ID: 1175859596

View in Genome Browser
Species Human (GRCh38)
Location 20:62143234-62143256
Sequence CTTCCAAGTGGAGTACGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175859596_1175859602 2 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859602 20:62143259-62143281 GTGGCCGTCGGGCGAGAAGACGG 0: 1
1: 0
2: 0
3: 1
4: 58
1175859596_1175859604 8 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 77
1175859596_1175859606 29 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859606 20:62143286-62143308 GGCGCGGTCGTAGCTCATGCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1175859596_1175859605 13 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859605 20:62143270-62143292 GCGAGAAGACGGTGATGGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 82
1175859596_1175859601 -9 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859601 20:62143248-62143270 ACTTGGAAGAGGTGGCCGTCGGG 0: 1
1: 0
2: 0
3: 7
4: 95
1175859596_1175859600 -10 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859600 20:62143247-62143269 CACTTGGAAGAGGTGGCCGTCGG 0: 1
1: 0
2: 3
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175859596 Original CRISPR CTTCCAAGTGGAGTACGCGC AGG (reversed) Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
906720222 1:47998624-47998646 CTTCCAAGCGGAGGAAGAGCAGG + Intergenic
918881067 1:190122074-190122096 CTTACAAGTGGAGTTCTCACAGG - Intronic
1105268279 13:18843233-18843255 CTTCCAAGTGGCGTATGAGCTGG - Intergenic
1110467212 13:75815540-75815562 CTTCCAAGTGGAGAATGAACAGG + Intronic
1115592041 14:34874317-34874339 CCTCCACCTGGAGAACGCGCGGG - Intronic
1202831034 14_GL000009v2_random:30759-30781 CTTCCAAGTGGCATATGAGCTGG + Intergenic
1152580216 17:81162495-81162517 CTTCCAAGGGGAGGACTCCCGGG + Intronic
1154419741 18:14216795-14216817 CTTCCAAGTGGCATATGAGCTGG + Intergenic
1159897217 18:74008644-74008666 CTTCCCAGTGGAGTTTGTGCTGG + Intergenic
1163015146 19:14450370-14450392 CTTCCGAGTGGAGCACGCGGTGG + Exonic
1164119960 19:22257191-22257213 CTTCCCAGTGGACTAGGCCCAGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1168411083 19:56140921-56140943 CTTCCCAGTGGTCTGCGCGCGGG - Intronic
1202641662 1_KI270706v1_random:97013-97035 CTTCCAAGTGGCATATGAGCTGG - Intergenic
925577729 2:5377887-5377909 TTTCCAAGTTGAGTACGCTCAGG + Intergenic
925928283 2:8685705-8685727 CGTCCGAGCGGACTACGCGCGGG - Intergenic
927810238 2:26176336-26176358 CTTCCCAGGGGAGTACGCCGAGG + Exonic
934497486 2:94820459-94820481 CTTCCAAGTGGCGTATGAGCTGG - Intergenic
1170657671 20:18305004-18305026 CTTCCAAATGGAGGACACACTGG - Intronic
1170757189 20:19214494-19214516 ATTCCTAGTGGATTACACGCTGG + Intronic
1171888778 20:30687206-30687228 CTTCCAAGTGGCATATGAGCTGG - Intergenic
1173245588 20:41335384-41335406 CTTCCAGGTGGAGTAAATGCTGG - Intergenic
1175859596 20:62143234-62143256 CTTCCAAGTGGAGTACGCGCAGG - Exonic
1176610222 21:8875598-8875620 CTTCCAAGTGGCATATGAGCTGG + Intergenic
1176853554 21:13942500-13942522 CTTCCAAGTGGCATATGAGCTGG - Intergenic
1180360280 22:11884845-11884867 CTTCCAAGTGGCATATGAGCTGG + Intergenic
953232161 3:41074847-41074869 CTTCCATGTGGAGTAGGCAGTGG - Intergenic
964990310 3:162802679-162802701 CTTCCATGGTGAGTACGCTCTGG - Intergenic
1202736904 3_GL000221v1_random:10385-10407 CTTCCAAGTGGCATATGAGCTGG + Intergenic
973385175 4:49507529-49507551 CTTCCAAGTGGCATATGAGCTGG - Intergenic
1202769036 4_GL000008v2_random:182887-182909 CTTCCAAGTGGCATATGAGCTGG - Intergenic
985673333 5:1217665-1217687 CCTCCAAGTGCAGGATGCGCAGG + Intronic
1001128722 5:169045406-169045428 CTTCCAAGTGTAGTCCATGCAGG + Intronic
1005711996 6:28511885-28511907 CTCCCACGTGGAATTCGCGCTGG - Intronic
1012709552 6:102581972-102581994 GTTCCAGGTGGAGTACACACCGG + Intergenic
1014238234 6:118985410-118985432 CTTCCAAGATGAGTACGCCAAGG + Intronic
1016472302 6:144387639-144387661 CTTCCAAGTGGAAAACCCACTGG + Intronic
1053659659 9:40260009-40260031 CTTCCAAGTGGCGTATGAGCTGG + Intronic
1053910029 9:42889362-42889384 CTTCCAAGTGGCGTATGAGCTGG + Intergenic
1054360669 9:64112758-64112780 CTTCCAAGTGGCATATGAGCTGG + Intergenic
1054371787 9:64406309-64406331 CTTCCAAGTGGCGTATGAGCTGG + Intronic
1054524939 9:66116207-66116229 CTTCCAAGTGGCGTATGAGCTGG - Intronic
1054679406 9:67896025-67896047 CTTCCAAGTGGCGTATGAGCTGG + Intronic
1058991272 9:110256711-110256733 CTTCCAGCTGGAGTGCGAGCTGG - Intergenic
1059686751 9:116645173-116645195 CTTCCAAGTGGAGGAGGCAGAGG - Intronic
1203693916 Un_GL000214v1:76602-76624 CTTCCAAGTGGCATATGAGCTGG - Intergenic
1203705629 Un_KI270742v1:40829-40851 CTTCCAAGTGGCATATGAGCTGG + Intergenic
1203558368 Un_KI270744v1:24982-25004 CTTCCAAGTGGCATATGAGCTGG - Intergenic
1203642357 Un_KI270751v1:27461-27483 CTTCCAAGTGGCATATGAGCTGG + Intergenic
1188161479 X:26809596-26809618 CTTCCAAGTGGAGTAGATGGAGG - Intergenic