ID: 1175859497

View in Genome Browser
Species Human (GRCh38)
Location 20:62142887-62142909
Sequence ACGCGCCCGGCCGGGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175859483_1175859497 12 Left 1175859483 20:62142852-62142874 CCCGGCCTCTGCTCGCCGGGGCG 0: 1
1: 0
2: 4
3: 13
4: 174
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859478_1175859497 18 Left 1175859478 20:62142846-62142868 CCCTCGCCCGGCCTCTGCTCGCC 0: 1
1: 0
2: 0
3: 20
4: 292
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859488_1175859497 -3 Left 1175859488 20:62142867-62142889 CCGGGGCGGCGGCGCGACCCACG 0: 1
1: 0
2: 3
3: 8
4: 99
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859476_1175859497 28 Left 1175859476 20:62142836-62142858 CCCAGAGCGGCCCTCGCCCGGCC 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859479_1175859497 17 Left 1175859479 20:62142847-62142869 CCTCGCCCGGCCTCTGCTCGCCG 0: 1
1: 0
2: 0
3: 59
4: 597
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859484_1175859497 11 Left 1175859484 20:62142853-62142875 CCGGCCTCTGCTCGCCGGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 199
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859487_1175859497 7 Left 1175859487 20:62142857-62142879 CCTCTGCTCGCCGGGGCGGCGGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179
1175859477_1175859497 27 Left 1175859477 20:62142837-62142859 CCAGAGCGGCCCTCGCCCGGCCT 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175859497 Original CRISPR ACGCGCCCGGCCGGGGCCAG GGG Intronic
900156733 1:1206168-1206190 CTGCTCCCGGCCGGGGCCACTGG + Intronic
900192816 1:1358643-1358665 AGGGGCCCGGCAGGAGCCAGAGG - Intronic
900329608 1:2127465-2127487 ACGGGCCCAGCCAGGACCAGAGG - Intronic
900518758 1:3095699-3095721 ACCCTCCTGGCCGAGGCCAGAGG - Intronic
900614616 1:3559722-3559744 ACTCGCCCGGCCGGGTACGGTGG + Intronic
901010505 1:6199246-6199268 AGGCCCCCGGCCGGGGTCCGAGG + Intronic
902770088 1:18640829-18640851 GCGCGCCGGGCCGGGGGCTGGGG + Intronic
903263359 1:22142934-22142956 GGGCGCCCGGCCCGGGGCAGCGG + Exonic
903830249 1:26170195-26170217 ACGAGCCCGGCCTGGGGCGGAGG + Intronic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
905449194 1:38046298-38046320 TCGCCCTCGCCCGGGGCCAGCGG - Exonic
905803859 1:40862176-40862198 GCTCCCCCGGCCCGGGCCAGCGG + Exonic
905933585 1:41806723-41806745 AGGCGCAGGGCCGGGGCCAGCGG + Intronic
906637008 1:47416479-47416501 CCGCGCCCGGCCCGGGGCGGCGG + Exonic
907540879 1:55214901-55214923 CCGGGCCCGGCGGGGGCCCGCGG - Exonic
911114890 1:94237208-94237230 AAGGGTCCGGCCGGGGCTAGGGG - Intronic
912717564 1:111992556-111992578 ACACACACGGCCAGGGCCAGAGG - Intergenic
914428616 1:147600240-147600262 CCCCGCGGGGCCGGGGCCAGCGG - Intronic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
915317037 1:155034484-155034506 ACTCGCCCGGCTGGCGCCACAGG - Exonic
916588248 1:166166467-166166489 GCGCGCCCTGCCGGAGCGAGGGG - Exonic
920165307 1:204031564-204031586 GTGCGCCCGGCAGGGGCCTGTGG + Intergenic
922503002 1:226110490-226110512 AAGCGGCCAGCCGAGGCCAGTGG - Intergenic
923152574 1:231246877-231246899 ACGCGCCCGGCCGAATCCAGTGG - Intronic
1062932621 10:1363043-1363065 ACGCGCCCGGCAGGGCCAGGAGG - Exonic
1063663611 10:8049570-8049592 GCCCGCGCAGCCGGGGCCAGCGG + Intergenic
1065533665 10:26697856-26697878 GCGCGCCCGGCGGGGCTCAGAGG + Intronic
1069191304 10:65494631-65494653 CCGCGCCCGGCCCGGACCAGTGG + Intergenic
1072757313 10:98030001-98030023 AGGCACTCGGCCGAGGCCAGTGG + Intronic
1076554338 10:131311913-131311935 CCGCGGCCGCCCGGGTCCAGGGG - Intergenic
1077090965 11:777944-777966 ACGCCCCCGTCCTGGGCCGGCGG - Intronic
1077091102 11:778627-778649 CCGCGCCCGGCGGAGGCCAGTGG - Intronic
1077502919 11:2917306-2917328 AAGAGCCCAGCCTGGGCCAGAGG + Intronic
1080540353 11:33258176-33258198 CCGCGCCTGGCCGGGGCCCGGGG + Intronic
1083289127 11:61680222-61680244 ACGCGCAGGGCCGGCGCCCGCGG + Intergenic
1083883092 11:65557989-65558011 GCGCGCCCGGGCGGGGCGAGGGG + Exonic
1084185525 11:67468973-67468995 TCCCGTCCGGCCGGGGGCAGGGG + Intronic
1084760185 11:71265989-71266011 ACGCTCCCTGCTGGGGGCAGGGG + Intergenic
1085157763 11:74311722-74311744 ACGGGCCGGGCCGGGGCCAGAGG - Intergenic
1088629002 11:111755919-111755941 CTGCTCCCGGCCGGGCCCAGTGG + Intronic
1096389628 12:51218186-51218208 TCCCGCTCGGCCAGGGCCAGAGG - Intergenic
1096391345 12:51231600-51231622 ACCCGGCCGGCCGGGCGCAGTGG + Intergenic
1101409406 12:104456749-104456771 CCGAGCCCGGCCGGGGACTGAGG + Intronic
1101910483 12:108857389-108857411 CCGCGCCCGGCCTGGGCCGCCGG - Intronic
1102680184 12:114685668-114685690 CAGCGCCCGGTCGGGGTCAGAGG + Intergenic
1103764404 12:123270932-123270954 ACGCTCCCGGCCGAGGCCCCCGG + Intronic
1103764615 12:123271491-123271513 GCGCGCCCGGCCCCGGCCCGGGG - Intronic
1104021243 12:124993815-124993837 AGGAGCCCGGCCCGGGCCAGGGG - Exonic
1104867394 12:131966100-131966122 ACCCGTCCGGCCGGGTGCAGTGG + Intronic
1104915785 12:132263774-132263796 ACGGGCCCAGCCGGTGCCTGTGG - Intronic
1105943406 13:25170686-25170708 GCGCGCCGAGCCGGGGCCCGGGG - Exonic
1112271807 13:97976203-97976225 GCGGGCCCGGCCGCGGCAAGGGG - Intronic
1117336418 14:54760368-54760390 ACCCCCTCGGCCGGGGCCAGCGG + Exonic
1119387624 14:74267671-74267693 ACAGGGCCGGCCAGGGCCAGGGG - Intergenic
1122502897 14:102213070-102213092 AGGTGCCAGGCCAGGGCCAGGGG + Intronic
1122739305 14:103862016-103862038 ACGGGTCCAGCTGGGGCCAGGGG + Intergenic
1123861934 15:24477286-24477308 AGGCTCCTGGGCGGGGCCAGGGG + Intergenic
1125535863 15:40441053-40441075 GCGCGCCTGGCCGGGGCGGGCGG - Intronic
1125535930 15:40441210-40441232 TCCAGCCCGGCCGGGGCCTGCGG + Exonic
1127480423 15:59372398-59372420 GGGCGCGCTGCCGGGGCCAGGGG - Intronic
1128944613 15:71812050-71812072 CTGCGCCCTGCCGGGGCCGGGGG - Exonic
1131272810 15:90957204-90957226 GCGCGCCGGGCCGGGGCCGGAGG + Exonic
1131582391 15:93657461-93657483 ACGCATCCGGCCGGGTGCAGTGG - Intergenic
1132842368 16:1984316-1984338 ACGCGCGGGGCCGGGGCGCGGGG + Exonic
1136351525 16:29711677-29711699 CCACGCCCAGCCGGGGGCAGTGG - Intergenic
1136891519 16:33975573-33975595 CCGGCCCCGGCCGGGGCCCGCGG - Intergenic
1140288084 16:73623321-73623343 ATGTGCCCGGCCGGGCGCAGTGG - Intergenic
1140481818 16:75266211-75266233 AGGAGCCCGGCCAGGGCCACAGG - Intronic
1141116817 16:81315685-81315707 GCGGGCCCGGCCTGGGCGAGGGG - Intronic
1203081513 16_KI270728v1_random:1148033-1148055 CCGGCCCCGGCCGGGGCCCGCGG + Intergenic
1142623798 17:1180109-1180131 ACGCCCCCGGCCGGGCTAAGGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG + Intergenic
1144816696 17:18039910-18039932 CCGGGCCGGGCCGGGGCCCGAGG + Intronic
1145248262 17:21283942-21283964 AGGCGCCCGGCCAGGGCGCGGGG - Intergenic
1145878280 17:28335917-28335939 GCGAGCCCGGCCGGGTCCTGGGG + Intronic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1146339675 17:32007864-32007886 ACGGGCCCGGCGGGGGCGCGGGG + Intronic
1146909906 17:36641833-36641855 GCGAGCCGGGCCTGGGCCAGGGG - Intergenic
1148332183 17:46819491-46819513 ACGCCTCCGACCCGGGCCAGAGG - Intronic
1148818229 17:50346003-50346025 GCGCGCCGGGGCGGGGCCGGGGG - Intergenic
1149891338 17:60392413-60392435 AGGCGCCCGGGCGGGGCGCGCGG - Intronic
1151589686 17:75034977-75034999 AGGCGGGCGGCTGGGGCCAGAGG + Intronic
1151765842 17:76132748-76132770 GCGCTCCCGGCAGGGGGCAGTGG - Intergenic
1151854408 17:76710792-76710814 GCGCCCCCGGCCGAGGCCACCGG - Exonic
1151960625 17:77403574-77403596 ACGATCCCTGCTGGGGCCAGGGG - Intronic
1152551059 17:81030514-81030536 AGGGGCCCGGCCGGGCACAGTGG - Intergenic
1152625653 17:81386931-81386953 CCGCCCCCGGCCGGCGCAAGTGG - Intergenic
1152883333 17:82832988-82833010 AAGCGCCCTGCCGGGGGCTGAGG + Intronic
1153688122 18:7566956-7566978 GCGCGGCCGGGCGGGACCAGCGG - Exonic
1153772047 18:8424231-8424253 ACGCTCACGGCCGGGCGCAGTGG + Intergenic
1157849101 18:51030644-51030666 GCGGGCCCGGCCGGGGGAAGGGG - Intronic
1160204573 18:76822490-76822512 GCGCGCCCAGCCGGCGCTAGAGG - Intergenic
1160662736 19:308611-308633 GCGCGGACGGCCGGGGCCATCGG + Exonic
1160822111 19:1063545-1063567 ACGCGCCAGGCCCGAGCCAGCGG - Exonic
1160875775 19:1295639-1295661 ATGCGCTCGGCCGGCGGCAGCGG - Exonic
1160935521 19:1592769-1592791 GCGCGCCCGGCTGGGGGCGGAGG - Intronic
1161112692 19:2478984-2479006 ACGCTCCCAGCCCGGGGCAGGGG - Intergenic
1161205073 19:3036551-3036573 ACCCGCGAGCCCGGGGCCAGCGG - Intronic
1161293530 19:3507899-3507921 AGGCGCCGGGCAGCGGCCAGTGG - Intronic
1161398145 19:4055530-4055552 CCGCGCCAGGCCGAGGCCAGGGG - Intronic
1161752289 19:6107003-6107025 CCGCGCCCGGCCGGCACCTGTGG - Intronic
1162940543 19:14006345-14006367 ACGCGCGGGGGCGGGGCCCGGGG + Intronic
1163085882 19:14979593-14979615 AAGCGCCCGGCCGGGGCCGCGGG + Intronic
1163314975 19:16535549-16535571 ATGGGCGCGGCGGGGGCCAGCGG + Exonic
1163557519 19:18001150-18001172 ACGCGCCCGCCCTGGGCCACCGG + Intronic
1163586916 19:18169260-18169282 AGGCGGCGGGCCGGGGCCCGGGG - Exonic
1163666664 19:18606830-18606852 GCGGGGCCGGGCGGGGCCAGCGG - Exonic
1165058632 19:33194452-33194474 CCGCGGCCGGCCTGGGCCCGGGG - Intronic
1165431427 19:35775623-35775645 TCGAGCGCGGCCGGGGCCTGAGG + Exonic
1166219102 19:41353832-41353854 AGGGCCCCGGCCGGGGGCAGGGG - Exonic
928964980 2:36966809-36966831 CCGCGCCCAGCCGGCCCCAGAGG - Intergenic
929075722 2:38077225-38077247 ACGCGCCCGGGCTCGGCCTGCGG - Intronic
935149115 2:100417686-100417708 ACGCGCACGGCCGGGGACGGCGG - Intergenic
935645425 2:105329949-105329971 ACGCTCTCGCCCGGGGCCGGCGG - Exonic
936279009 2:111122081-111122103 ACGTGCGCGTCCGCGGCCAGGGG + Intronic
937135035 2:119544746-119544768 AGGCGCTTGGCCGGGGCGAGAGG + Intronic
941104916 2:161341172-161341194 GCGCCCCCGGCCGAGGCCACCGG - Intronic
942448255 2:176092615-176092637 ACGCCCCCGGCGGGGGCCCTCGG + Intergenic
942459105 2:176157416-176157438 CCGCGCCCGCCGGGGGCCGGGGG - Intronic
948988677 2:241541169-241541191 ACGACACCGGCCGCGGCCAGGGG + Intergenic
1172581322 20:36050871-36050893 ACCCGCCGGCCCGGGGCCGGAGG + Intergenic
1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG + Intronic
1176096731 20:63347737-63347759 ACCCTCACGGCCGGGCCCAGAGG - Intronic
1176157895 20:63631713-63631735 AGTCTCCCGGCCGGGGGCAGTGG + Intergenic
1176247126 20:64102613-64102635 AGACGCCCGGCTGGGGCCGGAGG + Intergenic
1176555783 21:8253474-8253496 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176574720 21:8436508-8436530 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176611334 21:8987801-8987823 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176839533 21:13827558-13827580 AGGCGACTGCCCGGGGCCAGTGG + Intergenic
1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG + Intergenic
1181532147 22:23522806-23522828 ACCAGCCCGGCCGGGCCCCGCGG + Intergenic
1181665286 22:24391160-24391182 ACAGGCCCGGCCGGGCGCAGTGG - Intronic
1184548242 22:45188635-45188657 GCAAGCCCGGCCGGGCCCAGTGG + Intergenic
1184640494 22:45867658-45867680 GCGCGCCGGGCCGCGGGCAGAGG - Intergenic
1185065108 22:48628222-48628244 ACGCGCCTGGCCTGGGCCTGTGG - Intronic
1185286200 22:50000908-50000930 ACGGCCCCGTCCGGAGCCAGGGG - Intronic
1203252768 22_KI270733v1_random:125559-125581 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203260824 22_KI270733v1_random:170645-170667 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
949598929 3:5577797-5577819 CCGCGCCCGGCCGGGGTTAGTGG + Intergenic
953908902 3:46882227-46882249 AGGCGCCCGGCCGGGGAGAAGGG + Intronic
954334907 3:49910587-49910609 TCGCGCACGGCCGCCGCCAGGGG + Exonic
954558829 3:51538938-51538960 TCGCTCCCGGCCGGGGCCGCCGG + Intergenic
954799359 3:53178357-53178379 AGGCGGCCGGGCGGGACCAGCGG - Intronic
962738784 3:138348382-138348404 GCGCGCCCTGCCGGGCCCAGGGG + Intronic
963160749 3:142149120-142149142 ACGCGCCCGGCCGGGTCCAAAGG + Intronic
969053199 4:4386864-4386886 ACGCGCCCGCCCTGAGCCGGGGG - Exonic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
975689401 4:76949581-76949603 AGCCCCGCGGCCGGGGCCAGTGG + Intergenic
985649915 5:1102651-1102673 AGGCGCCGGGCCTGGGGCAGGGG + Intronic
985881123 5:2640111-2640133 AGGGGCTCGGCCGGGGGCAGTGG - Intergenic
986402853 5:7396226-7396248 ACGCGGGCGGCCGCGGCGAGCGG + Exonic
987989418 5:25190929-25190951 ATCCGCCGGCCCGGGGCCAGAGG + Intergenic
988489147 5:31692237-31692259 ACTCGCCCGGCCGGCCCCACCGG - Intronic
988564916 5:32312999-32313021 ACGGGCCTGGGCGGGGCGAGCGG - Exonic
990493357 5:56322773-56322795 TCTCGCCCGGCCGGGTACAGTGG - Intergenic
996329334 5:122312008-122312030 GGGCGCCCGGCCGGGGACGGGGG - Intronic
997239182 5:132294362-132294384 CCGCGCCCGGCCGGGGATGGGGG + Intronic
1001399576 5:171438509-171438531 AAGTGCCTGGGCGGGGCCAGTGG + Intronic
1002524120 5:179806282-179806304 ACGGGCGCGGCCCGGGCCCGAGG + Intronic
1004633368 6:17443002-17443024 ATGGGGCCAGCCGGGGCCAGTGG - Intronic
1004861001 6:19804780-19804802 GACCGCCCGGCCGGCGCCAGCGG + Intergenic
1006271653 6:32970502-32970524 ACGAGCCCTTCCGGGGCGAGGGG + Intronic
1007902268 6:45422975-45422997 CCGCTCCCGGCCGGGGGCGGGGG - Intronic
1010083251 6:71887311-71887333 AGGCGCCCGCCTTGGGCCAGGGG + Intronic
1013099430 6:106974700-106974722 CTGCGCCCGCCCGGAGCCAGCGG - Intronic
1016590084 6:145735091-145735113 ACGCGCGCCGCCGGGGCCTGCGG + Intronic
1016596979 6:145814454-145814476 ACGGGCCCGGCCTGGAGCAGAGG - Intronic
1018876596 6:167827088-167827110 CCGCGCGGGGCCGGGGCCGGAGG - Exonic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1019767135 7:2859859-2859881 ACACGCTCGGTCGGGCCCAGTGG - Intergenic
1026935770 7:74254447-74254469 TCGCGCCCGGCGGAAGCCAGGGG - Intronic
1027132273 7:75599387-75599409 AGGCGCCCAGCTGGGGGCAGAGG + Intronic
1027431571 7:78119270-78119292 ACGACACCGGCCGGGGGCAGTGG + Intronic
1029693216 7:102196271-102196293 GCTCCTCCGGCCGGGGCCAGCGG + Intronic
1034469847 7:151249214-151249236 TCGCGCCTGCCCGGGGCCGGCGG + Intronic
1034951235 7:155298117-155298139 GTGCGCCCGCCCGGGGCCAGCGG - Intronic
1038554182 8:28494763-28494785 AGGGGCCCGGCCGGAGCCGGCGG + Intronic
1049637078 8:143694819-143694841 ACGTGCCAGGCCGGGCTCAGAGG + Exonic
1053210582 9:36224037-36224059 AGGGGCCCGGCCGGGGGCAGTGG - Intronic
1057790057 9:98118885-98118907 GCGTGCCTGGCCGTGGCCAGTGG - Intronic
1059392581 9:114008408-114008430 AGGAGCCCAGCCGGGGACAGGGG - Intronic
1060480366 9:124013721-124013743 AGGAGCCCGGCCTGGGCCCGTGG + Intronic
1060554961 9:124503484-124503506 ACGCGACGGGCCGGCGACAGCGG - Intronic
1060555380 9:124504984-124505006 ACCCGCCGCGCCGGGGCCGGGGG + Intronic
1061559442 9:131393727-131393749 ATGGGCCCGGCCTGGGCCCGGGG - Intergenic
1062425014 9:136502148-136502170 CCACGCCAGGCCCGGGCCAGGGG - Intronic
1062596506 9:137302168-137302190 CCGGGCCCGGCCGGGGACGGCGG + Exonic
1203775962 EBV:73385-73407 AGGCCACCTGCCGGGGCCAGTGG - Intergenic
1203776057 EBV:73800-73822 ACGAGATCGGCCGAGGCCAGGGG + Intergenic
1203469171 Un_GL000220v1:108710-108732 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203476992 Un_GL000220v1:152682-152704 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1185623197 X:1465863-1465885 AGGCGCACGGCCGGGAGCAGCGG - Exonic
1190222542 X:48521699-48521721 ACGCGCGGGGGCGGGGCTAGAGG + Exonic
1190334678 X:49255235-49255257 CCACGCCCAGCCGGGGTCAGAGG + Intronic
1190596808 X:52059946-52059968 AGGCCCCAGGCCGGGGGCAGGGG + Intergenic
1190612016 X:52194127-52194149 AGGCCCCAGGCCGGGGGCAGGGG - Intergenic
1194500858 X:94679260-94679282 ATGGGCCTGCCCGGGGCCAGAGG - Intergenic
1196890560 X:120286907-120286929 AGGCTCCCGGCTGGGGTCAGAGG + Intronic
1198205320 X:134460089-134460111 AGGCGCGCGGGCGGGGCCGGGGG + Intergenic
1199772775 X:150984533-150984555 ACGCGCGGGGCCGGGGGCGGCGG - Intronic
1201895883 Y:18992763-18992785 CTGCGCCCGCCCGGAGCCAGCGG - Intergenic