCCCTCAGAGGCCTGG + Intergenic
933751075 2:85602469-85602491 CGCCCAGGCGAGCGGGGGCCGGG - Intronic
933776178 2:85772473-85772495 CGCCACGGAGGGCAGAGGGCAGG + Intronic
936585669 2:113756142-113756164 CTCCCCGGGGAGCCGAGGCGAGG + Intronic
938018304 2:127885709-127885731 CGCCCCGGCGAGAACAGGCCCGG + Intronic
938407514 2:131040647-131040669 CGCTCCTGGGAGCAGAGGGCTGG + Intronic
940516848 2:154694151-154694173 AGCCCCGTTGTGCAGAGGCCAGG - Intergenic
942448381 2:176093024-176093046 CGTCCCGGCGAACACAGGCGCGG - Exonic
942450990 2:176107912-176107934 CGGCCCGGCGAACGGGGGCCCGG - Exonic
948192401 2:236070055-236070077 CGCCACAGCCAGCAGATGCCAGG - Intronic
948910252 2:240999101-240999123 GGGCCCGGCGGGCAGCGGCCGGG - Intronic
1169223829 20:3843644-3843666 CCCCCTGGAGAGCAGAGGTCAGG - Intergenic
1172516954 20:35541868-35541890 CGCCCCGGACAGCGGAGGCCGGG + Intergenic
1174405281 20:50298916-50298938 CACCCCGGCAGGCAGAGGCCTGG + Intergenic
1175108322 20:56629620-56629642 CGCCCCGCCGAGGACAGTCCGGG + Intronic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1176242195 20:64080212-64080234 GGCCCCGCCGAGCAGAGTCGGGG - Intronic
1179250676 21:39668699-39668721 TGCCCCAGCGAACAGAGCCCGGG - Exonic
1179375573 21:40847192-40847214 CGCCCCAGCGGCCAGAGGCAGGG - Intergenic
1179492234 21:41748137-41748159 GACACCGGCCAGCAGAGGCCTGG + Intronic
1180055781 21:45358545-45358567 CCCCCCGGGCAGCAGAGGCTCGG - Intergenic
1180109924 21:45643039-45643061 CGCCCCGCCCACCACAGGCCTGG + Intergenic
1180110184 21:45643820-45643842 CGGGCCGGCGGGGAGAGGCCGGG - Exonic
1181067441 22:20313521-20313543 CCCCTCGGGGAGCAGTGGCCGGG + Intergenic
1182804466 22:33058417-33058439 CGCCGCGGCGCGGGGAGGCCGGG - Intergenic
1183393694 22:37560278-37560300 CGGGGTGGCGAGCAGAGGCCTGG + Intergenic
1183441838 22:37827447-37827469 GGCCCTGGGGAGCAGTGGCCAGG - Intergenic
1183942101 22:41301794-41301816 AGCCCCGCGGGGCAGAGGCCGGG + Intronic
1184662600 22:45972285-45972307 CGCCTGGGCCAGCTGAGGCCGGG + Intronic
1185065383 22:48629345-48629367 AGCCCCGGGGTGCCGAGGCCAGG - Intronic
950681635 3:14588978-14589000 CACCCCACTGAGCAGAGGCCTGG + Intergenic
952354294 3:32570482-32570504 ATCCCCGGCGCGCCGAGGCCGGG - Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
960936071 3:122903436-122903458 GGCCCCAGTGAGCACAGGCCTGG + Intergenic
963786190 3:149536676-149536698 TGCCCCGGCGACCCGAGGCCAGG + Intronic
964815876 3:160717667-160717689 CGCCAAGACGGGCAGAGGCCAGG + Intergenic
965648320 3:170908259-170908281 CGCGCCAGCTAGCAGAGGGCCGG - Intronic
968262972 3:197339959-197339981 ATCCCAGGCGAGCAGAGTCCAGG - Intergenic
968479032 4:825852-825874 AGACCCGGGGAGCGGAGGCCGGG + Intronic
968479095 4:825996-826018 AGACCCGGGGAGCGGAGGCCGGG + Intronic
970913299 4:21304407-21304429 CGGCGCGGCGCGCAGAGTCCCGG - Intronic
978514893 4:109559726-109559748 CTCGCCAGCGAGCAGGGGCCCGG + Intergenic
985692848 5:1323211-1323233 CTGCCCGGGCAGCAGAGGCCGGG + Intronic
989379261 5:40797877-40797899 CGGCGCGGCCAGCACAGGCCGGG - Intronic
1002292413 5:178209024-178209046 AGCCCAGGGGAGCAGAGGACAGG - Intronic
1002541188 5:179907591-179907613 CGCCGCGACGCGCCGAGGCCGGG + Intronic
1003122494 6:3329594-3329616 CACACCGCCCAGCAGAGGCCGGG - Intronic
1004177639 6:13354010-13354032 AGTCCAGGAGAGCAGAGGCCAGG + Intergenic
1004562012 6:16760679-16760701 CGCCCCAGGGCGCCGAGGCCGGG + Intronic
1007697628 6:43743874-43743896 CTCCCAGGGTAGCAGAGGCCAGG - Intergenic
1007702921 6:43774919-43774941 CTCCCAGGCCAGCAGAGGGCTGG + Intronic
1011708832 6:90030311-90030333 CTCCCAGGGCAGCAGAGGCCTGG - Intronic
1017671952 6:156777655-156777677 CGCCGCGGCGTGGCGAGGCCGGG - Intergenic
1018434989 6:163751510-163751532 CGCCCTGGAGAACAGAGACCAGG - Intergenic
1019441757 7:1050997-1051019 CCCACAGGCCAGCAGAGGCCTGG + Intronic
1019529142 7:1494982-1495004 GGCCCCAGCGCTCAGAGGCCGGG + Intronic
1019639674 7:2096795-2096817 CACCCCGCCCAGCAGAGGCTGGG + Intronic
1019643482 7:2116829-2116851 CGCCCAGGCCTGCAGAGGCAGGG - Intronic
1020107113 7:5427316-5427338 TGCCCTGGCTAGCCGAGGCCCGG + Intergenic
1020211840 7:6163691-6163713 GGCCCTGGGGTGCAGAGGCCCGG - Exonic
1023610216 7:41965036-41965058 CGCCCCGGTCAGCAGATGCTTGG - Exonic
1023863448 7:44228221-44228243 AGCCCAGGTCAGCAGAGGCCAGG + Intronic
1025781254 7:64603727-64603749 CCCCCCTGTGAGCAGAGACCTGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1030193342 7:106831001-106831023 CAGCCCGGCGAGGAGCGGCCGGG - Intergenic
1033044303 7:137947489-137947511 AGCCCCGGAGGGCACAGGCCAGG - Intronic
1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG + Intronic
1034982843 7:155489681-155489703 GGCCCCCACGAGCAGGGGCCTGG + Intronic
1036803260 8:11808583-11808605 CGCCGCGGCGCCCAGGGGCCCGG + Intronic
1042151445 8:65790219-65790241 AGCCCTGGGGAGCAGAGGCCAGG + Intronic
1048833355 8:138496971-138496993 AGCCCCAGCGAGCAGGCGCCAGG + Intergenic
1048996027 8:139794179-139794201 AGCTCCTGAGAGCAGAGGCCTGG + Intronic
1049164225 8:141116635-141116657 CGCACCTGCGAGCTGGGGCCAGG - Intergenic
1049791196 8:144473424-144473446 CGCCTCTGCCAGCAGAGACCTGG - Exonic
1050874021 9:10613104-10613126 CGCTCCGGCGGGCGGGGGCCGGG + Intergenic
1053230118 9:36400938-36400960 CGCCTCGGCGATCACAGACCCGG + Intronic
1060555119 9:124504204-124504226 AGCCCCGGAGAGACGAGGCCGGG + Intronic
1061321818 9:129835613-129835635 CGGCCCGGTGAGCGGAGCCCGGG + Intronic
1061882897 9:133576924-133576946 GGCCCCGCCGGGCAGAGCCCTGG + Intergenic
1062381940 9:136290868-136290890 AGCTCCGGCGTGCAGAGGGCCGG - Exonic
1186496347 X:10015237-10015259 GGCCCGGGCGAGCAGGGGCAGGG - Intergenic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1190326224 X:49208648-49208670 AGCCCCGGCGAGCTGAGGGCTGG + Exonic
1201059934 Y:10036476-10036498 CGCCCCGGCTGGCAAAGGACTGG + Intergenic